Populus tomentosa PtoYABBY2 gene and application thereof

By using transgenic technology based on the PtoYABBY2 gene of Populus tomentosa, the flowering time was regulated, solving the problems of long breeding cycle and environmental factors in Populus tomentosa, and achieving efficient breeding and regulation of flowering time.

CN120944897APending Publication Date: 2025-11-14BEIJING FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511002058.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-21
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

The breeding cycle of Populus tomentosa is long, traditional breeding methods are inefficient, and the pollen shedding of male trees and the flying of catkins from female trees cause environmental problems, affecting research on the regulation of flowering time.

Method used

Using genetic engineering techniques, the PtoYABBY2 gene of Populus tomentosa was used to construct an expression vector, regulate the flowering time of the plant, and shorten the breeding cycle.

Benefits of technology

It can significantly shorten the breeding cycle of Populus tomentosa, promote the cultivation of high-yield varieties, improve breeding efficiency, solve environmental problems, and provide a theoretical basis for regulating flowering time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944897A_ABST
    Figure CN120944897A_ABST
Patent Text Reader

Abstract

The invention relates to a populus tomentosa PtoYABBY2 gene and application thereof, and belongs to the field of plant genetic engineering. The nucleotide sequence of the gene is as shown in Seq ID NO.1, and the gene encodes a protein of Seq ID NO.2. The gene can obviously advance the flowering time of plants by regulating and controlling key factors (such as up-regulation of AtFT and the like and inhibition of AtFLC) of a flowering pathway. Through overexpression of the PtoYABBY2 in arabidopsis thaliana, the flowering time can be advanced by about 4 days on average, and floral organs grow normally. The gene shows tissue specific expression (mature leaves > young leaves > stems / roots) and dynamic expression in a flower bud development stage in populus tomentosa. The invention provides a construction method of a cloning primer, a fluorescent quantitative primer and an overexpression vector. The invention also discloses a method for cultivating populus tomentosa varieties with different flowering time by using the gene. By applying the gene, the breeding cycle of populus tomentosa can be shortened, the problems of long juvenile phase and flying catkins pollution are solved, and a new tool is provided for forest molecular design breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, and relates to a gene that affects the flowering time of plants, the protein encoded by the gene, an expression vector containing the gene, a primer set for cloning the gene from plant DNA, and the use of the gene. Background Technology

[0002] Populus tomentosa (scientific name: Populus tomentosa) Populus tomentosa Populus tomentosa (also known as the white poplar) is a tree belonging to the Salicaceae family and the Populus genus. It can grow up to 30 meters tall, with dark gray bark when young. A native species of poplar endemic to China, Populus tomentosa is prized for its upright and beautiful shape, rapid growth, excellent timber quality, and strong adaptability. It has long been a primary tree species for fast-growing timber forests, farmland shelterbelts, and urban and rural greening projects. However, the pollen shedding of male Populus tomentosa and the catkins produced by females in spring cause significant environmental problems and, due to its long juvenile stage, limits research into genetic breeding.

[0003] Flowering time determines a crop's adaptability to different local environments, influencing the quantity and quality of fruits and seeds, as well as reproductive success. Members of the YAB2 subfamily participate in the formation of apico-apic axis characteristics of leaves, regulate floral organ and leaf development, modulate flowering time, and respond to abiotic stresses, playing crucial roles in both vegetative and reproductive growth. As a typical perennial tree, the molecular-level flowering regulation mechanism of Populus tomentosa has been extensively studied. YABBY Gene families play an important role in the vegetative and reproductive growth of plants. Among them, members of the YAB2 subclass affect the development of plant floral organs and regulate the timing of flowering.

[0004] Research on flower development in Populus tomentosa is helpful in constructing a complete molecular regulatory network for poplar flower development. This is of great significance for shortening the breeding cycle of Populus tomentosa, promoting its growth and development, increasing its biomass accumulation, and improving its economic benefits. This study aims to advance the flowering time of Populus tomentosa through genetic engineering, which has important theoretical and practical significance for the improvement of Populus tomentosa varieties. Summary of the Invention

[0005] Therefore, the present invention aims to provide a novel poplar tree. PtoYABBY2 This invention focuses on a gene that plays a significant role in regulating flowering time in plants, contributing to the development of molecular genetic breeding techniques for Populus tomentosa. PtoYABBY2 This gene is one that can advance the flowering time of plants. Through transgenic technology, PtoYABBY2 The application of genes is expected to shorten the breeding cycle of Populus tomentosa and promote the development of high-yielding varieties. Furthermore, this invention also relates to… PtoYABBY2This involves multiple aspects, including gene cloning, expression vector construction, and gene expression pattern analysis, to provide a deeper understanding. PtoYABBY2 The functions and applications of genes provide scientific evidence.

[0006] Through long-term exploration and experimentation, and continuous reform and innovation, the inventor has provided a technical solution to solve the above-mentioned technical problems: a method for providing a Populus tomentosa. PtoYABBY2 Genes, expressed in plants to regulate flowering time, are described PtoYABBY2 Genes contain nucleotide sequences selected from the following group: A. The nucleotide sequence shown in Seq ID NO.1 of the sequence listing; B. The nucleotide sequence of the amino acid sequence shown in Seq ID NO.2 of the coding sequence listing.

[0007] The present invention also provides a method for obtaining the aforementioned poplar tree. PtoYABBY2 A gene-encoded protein, the amino acid sequence of which is selected from the amino acid sequence shown in Sequence Listing SeqID NO.2.

[0008] The present invention also provides a method for cloning the aforementioned Populus tomentosa. PtoYABBY2 The primer pairs for the gene, the base sequences of which are as follows: First upstream primer F: 5'-ATGCATCACATAAACGAAAGGAAA-3', First downstream primer R: 5'-TCACAGGGAGCCATTGATCTCGTA-3'; And selectively containing a second upstream primer F and a second downstream primer R with restriction enzyme sites: Second upstream primer F: 5'-AGACAGGGGGACTCTTGACATGCATCACATAAACGAAAGGAAA-3'. Second downstream primer R: 5'- GGGGAAATTCGAGCTGGTCACTCACAGGGAGCCATTGATCTCGTA -3'.

[0009] The present invention also provides a poplar tree. PtoYABBY2 The quantitative fluorescence primer pair for the gene, the base sequence of which is as follows: Third upstream primer F: 5'-CTTTTGGACTGAAGCTGGACA-3', Third downstream primer R: 5'-TCACAGGGAGCCATTGAT-3'.

[0010] The present invention also provides a method containing the aforementioned Populus tomentosa. PtoYABBY2The gene expression vector pCAMBIA1301 was obtained by double digestion of the pCAMBIA1301 vector plasmid with restriction endonucleases BstE II-HF and Ncol-HF, followed by vector ligation using the ClonExpress® II One Step Cloning Kit. PtoYABBY2.

[0011] The present invention also provides the aforementioned Populus tomentosa. PtoYABBY2 The gene is used to breed new varieties of Populus tomentosa with different flowering times.

[0012] The present invention also provides a method for cultivating new plant varieties, utilizing the aforementioned PtoYABBY2 Genetic regulation of flowering time can be used to obtain new varieties with desired flowering characteristics.

[0013] The present invention also provides a method for transgenic plants, comprising introducing the expression vector into plant cells to alter the flowering time of the plant.

[0014] This invention also provides a method for analyzing gene expression patterns related to the regulation of flowering time in plants, by measuring gene expression patterns at different developmental stages. PtoYABBY2 Gene expression levels were analyzed to understand the regulatory mechanisms of plant flowering time.

[0015] The present invention also provides a method for determining the expression level of genes related to flowering time regulation, using the aforementioned quantitative fluorescent primer pair to quantitatively analyze the expression level of genes related to flowering time regulation in transgenic plants.

[0016] Compared with the prior art, one of the above technical solutions has the following advantages: Populus tomentosa of the present invention PtoYABBY2 Genes have shown significant effects in regulating plant flowering time. Through the application of transgenic technology, PtoYABBY2 Genes can induce plants to enter the flowering stage earlier. Experiments in the model plant Arabidopsis thaliana showed that the flowering time of transgenic plants differed significantly from that of the wild type, thus proving this characteristic. PtoYABBY2 The potential of genes to shorten the plant growth and development cycle. (After genetic modification) PtoYABBY2 Whole plant observation and flowering time difference analysis of Arabidopsis thaliana. PtoYABBY2 Genes can advance the flowering time of plants to varying degrees. The flowering time of transgenic Arabidopsis plants differs significantly from that of wild-type plants, which is beneficial to accelerate the breeding cycle of Populus tomentosa and speed up the cultivation of varieties with superior traits.

[0017] PtoYABBY2 The application of genes has revolutionized the breeding of plants such as Populus tomentosa. Traditional breeding methods are time-consuming and inefficient, while... PtoYABBY2 The utilization of genes can significantly shorten this cycle and accelerate the breeding process of new varieties. This not only improves the efficiency of breeding work, but also provides agricultural producers and related industries with the possibility of realizing economic benefits more quickly, and enhances the market competitiveness of plant varieties.

[0018] Furthermore, through in-depth research PtoYABBY2 The functions and mechanisms of action of genes can provide a new theoretical and practical basis for the molecular regulation of flowering time in plants, and further promote the development of plant science and molecular design breeding. Attached Figure Description

[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.

[0020] Figure 1 yes PtoYABBY2 Cloning electrophoresis diagram of a gene.

[0021] Figure 2 These are the results of a phylogenetic analysis of YABBY2 subclass proteins from different species.

[0022] Figure 3 This is the result of amino acid sequence alignment analysis of PtoYABBY2.

[0023] Figure 4 yes PtoYABBY2 Predicted tertiary structure diagram of protein.

[0024] Figure 5 It is the process of the development of male and female flower buds in 8 stages. PtoYABBY2 The results of the expression pattern analysis.

[0025] Figure 6 It is different parts of the poplar PtoYABBY2 The results of the expression pattern analysis.

[0026] Figure 7 It is 35S:: PtoYABBY2 Subcellular localization results.

[0027] Figure 8 It is 35S:: PtoYABBY2 Identification results of transgenic plants.

[0028] Figure 9 It is wild type and 35S:: PtoYABBY2 Comparison of flowering time and phenotypic observation of transgenic lines.

[0029] Figure 10 This is a graph showing the expression levels of genes related to regulating flowering time in Arabidopsis thaliana flower tissue. Detailed Implementation

[0030] The following description, in conjunction with the accompanying drawings and specific embodiments, will be provided.

[0031] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention.

[0032] Example 1 The poplar described in this embodiment PtoYABBY2 The gene, whose nucleotide sequence is shown in Sequence Listing Seq ID NO.1, encodes the amino acid sequence shown in Sequence Listing Seq ID NO.2. The CDS sequence is shown in Sequence Listing Seq ID NO.1.

[0033] Populus tomentosa PtoYABBY2 The gene was expressed in plants, particularly Populus tomentosa, and functional verification and transgenic verification in Arabidopsis thaliana showed that the gene can significantly regulate the flowering time of plants. Using Populus tomentosa... PtoYABBY2 Genes can shorten the breeding cycle of Populus tomentosa and accelerate the development of high-yield Populus tomentosa varieties.

[0034] Example 2 The cloned poplar described in this embodiment PtoYABBY2 Primer pairs for cloning the Populus tomentosa described in Example 1. PtoYABBY2 The gene, and the base sequence of the primer pair are as follows: First upstream primer F: 5'-ATGCATCACATAAACGAAAGGAAA-3', First downstream primer R: 5'-TCACAGGGAGCCATTGATCTCGTA-3'; The first upstream primer F is shown in Seq ID NO.3 of the sequence listing, and the first downstream primer R is shown in Seq ID NO.4 of the sequence listing.

[0035] Example 3 The cloned poplar described in this embodiment PtoYABBY2 The primer pairs for the gene were obtained by adding restriction enzyme sites to the primer pairs described in Example 2, resulting in the second upstream primer F as shown in Sequence Listing Seq ID NO. 5 and the second downstream primer R as shown in Sequence Listing Seq ID NO. 6. The base sequences of the primer pairs including the restriction enzyme sites are as follows: Second upstream primer F: 5'-AGACAGGGGGACTCTTGACATGCATCACATAAACGAAAGGAAA-3'. Second downstream primer R: 5'- GGGGAAATTCGAGCTGGTCACTCACAGGGAGCCATTGATCTCGTA -3'.

[0036] The cloning primer sequences were designed using Primer3plus (https: / / www.primer3plus.com / ) and then sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for synthesis.

[0037] Example 4 The poplar described in this embodiment PtoYABBY2 A quantitative fluorescent primer pair for gene analysis, used to detect Populus tomentosa. PtoYABBY2 For the quantitative analysis of the gene, the base sequences of the fluorescent quantitative primer pairs are shown in Seq ID NO.7 and Seq ID NO.8 of the sequence listing: Third upstream primer F: 5'-CTTTTGGACTGAAGCTGGACA-3', Third downstream primer R: 5'-TCACAGGGAGCCATTGAT-3'.

[0038] The primer sequences for quantitative fluorescence were designed using Primer3plus (https: / / www.primer3plus.com / ) and then synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd.

[0039] Example 5 This embodiment is an example of using the primers described in Examples 3 and 4 to verify the nucleotide sequence and amino acid sequence described in Example 1.

[0040] In this embodiment, three Populus tomentosa trees of uniform growth, cultivated by the National Engineering Laboratory for Forest Breeding, were selected as the experimental materials. Populus tomentosaTissue culture seedlings (TC1521), female Populus tomentosa planted in the campus of Beijing Forestry University in Haidian District, Beijing, and male Populus tomentosa planted in the Xiaoyue River Basin in Haidian District, Beijing were sampled three times in a biological replicate. Roots, stems, young leaves, mature leaves, and male and female flower buds at different developmental stages were sampled from the same parts. After sampling, the samples were quickly placed in cryovials and frozen in liquid nitrogen, and then stored in a -80°C freezer for subsequent RNA extraction.

[0041] The eight stages of male and female flower bud development in Populus tomentosa are: flowering induction stage S1, flower primordium formation stage S2, organogenesis stage S3, elongation stage S4, spore formation stage S5, dormancy stage S6 & 7, and microspore formation stage S8.

[0042] After preliminary experimental screening, this embodiment ultimately used cDNA material from mature leaves of Populus tomentosa as a template for PCR amplification. The primers used were those described in Example 3. PtoYABBY2 The gene cloning reaction system is shown in Table 1 below. The reaction program was: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for 34 cycles, with a final extension at 72℃ for 5 min, and storage at 4℃. PCR products were separated by 1% agarose gel electrophoresis, and the cleaned target fragment was recovered using a DNA gel electrophoresis kit. The entire process was performed on ice.

[0043] Table 1. TA Cloning PCR Sequence Amplification System

[0044] Add the adhesive-terminated poly(A) tail to the recycled adhesive product and connect it in a metal bath at 72°C for 30 min. The reaction system is shown in Table 2.

[0045] Table 2 T-clone ligation vector system

[0046] The ligation product was ligated to the T support, and the reaction system is shown in Table 3.

[0047] Table 3 T-clone ligation vector system

[0048] The cells were incubated in a metal bath at 16°C for 2 hours. After the reaction, the cells were placed at 4°C. 5 μL of the ligation solution was added to 50 μL of thawed DH5α competent cells, gently mixed, and incubated on ice for 25 minutes. The cells were then heat-shocked in a 42°C metal bath for 45 seconds and immediately placed on ice for 2-3 minutes. 700 μL of sterile LB medium was added, and the cells were incubated at 37°C with shaking at 200 rpm for 1 hour. 50 μL of the bacterial culture was evenly spread onto a culture dish containing ampicillin and incubated at 37°C for 12-16 hours. Single colonies were selected for PCR identification. The PCR products were detected by 1% agarose gel electrophoresis. The clonal electrophoresis pattern is shown in [Figure number missing]. Figure 1 The positive E. coli bacterial culture was sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for analysis. Sequencing of the target fragment yielded a 591 bp coding sequence (see Sequence Listing Seq ID NO.1), encoding 197 amino acids (see Sequence Listing Seq ID NO.2).

[0049] To further study the white poplar PtoYABBY2 Conserved motif sequences were obtained by screening the YABBY2 subclass amino acid sequences of the YABBY family from various species databases in Phytozome v13, including Arabidopsis thaliana. Arabidopsis thaliana TAIR10), soybeans ( Glycine max Wm82.a4.v1), Tomato ( Solanum lycopersicum ITAG5.0), grapes ( Vitis vinifera v2.1), rice ( Oryza sativa The amino acid sequence of the YABBY2 subclass of the YABBY family (v7.0) was used, combined with the YABBY2 subclass members of the Arabidopsis YABBY gene family. The YABBY protein sequences of multiple species were aligned using CLUSTALW and the NJ nearest neighbor method using MEGA7 to reconstruct the phylogenetic tree of the YABBY subclass. The bootstrap parameter was checked and set to be repeated 1000 times.

[0050] The amino acid sequences of the YABBY2 subclasses of each species were screened and subjected to phylogenetic analysis, see [link to relevant documentation]. Figure 2 The number of YABBY2 subclass members in each group of Arabidopsis thaliana, soybean, tomato, grape, rice and poplar were 1, 4, 2, 2, 3 and 2, respectively. Evolution shows that PtoYABBY2 and soybean YABBY2 subclass proteins are distantly related, and the regulatory functions of YABBY2 subclass proteins in different species are significantly different.

[0051] The amino acid sequences of YABBY2 subclass members from Arabidopsis thaliana, soybean, tomato, grape, rice, and Populus tomentosa were analyzed for domain structure. Multiple sequence alignment was performed using DNAMAN. (See attached image.) Figure 3PtoYABBY2 possesses a complete YABBY domain and a C2C2 domain. The predicted tertiary structure of the PtoYABBY2 protein is shown below. Figure 4 As shown.

[0052] RNA extraction and real-time fluorescence quantitative assay All centrifuge tubes, pipette tips, and grinding beads used in the experiment were nuclease-free materials. Samples from various tissue parts of *Populus tomentosa* were ground using a grinder, and total RNA was extracted using the Omega RNA kit. RNA concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). cDNA was synthesized using the TransScript All-in-One First-Strand cDNA Synthesis SuperMIX for qPCR reverse transcription kit, and the obtained cDNA was diluted with nuclease-free water to a uniform concentration of 500 ng / μL.

[0053] Using TB Green Premix Ex Taq (SYBR Green) enzyme pair PtoYABBY2 Genes were subjected to RT-qPCR experiments, and at the same time, PtACTIN This gene was used as an internal reference for quantitative real-time PCR. The primer sequences for quantitative real-time PCR of the gene are shown in Table 4.

[0054] Table 4 qRT-PCR amplification reaction system

[0055] The RT-qPCR reaction program was set as follows: 95℃ for 30 s; 95℃ for 5 s, 61℃ for 30 s, for 40 cycles. After cycling, product specificity was detected using melting curve analysis: fluorescence signals were collected 5 times for every 1℃ increase in temperature from 60℃ to 95℃. *Populus tomentosa* was used as a starting point. PtACTIN Genes were used as internal controls for detection. Three biological replicates and three technical replicates were set up, and the average value was calculated. A 23 -∆Ct Gene expression levels were calculated and plotted using a method.

[0056] like Figure 5 As shown, during the development of female flower buds, PtoYABBY2 Gene expression levels were downregulated in stages 1-2, 4-5, and 6-7, and upregulated in stages 2-4, 5-6, and 7-8, with expression levels reaching their lowest point in stage 2 and highest in stage 8. During male flower bud development... PtoYABBY2 Expression levels decreased in periods 1-8, with the highest expression level in period 1 and the lowest in period 8.

[0057] Quantitative fluorescence results in nutrient tissues, such as Figure 6 As shown, PtoYABBY2 It was expressed in the roots, stems, young leaves, and mature leaves observed. PtoYABBY2 It is mainly expressed in leaves. PtoYABBY2 Expression levels are low in roots and stems, and PtoYABBY2 The expression level is highest in mature leaves.

[0058] PtoYABBY2 Subcellular Localization The *Agrobacterium tumefaciens* GV3101 bacterial suspension containing the target vector was placed in a shaker at 28°C and 200 rpm for 10 h. The suspension was then resuspended, with an OD600 in the range of 0.8–1.0. After standing for 3 h, the resuspended suspension was injected into *Nicotiana benthamiana* for transient transformation, and subcellular localization of PtoYAB2 and PtoYAB12 was performed. The transformed tobacco cells were observed using a Zeiss fluorescence inverted microscope (Zeiss, Germany). Figure 7 This is a result of transient expression of PtoYABBY2 in Nicotiana benthamiana, which is located in the cell nucleus.

[0059] PtoYABBY2 Construction of gene overexpression vectors Extract the DNA using a high-purity plasmid DNA miniprep kit. The sequencing results correctly indicate the presence of... PtoYABBY2 The fragmented bacterial culture plasmid was double-digested with restriction endonucleases BstEII-HF and Ncol-HF on pCAMBIA1301 plasmid (preserved in our laboratory). The digestion system is shown in Table 5. The reaction program was 37℃ for 30 min. After digestion, the vector was purified using a DNA gel extraction kit and detected by electrophoresis. The digested products were stored at -20℃.

[0060] Table 5. Enzyme digestion reaction system for the 1301 expression vector

[0061] Vector linkage was performed using the ClonExpress® Ⅱ One Step Cloning Kit, and the linkage system is shown in Table 6, yielding pCAMBIA1301- PtoYABBY2 The recombinant was introduced into Agrobacterium GV3101 competent cells via an overexpression vector for subsequent genetic transformation in Arabidopsis thaliana.

[0062] Table 6 1301 expression vector ligation reaction system .

[0063] Cultivation and Infection of Wild-type Arabidopsis Under sterile conditions, wild-type Arabidopsis thaliana (Col) seeds were placed in 2 ml centrifuge tubes, and a 5% sodium hypochlorite solution was added. The tubes were shaken repeatedly for 5 minutes to disinfect the seeds. After disinfection, the seeds were washed 6-8 times with sterile distilled water. The seeds were then spread evenly on sterile 1 / 2 MS solid medium and vernalized at 4°C for 3 days. After culturing under light for one week, the Arabidopsis seedlings were transplanted into sterilized culture soil (a mixture of substrate soil and vermiculite = 1:1) and placed in a light incubator for long-day (16 / 8 h) cultivation at 22°C and a relative moisture content of 70%. The Arabidopsis plants were transformed using the flower immersion method. When the Arabidopsis plants had bolted and developed 3-4 stem leaves, the terminal inflorescences of all plants were simultaneously removed to utilize apical dominance and promote the growth and flowering of lateral branches. A large number of unopened flower buds were infected with Agrobacterium and soaked for 30-60 seconds. After infection, the plants were placed in a dark environment for about 24 hours. The infection was repeated 4 times during the flowering period, with an interval of about one week between each infection, to improve the transformation efficiency.

[0064] Screening and identification of transgenic Arabidopsis thaliana After infection with Arabidopsis thaliana, seeds were mixed and harvested to obtain the first generation (T0 generation). These seeds were sown on 1 / 2 MS solid medium containing 30 mg / L hygromycin. Normally growing transgenic seedlings were selected. For resistant plants, DNA was extracted and used as a template for PCR amplification and molecular testing according to the Plant Direct PCR Kit instructions. Gel electrophoresis was used to observe the presence of the target band. The above process was repeated to obtain T2 generation homozygous transgenic plants. Subsequent phenotypic observation and functional analysis were then performed.

[0065] Extracts were extracted from WT wild-type Arabidopsis thaliana and T4 generation 35S:: PtoYABBY2 Overexpressing DNA from plant leaves and using it as a template for further processing PtoYABBY2 Genetic testing, results as follows Figure 8 As shown in the diagram, "Marker" represents the DM2000 marker; "OE" represents 35S:: PtoYABBY2 Plant. According to Figure 8 Wild-type lines served as the control group and did not show any bands. The T1 generation lines that were successfully transfected with the exogenous gene showed the target band. A total of 5 lines were verified.

[0066] During the growth of wild-type and transgenic Arabidopsis thaliana, the bolting and flowering times of the plants were recorded and compared in real time, and graphs were generated using Excel 2021 software.

[0067] Figure 9 The image shows WT wild-type Arabidopsis thaliana (left) and 35S:: PtoYABBY2 Comparison of transgenic plants (right). Figure 9 show, PtoYABBY2Overexpression of the gene in Arabidopsis thaliana affects bolting and flowering time, causing earlier flowering. See figures b and c; the flower morphology is normal, and the number of petals, sepals, pistils, and stamens are all normal. The morphology, number, and size of the leaves are also normal. Figure c shows the 35S:: PtoYABBY2 Both the inflorescences of the plant and the wild type are indeterminate.

[0068] Wild type and 35S:: PtoYABBY2 See the comparison results of flowering time of transgenic lines. Figure 10 . Figure 10 In the middle, the plant on the left is the WT wild-type plant, and from left to right are the 35S:: PtoYABBY2-6 35S:: PtoYABBY2-8 and 35S:: PtoYABBY2-18 Therefore, we can see three 35S:: PtoYABBY2 The flowering time of the transgenic lines was earlier than that of WT Arabidopsis thaliana.

[0069] The statistical results of flowering time of wild-type and 35S::PtoYABBY2 transgenic lines are shown in Table 7.

[0070] Table 7. Statistical results of flowering time of wild-type and 35S::PtoYABBY2 transgenic lines .

[0071] In Table 7, WT represents wild-type Arabidopsis thaliana, and there are 3 35S:: PtoYABBY2 Transgenic strains.

[0072] Statistical analysis of flowering time (days). The flowering time of these six lines differed significantly from that of the wild-type plants, and the SPSS analysis results all showed significance. The bolting time of the wild-type Arabidopsis thaliana was 20.4 days; 35S:: PtoYABBY2 The flowering time of the plants has been advanced to varying degrees, specifically by about 4 days earlier.

[0073] Study on the expression patterns of endogenous genes in transgenic plants Representative transgenic lines were selected from Arabidopsis thaliana exhibiting the aforementioned differences in flowering time. Flowers were extracted from positive transgenic plants and wild-type Arabidopsis thaliana. Flowers were also extracted from WT wild-type plants and 35S:: PtoYABBY2-6 35S:: PtoYABBY2-8 and 35S:: PtoYABBY2-18 RNA from transgenic plants is reverse transcribed to obtain cDNA, which is then used as a template for subsequent RT-qPCR experiments. AtACTIN The gene was used as an internal reference gene, and the quantitative fluorescence assay method was the same as described above. Meanwhile, AtACTIN This gene was used as an internal reference for quantitative real-time PCR. The primer sequences for quantitative real-time PCR of the gene are shown in Table 8.

[0074] use Gene expression levels were calculated and plotted using a method.

[0075] Table 8 Primers for Quantitative Real-Time PCR .

[0076] To further study 35S:: PtoYABBY2 Gene regulation in transgenic plants explains phenotypic changes at the molecular level. This was demonstrated by measuring [the gene structure] in the floral tissues of Arabidopsis thaliana. PtoYABBY2 The expression levels of endogenous genes regulating flowering time in three transgenic Arabidopsis lines were compared with those in wild-type plants subjected to WT. (See [reference needed]). Figure 10 . Figure 10 In the text, WT represents wild-type Arabidopsis thaliana plants and 35S:: PtoYABBY2-6 35S:: PtoYABBY2-8 and 35S:: PtoYABBY2-18 Transgenic strains.

[0077] In 35S:: PtoYABBY2 In the tissues of Arabidopsis thaliana flower, AtSOC1, AtLFY , AtFT , AtFUL Gene expression levels were higher in the group than in the wild type. AtFLC Gene expression levels were lower in the Arabidopsis thaliana flower tissue than in the wild type. AtFT and AtSOC1 ), flowering meristem regulators ( AtLFY and AtFUL The expression levels of genes such as ) were higher in the wild type, while the expression levels of flowering inhibitors () were higher in the wild type. AtFLC The expression level of ) was lower than that of the wild type. Therefore, PtoYABBY2 Overexpression of the gene promotes the expression of flowering integrons and floral meristem regulators, resulting in 35S:: PtoYABBY2 Genetically modified Arabidopsis thaliana bolts and flowers earlier.

[0078] This embodiment demonstrates the effectiveness of Populus tomentosa using the model plant Arabidopsis thaliana. PtoYABBY2 Genes can be used to breed new varieties of Populus tomentosa with different flowering times; utilizing the aforementioned PtoYABBY2 Genes can regulate flowering time to obtain new varieties with desired flowering characteristics. This embodiment also illustrates a plant transgenic method of introducing the expression vector into plant cells to alter the flowering time of the plant. This embodiment further illustrates the method of measuring flowering time at different developmental stages. PtoYABBY2This embodiment describes a method for analyzing gene expression patterns related to flowering time regulation in plants, using the aforementioned quantitative fluorescent primer pairs to quantify the expression levels of genes involved in flowering time regulation in transgenic plants.

[0079] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A type of white poplar PtoYABBY2 Genes, characterized by, The expression of this substance in plants to regulate flowering time, PtoYABBY2 Genes contain nucleotide sequences selected from the following group: A. The nucleotide sequence shown in Seq ID NO.1 of the sequence listing; B. The nucleotide sequence of the amino acid sequence shown in Seq ID NO.2 of the coding sequence listing.

2. A type of Populus tomentosa as described in claim 1 PtoYABBY2 Gene-encoded proteins are characterized by, The amino acid sequence of the protein is selected from the amino acid sequence shown in Sequence Listing SeqID NO.

2.

3. A method for cloning the white poplar of claim 1 PtoYABBY2 A primer pair for a gene, characterized in that, The base sequences of the primer pairs are as follows: First upstream primer F: 5'-ATGCATCACATAAACGAAAGGAAA-3', First downstream primer R: 5'-TCACAGGGAGCCATTGATCTCGTA-3'; And selectively containing a second upstream primer F and a second downstream primer R with restriction enzyme sites: Second upstream primer F: 5'- AGAACAGGGGGACTCTTGACATGCATCACATAAACGAAAGGAAA -3', Second downstream primer R: 5'-GGGGAAATTCGAGCTGGTCACTCACAGGGAGCCATTGATCTCGTA -3'.

4. A type of white poplar PtoYABBY2 The fluorescent quantitative primer pair for the gene is characterized by, The base sequences of the fluorescence quantitative primer pairs are as follows: Third upstream primer F: 5'-CTTTTGGACTGAAGCTGGACA-3', Third downstream primer R: 5'-TCACAGGGAGCCATTGAT-3'.

5. A type of poplar tree containing the poplar described in claim 1 PtoYABBY2 Gene expression vectors, characterized in that, Using restriction endonucleases Bst EII-HF and Nco The pCAMBIA1301 vector plasmid was double-digested with l-HF, and ligation was performed using the ClonExpress® II One Step Cloning Kit to obtain the overexpression vector pCAMBIA1301- PtoYABBY2 .

6. A Populus tomentosa as described in claim 1 PtoYABBY2 The uses of genes, characterized by, Used to cultivate new varieties of white poplar with different flowering times.

7. A method for cultivating new plant varieties, characterized in that, Using the method described in claim 1 PtoYABBY2 Genetic regulation of flowering time can be used to obtain new varieties with desired flowering characteristics.

8. A method for transgenic plants, characterized in that, This includes introducing the expression vector of claim 5 into plant cells to alter the flowering time of the plant.

9. A method for analyzing gene expression patterns related to the regulation of flowering time in plants, characterized in that, By measuring different developmental stages PtoYABBY2 Gene expression levels were analyzed to understand the regulatory mechanisms of plant flowering time.

10. A method for determining the expression levels of genes related to flowering time regulation, characterized in that, Using the fluorescent quantitative primer pair described in claim 4, the expression levels of genes related to flowering time regulation in transgenic plants were quantitatively analyzed.