Recombinant adenoviruses displaying ultra-large fragment antigens on their capsid surface: construction methods and applications

By inserting exogenous genes into the Hexon hypervariable regions HVR1 and HVR5 of the adenovirus capsid and using flexible linker fragments, the problems of viral particle stability and high-density antigen display were solved, and efficient immune response activation was achieved.

CN120944926BActive Publication Date: 2026-01-30TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511468038.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-15
Publication Date
2026-01-30
Estimated Expiration
2045-10-15

AI Technical Summary

Technical Problem

Existing adenovirus vector technology cannot achieve high-density display of antigens on the surface of the viral capsid without damaging the stability of viral particles, which limits the functional expansion of the vector and the effectiveness of the immune response.

Method used

Foreign gene fragments were inserted into the Hexon hypervariable regions HVR1 and HVR5 of the adenovirus capsid and ligated using flexible linkers to ensure the stability and infectivity of the viral particles.

Benefits of technology

It achieves high-density antigen display on the surface of viral particles, enhances immunogenicity, can stably package high-titer and infectious viral particles, and stimulate a strong immune response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944926B_ABST
    Figure CN120944926B_ABST
Patent Text Reader

Abstract

This invention relates to the field of bioengineering technology, specifically to a recombinant adenovirus displaying a large antigen fragment on its capsid surface, its construction method, and its applications. The HVR1 and HVR5 regions of the hexon hypervariable region of this virus are replaced by gene fragments containing exogenous genes; each exogenous gene fragment has a flexible linker attached to both ends, and the gene sequence of the flexible linker is shown in SEQ ID No. 1. By precisely locating the naturally variable HVR1 and HVR5 loop regions exposed on the surface of the hexon protein as insertion sites, and supplementing them with flexible linkers, the core problem of exogenous sequence insertion disrupting the stability of the hexon structure is successfully solved. This allows for stable packaging to produce viral particles with high titers and infectivity, enabling the development of a new generation of highly efficient and safe capsid-displaying adenovirus vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and more specifically, to recombinant adenoviruses displaying ultra-large fragment antigens on their capsid surface, their construction methods, and their applications. Background Technology

[0002] Gene therapy, particularly viral vector-based tumor immunotherapy, has become a frontier in modern biomedicine. Its core strategy involves enhancing the host's immune system, especially cytotoxic T lymphocytes (CTLs), through genetic engineering to specifically recognize and kill tumor cells. Adenovirus (Ad) vectors, with their broad infectivity spectrum, high gene delivery efficiency, ability to induce strong humoral and cellular dual immune responses, and mature production processes, have become one of the most favored tools in vaccine and gene therapy research, demonstrating their significant success in the development of vaccines for major infectious diseases such as Ebola and COVID-19.

[0003] However, existing adenovirus vector technologies, such as the classic pAdEasy system, primarily utilize the E1 or E3 gene deletion regions to load exogenous genes. While this approach is mature, it limits the functional expansion of the vector and cannot achieve direct, high-density display of antigens on the surface of viral particles. Directly displaying antigens on the viral capsid surface, i.e., "capsid arming," can more effectively mimic natural pathogens, thereby eliciting a stronger immune response.

[0004] Hexon is the most numerous and widely exposed structural protein in the adenovirus capsid, making it an ideal target for capsid armament modification. Theoretically, displaying antigens on hexon can enable the presentation of hundreds of antigen molecules per viral particle, significantly enhancing immunogenicity. However, in practice, hexon modification faces significant technical bottlenecks. Hexon proteins, forming a trimer, constitute the main backbone of the adenovirus capsid, and their highly precise structure is crucial for maintaining viral particle stability and infectivity. Any modification to the hexon protein, especially the insertion of exogenous sequences, can easily disrupt the correct folding and assembly of its trimer, thereby affecting the stability of the entire viral capsid and ultimately preventing the production of infective viral particles. Therefore, how to functionally modify hexon without compromising viral viability has long been a technical challenge in the field of adenovirus vectors. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a recombinant adenovirus displaying ultra-large fragment antigens on the capsid surface, its construction method and application.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] This invention provides a fusion gene fragment of the Hexon hypervariable region of an adenovirus capsid, wherein the HVR1 and HVR5 regions of the Hexon hypervariable region are respectively replaced by gene fragments containing exogenous genes; in the gene fragment, flexible linker fragments are respectively attached to both ends of the exogenous genes, and the gene sequence of the flexible linker fragments is shown in SEQ ID No. 1.

[0008] Based on the above technical solution, the present invention can be further improved as follows.

[0009] Furthermore, the exogenous genes located in the HVR1 region and the HVR5 region can be independently selected from HPV antigen genes or OVA antigen genes.

[0010] Furthermore, the HPV antigen gene is a gene that encodes the human papillomavirus type 16 L2 protein.

[0011] The present invention provides a recombinant adenovirus with a capsid surface displaying a large fragment antigen, wherein the gene sequence of the recombinant adenovirus includes the Hexon hypervariable region fusion gene fragment as described above.

[0012] Preferably, the recombinant adenovirus is adenovirus type 5.

[0013] The present invention also provides a method for constructing a recombinant adenovirus as described above, comprising the following steps:

[0014] The adenovirus backbone plasmid was linearized; the Hexon hypervariable fusion gene fragment was synthesized in vitro.

[0015] The linearized adenovirus backbone plasmid and the Hexon hypervariable region fusion gene fragment were co-transformed into competent cells to obtain a recombinant adenovirus plasmid.

[0016] After amplification and identification of the recombinant adenovirus plasmid, it is packaged and purified to obtain the recombinant adenovirus with ultra-large fragment antigens displayed on the capsid surface.

[0017] Furthermore, the viral backbone plasmid is BJ5183-pADeasy plasmid, and the competent cells are BJ5183 competent cells.

[0018] Furthermore, the packaging method involves linearizing the recombinant adenovirus plasmid using a restriction endonuclease to expose its inverted terminal repeat sequence, and then transfecting it into a packaging cell line.

[0019] The present invention also provides the application of the recombinant adenovirus as described above, which can be used to prepare vaccines or gene therapy drugs.

[0020] Preferably, the vaccine is a monovalent vaccine, a bivalent vaccine, or a multivalent vaccine, and the gene therapy drug is a combination immune adjuvant.

[0021] The beneficial effects of this invention are as follows:

[0022] (1) The Hexon hypervariable region fusion gene fragment of the adenovirus capsid of the present invention, by precisely locating the HVR1 and HVR5 loop regions exposed on the surface of the Hexon protein and having natural variability as insertion sites, and supplemented by a flexible linker fragment, successfully solves the core problem of exogenous sequence insertion destroying the stability of Hexon structure, and can stably package and produce viral particles with high titer and infectivity.

[0023] (2) The Hexon hypervariable region fusion gene fragment of the adenovirus capsid of the present invention, wherein the flexible linker fragment can provide an independent folding space for the exogenous antigen, thereby reducing interference with the Hexon protein structure;

[0024] (3) The recombinant adenovirus of the present invention has excellent antigen display and enhanced immunogenicity;

[0025] (4) The recombinant adenovirus preparation method of the present invention provides a new adenovirus modification strategy that can accurately find a "safe window" on the Hexon protein that can accommodate exogenous antigens without affecting viral activity, thereby developing a new generation of highly efficient and safe capsid-displaying adenovirus vaccines. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of the gene structure of the recombinant virus carrying the HPV-L2 antigen in Example 1 of the present invention. Figure 1 Figure (1) is a schematic diagram of the PAd-Hexon(HVR1)-L2 modification. Figure 1 (2) is a schematic diagram of the PAd-Hexon(HVR5)-L2 modification. Figure 1 (3) is a schematic diagram of the PAd-Hexon(HVR1+5)-L2 modification;

[0027] Figure 2 In Example 1 of the present invention, the gene maps of the three fragments are shown. Figure 2 In the text, A represents segment A. Figure 2 In the middle, B is segment B. Figure 2 C in the middle represents segment C;

[0028] Figure 3 The Western Blot results of each recombinant adenovirus expressing Hexon fusion antigen in vitro in Example 2 of the present invention are shown.

[0029] Figure 4 The results of ELISA detection of L2-specific antibodies induced by different recombinant adenoviruses in C57BL / 6 mice in Example 3 are shown.

[0030] Figure 5 This is a schematic diagram of the gene structure of the recombinant virus carrying the OVA antigen in Example 4 of the present invention. Figure 5 (1) is a schematic diagram of the PAd-Hexon(HVR1)-OVA modification. Figure 5 (2) is a schematic diagram of the PAd-Hexon(HVR5)-OVA modification. Figure 5 (3) is a schematic diagram of the PAd-Hexon(HVR1+5)-OVA modification;

[0031] Figure 6 These are electron micrographs of the virus particles in Example 4 of the present invention. Figure 6 A in the text is a recombinant virus of PAd-Hexon(HVR1)-OVA. Figure 6 B is a recombinant virus of PAd-Hexon(HVR5)-OVA. Figure 6 C in the text represents a recombinant virus of PAd-Hexon(HVR1+5)-OVA;

[0032] Figure 7 This is a schematic diagram of the gene structure of recombinant viruses carrying the OVA antigen in different linker segments in Example 5 of the present invention. Figure 7 Figure (1) is a schematic diagram of the gene structure containing the flexible Linker virus. Figure 7 Figure (2) is a schematic diagram of the gene structure of a polyglycine-containing Linker virus. Figure 7 Figure (3) is a schematic diagram of the gene structure of a rigid linker virus. Figure 7 (4) is a schematic diagram of the gene structure of (XP)n Linker virus containing proline-rich protein;

[0033] Figure 8 These are electron micrographs of the virus particles in Example 5 of the present invention. Figure 8 In the middle, A represents a virus containing a flexible linker. Figure 8 Type B is a virus containing a polyglycine linker. Figure 8 The C in the middle represents a virus containing a rigid linker. Figure 8 The virus in the middle D is a (XP)n linker rich in proline. Detailed Implementation

[0034] The principles and features of the present invention are described below. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0035] The present invention relates to a fusion gene fragment of the Hexon hypervariable region of the adenovirus capsid, wherein the HVR1 and HVR5 regions of the Hexon hypervariable region are respectively replaced by gene fragments containing exogenous genes; in the gene fragment, flexible linker fragments are respectively attached to both ends of the exogenous genes, and the gene sequence of the flexible linker fragments is shown in SEQ ID No. 1.

[0036] The adenovirus capsid Hexon hypervariable region fusion gene fragment of this invention, by precisely locating the naturally variable HVR1 and HVR5 loop regions exposed on the surface of the Hexon protein as insertion sites and supplemented by a flexible linker, successfully solves the core problem of exogenous sequence insertion disrupting the stability of the Hexon structure. This enables stable packaging to produce viral particles with high titers and infectivity. The flexible linker provides independent folding space for exogenous antigens, reducing interference with the Hexon protein structure.

[0037] The replaced segment in region HVR1 is shown in SEQ ID No. 2, and the replaced segment in region HVR5 is shown in SEQ ID No. 3.

[0038] Preferably, the exogenous genes located in the HVR1 and HVR5 regions can be independently selected from the HPV antigen gene or the OVA antigen gene.

[0039] Further preferably, the HPV antigen gene is a gene encoding the human papillomavirus type 16 L2 protein (HPV16-L2); the HPV16-L2 gene fragment is amino acids 10 to 41 of the hpv16-L2 protein, and its gene sequence is shown in SEQ ID No. 4, and its amino acid sequence is shown in SEQ ID No. 5.

[0040] The flexible linker fragment of the present invention can carry hpv16-L2 protein with a longer gene sequence and more amino acids.

[0041] The present invention relates to a recombinant adenovirus whose capsid surface displays ultra-large fragment antigens, and whose gene sequence includes the Hexon hypervariable region fusion gene fragment as described above. This recombinant adenovirus exhibits excellent antigen display and enhanced immunogenicity. Hexon is the most abundant protein in the adenovirus capsid. Fusing antigens to HVR1 / HVR5 means that the surface of each viral particle can display antigens at an extremely high density (hundreds of copies) and in a spatially optimized conformation, greatly mimicking the surface of pathogens. This effectively activates B cells to generate strong humoral immunity and allows the antigen to be efficiently taken up by antigen-presenting cells as particulate antigens, thereby inducing robust T cell-mediated cellular immunity.

[0042] Preferably, the recombinant adenovirus is adenovirus type 5.

[0043] The method for constructing the recombinant adenovirus of the present invention includes the following steps:

[0044] S1. Linearize the adenovirus backbone plasmid; synthesize the Hexon hypervariable fusion gene fragment in vitro.

[0045] Specifically, restriction endonucleases (such as AsiSI) are used to linearize the backbone plasmids (such as pAdEasy-1) containing the adenovirus genome, in preparation for subsequent homologous recombination.

[0046] The specific structure of the Hexon hypervariable fusion gene fragment is as follows: Hexon protein N-terminal sequence — HVR1 (or HVR5) insertion site — flexible adapter sequence — exogenous antigen gene sequence — flexible adapter sequence — HVR1 (or HVR5) downstream sequence — Hexon protein C-terminal sequence.

[0047] S2. The linearized adenovirus backbone plasmid and the Hexon hypervariable region fusion gene fragment are co-transformed into competent cells to obtain recombinant adenovirus plasmid.

[0048] Preferably, the linearized adenovirus backbone plasmid from step S1 and the Hexon hypervariable region fusion gene fragment are co-transformed into competent cells (such as BJ5183) with high homologous recombination capability. Through homologous recombination reaction, the fusion gene fragment is precisely integrated into the Hexon coding region of the adenovirus genome to obtain a recombinant adenovirus plasmid (e.g., PAd-Hexon(HVR1-L2)).

[0049] S3. After amplification and identification of the recombinant adenovirus plasmid, it is packaged and purified to obtain a recombinant adenovirus with ultra-large fragment antigens displayed on the capsid surface.

[0050] Preferably, the recombinant plasmid that has been verified to be correct by sequencing is transformed into a conventional amplification strain (such as FasT1) for large-scale amplification and purification.

[0051] Preferably, viral packaging and purification involves linearizing the recombinant adenovirus plasmid with a restriction endonuclease (such as PacI) to expose its inverted terminal repeat (ITR) sequences, followed by transfection into a packaging cell line (such as HEK293).

[0052] Preferably, during cell culture, the cells package, replicate, and release mature, infectious capsid-modified recombinant adenovirus particles. Finally, purification and titer determination are performed using standard methods (such as cesium chloride density gradient centrifugation).

[0053] The recombinant adenovirus described above can be used to prepare vaccines or gene therapy drugs.

[0054] This invention demonstrates through specific embodiments that HVR1 and HVR5 are both feasible antigen insertion "hot spots." This discovery is a milestone, meaning that these two sites can be used to develop more complex vaccines.

[0055] Specifically, the vaccine is a bivalent vaccine, displaying antigens from different pathogens (or different subtypes of the same pathogen) on HVR1 and HVR5 respectively.

[0056] Gene therapy drugs can act as combination immune adjuvants, displaying an antigen at one site and an immune adjuvant molecule at another site, achieving a "self-adjuvant" effect.

[0057] In addition, this recombinant adenovirus can also display complex antigens, showing different epitopes of a larger antigen at two sites.

[0058] Experiments have demonstrated that this invention can be successfully applied to the display of various antigens (such as HPV16-L2, OVA), proving its versatility as a technology platform. Furthermore, the entire construction and production process is based on a mature adenovirus technology platform, which is easy to scale up and standardize, laying a solid foundation for clinical translation.

[0059] The present invention will be illustrated by specific embodiments below.

[0060] Example 1: Construction of a recombinant adenovirus displaying ultra-large fragment antigens on the capsid surface

[0061] This embodiment uses the method of the present invention to construct three recombinant adenoviruses (PAd-Hexon-L2) with capsid surfaces displaying ultra-large fragment antigens using three different strategies. The aim is to describe in detail the construction process of three recombinant adenoviruses carrying HPV16-L2 antigens, namely, single-point insertion at HVR1, single-point insertion at HVR5, and double-point insertion at both HVR1 and HVR5.

[0062] The specific steps are as follows:

[0063] (1) Linearization of the adenovirus backbone pAdEasy-1: Take 50 μg of pAdEasy-1 plasmid and completely digest it with NEB's AsiSI restriction endonuclease at 37°C for 1 hour. After confirming complete linearization of the plasmid by agarose gel electrophoresis, it was purified using a kit for later use.

[0064] (2) Preparation of three Hexon-L2 fusion gene fragments:

[0065] Three different Hexon-L2 fusion gene fragments were synthesized by a professional company. Each fragment had homologous arms (approximately 1000 bp each) at both ends that were homologous to the flanking sequences of the AsiSI restriction site, for subsequent homologous recombination.

[0066] Fragment A (HVR1-L2): The sequence “flexible adapter-HPV16-L2-flexible adapter” is inserted into the HVR1 coding region of the Hexon gene, replacing the HVR1 fragment. The specific sequence is shown in SEQ ID No. 6.

[0067] Fragment B (HVR5-L2): The sequence “flexible adapter-HPV16-L2-flexible adapter” is inserted into the HVR5 coding region of the Hexon gene, replacing the HVR5 fragment. The specific sequence is shown in SEQ ID No. 7.

[0068] Fragment C (HVR1+5-L2): A "flexible adapter-HPV16-L2-flexible adapter" sequence is inserted into both the HVR1 and HVR5 coding regions on the same Hexon gene sequence, replacing fragments of HVR1 and HVR5. The specific sequence is shown in SEQ ID No. 8.

[0069] The structural diagrams of the three segments mentioned above are as follows: Figure 1 As shown, the final recombinant adenovirus genome map reveals a linearized, complete viral genome structure suitable for virus packaging.

[0070] The three synthesized fragments were amplified using high-fidelity PCR. After confirming the correct bands by gel electrophoresis, they were recovered and purified for later use.

[0071] The primers used for the PCR amplification are as follows:

[0072] F (SEQ ID No.9): CTCTGGCATTAGCGGGGTGG

[0073] R (SEQ ID No.10):gtttttaatggcaaagaacttctgaggc

[0074] (3) Homologous recombination yielded three types of recombinant plasmids:

[0075] Approximately 100 ng of the linearized pAdEasy-1 backbone was co-transformed into BJ5183 competent cells with approximately 300 ng of fragments A, B, and C, respectively. After transformation using the standard heat shock method, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C.

[0076] The following day, single colonies were selected for colony PCR and Sanger sequencing identification. Positive colonies with completely correct sequencing results were amplified, and plasmids were extracted and named PAd-Hexon(HVR1)-L2, PAd-Hexon(HVR5)-L2, and PAd-Hexon(HVR1+5)-L2, respectively.

[0077] (4) Plasmid amplification and virus packaging:

[0078] The three correctly identified recombinant plasmids were transformed into FasT-Easy T1 competent cells for large-scale amplification and purification.

[0079] 50 μg of purified recombinant plasmid was linearized using PacI restriction endonuclease. The linearized viral genomic DNA was transfected into HEK293A cells. After approximately 7-10 days, when significant cytopathic effect (CPE) was observed, the virus was collected and amplified. Finally, the virus was purified by cesium chloride density gradient ultracentrifugation to obtain high-titer recombinant viruses, which were then stored in aliquots at -80°C.

[0080] Example 2: Identification of protein expression of recombinant virus in in vitro cells

[0081] To verify whether the constructed virus can express the fusion protein in target cells, HEK293 cells were infected with the control virus pAdEasy-1, the PAd-Hexon(HVR1)-L2, PAd-Hexon(HVR5)-L2 and PAd-Hexon(HVR1+5)-L2 viruses obtained in Example 1 at an MOI of 5. After 72 hours, the cells were collected and total protein was extracted.

[0082] The results are as follows Figure 3 As shown, Figure 3 In the table, NC is the Western Blot result of pAdEasy-1 infected with HEK-293A (MOI=5) for 72 hours, (1) is the Western Blot result of PAd-Hexon(HVR1)-L2 infected with HEK-293A (MOI=5) for 72 hours, (2) is the Western Blot result of PAd-Hexon(HVR5)-L2 infected with HEK-293A (MOI=5) for 72 hours, and (3) is the Western Blot result of PAd-Hexon(HVR1+5)-L2 infected with HEK-293A (MOI=5) for 72 hours.

[0083] The Western blot results show that the three virus infection groups obtained in Example 1 all exhibited specific Hexon-L2 fusion protein bands at the expected molecular weight positions, while the negative control group did not show this band. This indicates that all three modification strategies (HVR1, HVR5, and HVR1+5) can drive the successful expression of the target protein.

[0084] Example 3: Evaluation of the specific immune response induced in vivo by the recombinant virus

[0085] To assess the in vivo immunogenicity of the virus, female C57BL / 6 mice aged 6-8 weeks were randomly divided into four groups: a PBS control group, a PAd-Hexon(HVR1)-L2 group, a PAd-Hexon(HVR5)-L2 group, and a PAd-Hexon(HVR1+5)-L2 group. Each mouse was injected intramuscularly with 5 × 10⁻⁶ PBS. 8 PFU with the corresponding virus or an equal volume of PBS.

[0086] On day 14 after the initial immunization, mouse serum was collected, and the level of anti-HPV16 L2 IgG antibodies in the serum was detected by ELISA. Figure 4 As shown, compared with the PBS control group, significantly high levels of L2-specific antibodies were detected in the serum of mice in all three virus-immunized groups, demonstrating that all recombinant adenoviruses constructed in this invention can effectively induce specific humoral immune responses against the antigens they carry in vivo.

[0087] The IgG antibody level in the PAd-Hexon(HVR1+5)-L2 group was significantly better than that in the other two groups, indicating that the simultaneous insertion of fragments containing foreign genes into the HVR1 and HVR5 regions has a synergistic effect.

[0088] Example 4: Construction of the PAd-Hexon-OVA series of viruses

[0089] To demonstrate the universality of the method of this invention, this embodiment uses the exact same method as Example 1, except that in step (2), the HPV16-L2 gene is replaced with the ovalbumin (OVA) gene. Three capsid-modified adenoviruses carrying the OVA antigen were successfully constructed, packaged, and purified, as follows:

[0090] Fragment D: PAd-Hexon(HVR1)-OVA;

[0091] Fragment E: PAd-Hexon(HVR5)-OVA;

[0092] Fragment F: PAd-Hexon(HVR1+5)-OVA.

[0093] The amino acid sequence of OVA is referenced below:

[0094] .

[0095] The nucleic acid sequence references Gallus gallus ovalbumin (SERPINB14) (OVAL), mRNA-Nucleotide-NCBI's CDS region.

[0096] The gene structure diagrams of the above PAd-Hexon-OVA series viruses are shown below. Figure 5 As shown in the electron micrograph, the virus particles are as follows: Figure 6 As shown.

[0097] pass Figure 6 As can be seen, all three OVA viruses in this embodiment were successfully constructed, which fully demonstrates that the method of the present invention can carry multiple exogenous antigen genes and provides a stable, reliable and universal technical platform.

[0098] Example 5: Comparison of the effects of different flexible connecting segments

[0099] To optimize the linking of candidate molecules, this embodiment systematically evaluated and compared various linkers with different characteristics, aiming to screen out the linking strategy that can achieve the highest viral yield.

[0100] This embodiment constructs and evaluates viral vectors containing the following four representative linkers for hexon fusion antigens. The antigen gene is an OVA, and the specific linkers are as follows:

[0101] Flexible Linker: GS Linker, sequence as shown in SEQ ID No. 1.

[0102] Polyglycine Linker: Poly-(G)n, n=8, sequence: GGGGGGGG, corresponding nucleic acid sequence: GGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGA.

[0103] Rigid Linker: (EAAAK)n, n=3, sequence: EAAAKEAAAKEAAAK, corresponding nucleic acid sequence: GAAGCTGCTGCTAAGGAAGCTGCTGCTAAGGAAGCTGCTGCTAAG.

[0104] Proline-rich (XP)n Linker: Pro-rich, X=A, n=4, sequence: APAPAPAP, corresponding nucleic acid sequence: GCTCCAGCTCCAGCTCCAGCTCCA.

[0105] Using the different linkers described above, the same viral vector was constructed according to the method of this invention. The gene structure diagrams of each linker series of viruses are shown below. Figure 7 As shown in the electron micrograph, the virus particles are as follows: Figure 8 As shown.

[0106] according to Figure 8It can be seen that the viral vector using the flexible linker fragment of the present invention exhibits the highest viral yield. In contrast, the viral yield of vectors using polyglycine linker, (EAAAK)n linker, or (XP)n linker is significantly reduced.

[0107] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A Hexon hypervariable region fusion gene segment of an adenovirus capsid, characterized in that, The HVR1 region and the HVR5 region of the Hexon hypervariable region are replaced by gene fragments containing an exogenous gene; in the gene fragments, the exogenous gene is connected with a flexible connection fragment at both ends, the gene sequence of the flexible connection fragment is shown as SEQ ID No. 1; the replacement fragment of the HVR1 region is shown as SEQ ID No. 2, and the replacement fragment of the HVR5 region is shown as SEQ ID No. 3; and the adenovirus is a human 5-type adenovirus.

2. The Hexon hypervariable region fusion gene segment of adenovirus capsid according to claim 1, characterized in that, The exogenous gene located in the HVR1 region and the HVR5 region can be independently selected from an HPV antigen gene or an OVA antigen gene.

3. The Hexon hypervariable region fusion gene segment of an adenovirus capsid according to claim 2, characterized in that, The HPV antigen gene is a gene for encoding human papilloma virus type 16 L2 protein.

4. A recombinant adenovirus displaying an oversize fragment antigen on the surface of the coat, characterized in that, The gene sequence of the recombinant adenovirus comprises the Hexon hypervariable region fusion gene fragment according to any one of claims 1-3.

5. A method of constructing a recombinant adenovirus according to claim 4, wherein the adenovirus is a recombinant adenovirus of serotype 5. The method comprises the following steps: ​ linearizing an adenovirus backbone plasmid; synthesizing the Hexon hypervariable region fusion gene fragment in vitro; co-transforming the linearized adenovirus backbone plasmid and the Hexon hypervariable region fusion gene fragment into a competent cell to obtain a recombinant adenovirus plasmid; amplifying and identifying the recombinant adenovirus plasmid, and then performing packaging and purification to obtain the recombinant adenovirus with the capsid surface display super-large fragment antigen.

6. The method of constructing a recombinant adenovirus according to claim 5, wherein, The virus backbone plasmid is a BJ5183-pADeasy plasmid, and the competent cell is a BJ5183 competent cell.

7. The method of constructing a recombinant adenovirus according to claim 5, wherein, The packaging mode is to linearize the recombinant adenovirus plasmid by using a restriction enzyme to expose its inverted terminal repeat sequence, and then transfecting into a packaging cell line.

8. The recombinant adenovirus of claim 4 in the preparation of a vaccine.

9. Use of a recombinant adenovirus according to claim 8, characterised in that, The vaccine is a monovalent vaccine, a bivalent vaccine or a multivalent vaccine.

Citation Information

Patent Citations

  • Method for enhancing HPV epitope peptide immunogenicity, viroid particle, particle preparation method and application

    CN104531741A

  • Peste des petits ruminants virus recombinant fusion protein and application thereof

    CN117866106A