Construction method of recombinant bacillus subtilis for producing small cells
By constructing recombinant Bacillus subtilis and undergoing adaptive evolution, knocking out the septum inhibitor protein gene and overexpressing cell septum components and lipid metabolism genes, the problem of insufficient efficiency in the production of Minicell by Bacillus subtilis was solved, and the yield and stability of Minicell were improved.
Patent Information
- Application Number
- CN202511476515.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-16
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-16
AI Technical Summary
The efficiency and stability of Bacillus subtilis in producing Minicell in existing technologies are insufficient to meet the needs of industrial production.
By constructing recombinant Bacillus subtilis, knocking out the gene encoding the septum inhibitor protein and overexpressing genes related to cellular septum components and lipid metabolism, and combining this with adaptive evolution technology, the production pathway of Minicell was optimized.
It significantly improves Minicell's output and production stability, providing a more efficient and stable industrial production solution.
Smart Images

Figure CN120944934A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering, specifically relating to a method for constructing recombinant Bacillus subtilis for producing small cells. Background Technology
[0002] Reports of bacteria producing small cells (Minicell) dated back to 1930, but the term "Minicell" was not formally used until its discovery in a mutant strain of *E. coli* in 1967. In recent years, with the development of gene editing and nanotechnology, non-replicating Minicell derived from bacteria has received increasing attention. Minicell has now been successfully isolated from bacteria such as *E. coli*, *Salmonella typhimurium*, *Shigella*, *Corynebacterium glutamicum*, and lactic acid bacteria.
[0003] Minicells are small, chromosome-free cells capable of carrying target molecules. Due to their unique physical properties and intracellular space, minicells are widely used in drug delivery, protein expression, and genetic engineering. (Bacillus subtilis...) Bacillus subtilis As a commonly used bacterial host, Bacillus subtilis is an ideal choice for producing Minicell due to its clear genetic background, rapid growth rate, and high culturability. However, the efficiency of Bacillus subtilis in producing Minicell is still limited, and technological innovation is needed to further improve its production capacity.
[0004] Traditional methods for producing minicell typically rely on genetic engineering techniques, such as deleting or mutating genes related to cell division to induce its formation. While these methods have made some progress, the yield and stability of minicell remain insufficient for industrial-scale production. Furthermore, there have been no recent reports on the yield of minicell produced by Bacillus subtilis. Therefore, how to further improve the efficiency of minicell production by Bacillus subtilis has become a pressing problem in the field of bioengineering.
[0005] In recent years, adaptive evolution technology has gradually become an important means of optimizing microbial production capacity. By simulating the process of natural selection, adaptive evolution enables microorganisms to gradually accumulate beneficial mutations under specific culture conditions, thereby enhancing their growth capacity and product production capacity in extreme environments. In the production process of Minicell, adaptive evolution not only improves the tolerance of Bacillus subtilis but also enhances its adaptability to different culture conditions, thereby increasing the yield of Minicell. Summary of the Invention
[0006] Objective of the Invention: The technical problem to be solved by this invention is to address the shortcomings of existing technologies by providing a method for improving the production of small-cell Minicell by Bacillus subtilis. The method includes constructing a recombinant Bacillus subtilis strain that produces Minicell and adaptively evolving the recombinant Bacillus subtilis strain. The recombinant Bacillus subtilis strain promotes Minicell formation by regulating key genes involved in cell division.
[0007] To address the aforementioned technical problems, this invention discloses a method for improving the production of small-cell Minicell by Bacillus subtilis. The specific technical solution is as follows: In a first aspect, the present invention provides a method for constructing a recombinant Bacillus subtilis for producing small cells, wherein the recombinant Bacillus subtilis knocks down or eliminates the expression of a gene encoding a membrane repressor protein and overexpresses the expression of a gene encoding a cell membrane component and / or a lipid metabolism-related gene; the gene encoding the membrane repressor protein includes any one or a combination of several of minC, minD, or minJ; the gene encoding a cell membrane component includes ftsA and / or ftsZ; and the lipid metabolism-related gene includes plsX and / or plsC. The minC, minD, and minJ genes are encoded sequentially by the amino acid sequences shown in SEQ ID NO. 1-3 or their truncated forms. The ftsA, ftsZ, plsX, and plsC genes are encoded sequentially by the amino acid sequences shown in SEQ ID NO. 5-8. Preferably, the knockdown or deletion of gene expression is achieved through CRISPR / Cas9 editing technology (Altenbuchner, Josef. Editing of the Bacillus Subtilis Genomeby the Crispr-Cas9 System, Applied and environmental microbiology, 2016, 82(17): 5421-5427). More preferably, the expression of the cell membrane component encoding genes and / or lipid metabolism-related genes is regulated by RBS sequences; wherein the RBS sequence is shown in SEQ ID NO.9.
[0008] Preferably, the overexpressed gene is expressed by first integrating the gene into an overexpression plasmid and then transforming it into Bacillus subtilis for expression. The overexpression plasmid includes, but is not limited to, pHT01, pHT43, pBE2R, pAX01, or pDG148. Any plasmid that can express the key gene in Bacillus subtilis according to existing technology is suitable for this invention. pHT01 is further preferred.
[0009] Preferably, the recombinant Bacillus subtilis knocks out the expression of the membrane inhibitory protein encoding genes minC and minD; and simultaneously overexpresses the cell membrane component encoding genes ftsZ and ftsA and the lipid metabolism-related gene plsX; the minC, minD, ftsA, ftsZ and plsX genes are encoded by the amino acid sequences shown in SEQ ID NO.1~2 and SEQ ID NO.5~7, respectively.
[0010] The recombinant Bacillus subtilis, wherein the originating strain includes Bacillus subtilis. Bacillus subtilis Any one of 168, PY79, NCIB 3610, DB104, WB600, WB800, QB928, C-3102, or 29784. Preferably, it is Bacillus subtilis. Bacillus subtilis 168.
[0011] In a second aspect, the present invention provides recombinant Bacillus subtilis constructed by the construction method described in the first aspect.
[0012] Thirdly, the present invention provides a method for improving the production of small cells by Bacillus subtilis, wherein the recombinant Bacillus subtilis described in the second aspect undergoes adaptive evolution; the adaptive evolution involves inoculating the recombinant Bacillus subtilis into a passage medium and continuously passaged for 10 to 80 generations. The passage medium comprises 5 to 15 g / L peptone, 1 to 5 g / L yeast extract, and 5 to 10 g / L sodium chloride. In some embodiments of the present invention, the passage medium further comprises 0.1 to 2% v / v stress factor; the stress factor includes any one of ethanol, antibiotics, or metal ions. Preferably, the continuous passage involves subculturing for 2 to 8 hours each time, with an inoculation amount of 1 to 5% v / v; more preferably, subculturing for 6 hours each time. The stress factor is preferably ethanol, added at a concentration of 0.1% v / v.
[0013] Preferably, in this invention, the small cells obtained from the recombinant Bacillus are produced using a method of differential centrifugation combined with ultrasound to destroy the parent cells and / or an antibiotic lysis method. The differential centrifugation combined with ultrasound to destroy the parent cells involves first centrifuging the *E. coli* bacterial solution at low speed to obtain a supernatant, then centrifuging the supernatant at high speed to obtain a precipitate, resuspending the precipitate, and then ultrasonically disrupting it to obtain Minicell. The low-speed centrifugation is 400–1000 × g for 1–10 min, preferably 800 × g for 5 min; the high-speed centrifugation is 10000–13000 × g for 10–20 min, preferably 13000 × g for 20 min; the ultrasound is performed at a power of 50–100 W, preferably 90 W. The antibiotic lysis method uses any one of penicillin, ceftriaxone, or fosfomycin, preferably ceftriaxone; the concentration of the antibiotic is 50–300 μg / mL, preferably 200 μg / mL, and the lysis time is 20–60 min, preferably 30 min.
[0014] Fourthly, the present invention provides the application of the recombinant Bacillus subtilis described in the second aspect or the recombinant Bacillus prepared by the method described in the third aspect in the fermentation production of biomacromolecules.
[0015] The biomolecules mentioned include any one of nucleic acids, proteins, or intracellular polysaccharides; the proteins include green fluorescent protein; and the fermentation involves inoculating recombinant Bacillus into a fermentation medium and culturing it at 18–37°C until OD (Organic Demand). 600 When the OD value is 0.6–0.8, add 0.01–2.0 mM isopropyl-β-D-thiogalactoside (IPTG) and continue fermentation for 8–72 h; preferably, fermentation is carried out at a temperature of 37°C and a rotation speed of 200 rpm, until the OD value reaches 0.6–0.8. 600 When the pH is 0.6–0.8, 0.2 mM isopropyl-β-D-thiogalactoside is added, and the total fermentation time is 20 h. The fermentation medium includes any one of LB medium, TB medium, or TSB medium, preferably LB medium. The LB medium has the following formulation: peptone 5–15 g / L, yeast extract 1–5 g / L, sodium chloride 5–10 g / L; the TB medium has the following formulation: peptone 5–15 g / L, yeast extract 5–30 g / L, disodium hydrogen phosphate 5–15 g / L, potassium dihydrogen phosphate 1–5 g / L, glycerol 1–10 mL / L; the TSB medium has the following formulation: peptone 10–20 g / L, soybean papain hydrolysate 1–5 g / L, sodium chloride 5–10 g / L, dipotassium hydrogen phosphate 1–5 g / L, glucose 1–5 g / L.
[0016] Beneficial effects: This invention constructs a novel Bacillus subtilis Minicell production platform by combining genetic engineering and adaptive evolution techniques. The method of this invention not only optimizes the Minicell production pathway through genetic modification but also further enhances the strain's production capacity through adaptive evolution, providing a more efficient and stable solution for the industrial production of Minicell. The specific beneficial effects of this invention are as follows: (1) This invention fundamentally disrupts the normal division mechanism of Bacillus subtilis by systematically modifying cell division-related genes, thereby significantly increasing the probability of producing Minicell through polar division. Combined with adaptive evolutionary screening, the production phenotype of the strain is further enhanced, ultimately increasing the yield of Minicell; (2) This invention not only constructs a high-yield chassis through genetic engineering, but also enables beneficial mutations to be fixed and strengthened in the population through continuous generation and adaptive evolution. (3) The strategy of “genetic engineering to construct chassis - adaptive evolution to enhance traits - culture medium and process optimization” adopted in this invention is not only applicable to the Bacillus subtilis strain 168 described in this embodiment, but its technical principles and methods can also be widely applied to the modification of Minicell production strains of other Bacillus subtilis strains and even other bacteria. Attached Figure Description
[0017] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.
[0018] Figure 1 This is a comparison of the growth curves of different genotypes of Bacillus subtilis strains in LB medium.
[0019] Figure 2 A comparison chart of Minicell production from different genotypes of Bacillus subtilis strains.
[0020] Figure 3 The image shows the plate validation results of the Minicell sample after ceftriaxone lysis. In the image, a represents BS168 before lysis, b represents BS168 after lysis, and c represents BS168 Δ after lysis. minC d represents the BS168 Δ after pyrolysis. minJ e represents the BS168 Δ after pyrolysis. minCD f represents the BS168 Δ after pyrolysis. divIVA.
[0021] Figure 4Microscopic morphological observations of Minicell produced by different genotype chassis strains are shown. White arrows point to small cells. In the figures, A is a microscopic image of purified Minicell, and B is a microscopic image of Minicell before purification.
[0022] Figure 5 Statistical analysis of the size of Minicell produced by different genotype Bacillus subtilis strains.
[0023] Figure 6 The graph shows the yield and extraction rate of Minicell from different genotypes of chassis strains in different culture media. A represents the extraction rate in LB, B in TB, C in TSB, and D represents the OD per unit volume in LB. 600 E is the OD per unit volume in TB. 600 F is the OD per unit volume in TSB. 600 .
[0024] Figure 7 For BS168△ minCD Overexpression based on plsX , ftsA or ftsZ The effect of genes on the extraction rate and yield of Minicell. Where A represents the extraction rate and B represents the OD per unit volume. 600 .
[0025] Figure 8 The graph shows the yield and extraction rate of Minicell from the recombinant strain at different temperatures and IPTG concentrations. A represents the extraction rate, and B represents the OD per unit volume. 600 .
[0026] Figure 9 BS168△ minCD and BS168△ divIVA The graph shows the trend of Minicell yield changes during the adaptive evolution of the strain under conventional and ethanol stress conditions. Where A represents the extraction rate and B represents the OD per unit volume. 600 .
[0027] Figure 10 The results of EGFP protein expression in the recombinant strain are shown in the figure. A is an SDS-PAGE electrophoresis image of the strain expressing EGFP protein; B is a bar chart comparing the quantitative fluorescence intensity per cell of the strain; C is a morphological observation image of the strain under a fluorescence microscope, clearly showing the fluorescence expression of the mother cell and Minicell. Detailed Implementation
[0028] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; the reagents and materials described are commercially available unless otherwise specified.
[0029] In the following examples, the formulation of the GM I solution is as follows: 9.6 mL of inorganic salt stock solution, 2.5 mL of 20% w / v (g / mL) glucose, 0.4 mL of 5% w / v (g / mL) hydrolyzed casein, 1 mL of 10% w / v (g / mL) yeast extract, and distilled water to a final volume of 100 mL. Each component is sterilized separately. The formulation of the GM II solution is as follows: 9.7 mL of inorganic salt stock solution, 2.5 mL of 20% w / v (g / mL) glucose, 0.08 mL of 5% w / v (g / mL) hydrolyzed casein, 0.04 mL of 10% w / v (g / mL) yeast extract, 0.25 mL of 1M magnesium chloride, 0.05 mL of 1M calcium chloride, and distilled water to a final volume of 100 mL. Each component is sterilized separately. The inorganic salt mother liquor formula is as follows: 140 g / L anhydrous dipotassium hydrogen phosphate, 60 g / L anhydrous potassium dihydrogen phosphate, 20 g / L ammonium sulfate, 10 g / L trisodium citrate dihydrate, and 2 g / L magnesium sulfate heptahydrate, sterilized at 121℃ for 15 min. The LB medium formula is as follows: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride; the TB medium formula is as follows: 12 g / L peptone, 24 g / L yeast extract, 9.4 g / L disodium hydrogen phosphate, 2.2 g / L potassium dihydrogen phosphate, and 4 mL / L glycerol; the TSB medium formula is as follows: 17 g / L peptone, 3 g / L soybean papain hydrolysate, 5 g / L sodium chloride, 2.5 g / L dipotassium hydrogen phosphate, and 2.5 g / L glucose.
[0030] Bacillus subtilis used in the following examples Bacillus subtilis The originating bacteria is Bacillus subtilis. Bacillus subtilis 168 (BS168).
[0031] In the following examples, the extraction rate of the small cells (also known as the unit OD) is... 600 The extraction rate (%) was calculated as follows: OD after purification = 600 / Concentration Factor / Original OD 600 In the following embodiments, the unit volume OD of the small cells is... 600 (abbreviated as A) 600 A was calculated as follows: 600 =Purified OD 600 / Concentration factor / Volume before dilution; The yield of the small cells was calculated as follows: Yield (cells / mL) = A 600 ×5.0×10 10 .
[0032] Example 1: Chassis construction with inactivated minC, minJ, minCD, and divIVA 1. Construction of Donor Fragments Taking the knockout of the minC gene as an example, using the Bacillus subtilis 168 genome as a template, PCR amplification was performed using primer pairs minCup-F / R and minC down-F / R, respectively, yielding homologous arms of approximately 1000 bp upstream and downstream of the minC gene, which were used as Donor fragments. The construction process for the Donor fragments of the minJ, minCD (minC and minD), and divIVA genes was the same. The primer sequences used are shown in Table 1. The amino acid sequences of the proteins encoded by minC, minD, minJ, and divIVA are shown in SEQ ID NO. 1~4, respectively.
[0033] Table 1 Primer sequences for constructing Donor DNA
[0034] 2. Construction of mutant sgRNA The N20 sequences of the minC, minJ, minCD, and divIVA genes to be knocked out were searched and identified on the CHOPCHOP website. Using pJOE8999 plasmid as a template, upstream and downstream primers containing the corresponding N20 sequences were designed for reverse PCR. The upstream and downstream primer sequences corresponding to the N20 sequences are shown in Table 2. The minC N20, minJ N20, minCD N20, and divIVA N20 sequences were amplified.
[0035] Table 2 shows the upstream and downstream primer sequences corresponding to the N20 sequence.
[0036] After verification by nucleic acid gel electrophoresis, the above PCR products (upstream and downstream homologous arms and N20 sequence) were extracted using a Takara gel extraction kit (Code No. 9762) to obtain three fragment products. Using these three fragments as templates, the ligation products of the above three fragments were obtained by using primer N20-F in Table 2 and primer down-R in Table 1 via overlap PCR. The resulting minC knockout, minJ knockout, minCD knockout, and divIVA knockout samples were all 2227 bp in length. The 5' end of the knockout slides contains the homologous sequence gttgggaagggcgatcg (SEQ ID NO.35) at the Pvu I restriction site of plasmid pJOE8999, and the 3' end of the knockout slides contains the homologous sequence tctagattaagaaataatcttc (SEQ ID NO.36) at both the Pvu I and Xba I restriction sites of plasmid pJOE8999. This ensures that plasmid pJOE8999 can be cloned in one step using the Novizan kit (C112) and knockout slides after double digestion with Pvu I and Xba I.
[0037] The PCR amplification system (50 μL) consisted of: 25 μL Max premix (2x), 1 μL primer F, 1 μL primer R, 1 μL template, and 22 μL ddH2O.
[0038] The PCR amplification program is as follows: 98 ℃ pre-denaturation for 3 min, 98 ℃ denaturation for 10 sec, 55 ℃ annealing for 5 sec, 72 ℃ extension for 1 min 5 sec, denaturation, annealing, and extension cycles for 30 times, 72 ℃ extension for 5 min, and storage at 4 ℃.
[0039] The amplification system for overlap PCR (50 μL) is as follows: Max premix (2x) 25 μL, primer F 1 μL, primer R 1 μL, N2O fragment 1 μL, upstream homologous arm fragment 1 μL, downstream homologous arm fragment 1 μL, ddH2O 20 μL. The overlap PCR amplification program is the same as above, except that the extension at 72 ℃ for 1 min 5 sec is changed to 2.5 min.
[0040] The overlap PCR product and the plasmid pJOE8999, which had been double-digested with Pvu I and Xba I, were cloned in one step using the Novizan kit (C112). The knockout plasmid pJOE8999- was successfully constructed. minC pJOE8999- minJ pJOE8999- minCD pJOE8999- divIVA.
[0041] The double enzyme digestion system consisted of: 10 x QuickQut Buffer 3 μL, plasmid DNA 5 μL, Pvu I 1 μL, Xba I 1 μL, and ddH2O 20 μL. The one-step cloning and ligation system consisted of: 2 x Mix 5 μL, plasmid backbone 2 μL, N20-UP-DOWN knockout fragment 1 μL, and ddH2O 2 μL.
[0042] 3. Construction of gene knockout strains (1) Preparation of BS168 competent cells: Activated BS168 single colonies were inoculated into 5 mL shaker tubes containing GM I solution and cultured at 30 ℃ and 125 rpm for 16 h. 2 mL of the inoculum was transferred to 18 mL of fresh GM I solution and cultured for 3.5 h (37 ℃, 200 rpm) to obtain seed culture. 10 mL of the seed culture was transferred to 90 mL of GM II culture medium and cultured at 37 ℃ and 200 rpm for 90 min. The cells were collected by centrifugation at 4 ℃ for 10 min, and 10 mL of the liquid was reserved for resuspending the bacterial culture to obtain BS168 competent cells. Each tube was aliquoted into 500 μL and stored at -80 ℃.
[0043] (2) Gene knockout was performed by introducing the knockout plasmid into BS168 cells: BS168 competent cells were incubated in a water bath at 45 ℃ for 3-5 min, and 1 μg of the constructed knockout plasmid pJOE8999- was added to each cell. minC pJOE8999- minJ pJOE8999- minCD pJOE8999- divIVA DNA was incubated at 37 °C for 90 min, plated on LB agar plates containing 5 μg / mL Kan, and incubated at 30 °C for 18 h. Single colonies were picked and streaked onto new LB agar plates and incubated at 48 °C for 12 h for colony PCR verification. Correctly verified transformants were picked and incubated at 48 °C with a shaker at 200 rpm for 12 h. They were then streaked onto LB agar plates using an inoculation loop and incubated at 37 °C for 12 h. Single colonies were picked and streaked onto LB agar plates and incubated at 37 °C for 12 h for colony PCR verification. Correctly verified transformants were incubated overnight at 37 °C. 500 μL of the bacterial culture was added to 500 μL of 40% glycerol and stored in a preservation tube to obtain the modified strain BS168△. minC、 BS168△ minJ BS168△ minCD BS168△ divIVA The primers used for colony PCR verification are shown in Table 3.
[0044] Table 3 Primer sequences required for constructing the knockout strain.
[0045] Finally, in this embodiment, using BS168 as the starting strain, the minC, minJ, minCD, and divIVA genes were knocked out using CRISPR-Cas technology to obtain the recombinant strain BS168△. minC、 BS168△ minJ BS168△ minCD and BS168△ divIVA The recombinant strains constructed in this invention are shown in Table 4.
[0046] Table 4 List of strains
[0047] Example 2: Investigation of different chassis growth concentrations The strain BS168 and the recombinant strain BS168△ constructed in Example 1 were used. minC BS168△ minCD and BS168△ divIVA Single colonies were obtained by streaking the culture onto LB agar plates and incubating at 37 °C for 12–16 h. A suitable amount of bacterial sludge was scraped from the agar plate using a sterile inoculation loop and inoculated into 50 mL of LB liquid medium. The culture was then incubated at 37 °C with shaking at 200 rpm for 12 h to obtain the primary seed culture. The primary seed culture was then transferred at a 1% v / v inoculation rate to 250 mL Erlenmeyer flasks containing 50 mL of LB liquid medium and incubated at 37 °C with shaking at 200 rpm for 14 h. Samples were taken every 2 hours, and the absorbance (OD) of the samples was measured at 600 nm using a UV spectrophotometer. 600 This is used to characterize the growth density of the bacteria.
[0048] like Figure 1 As shown, BS168, BS168△ minC BS168△ minCD and BS168△ divIVA The strains showed similar growth trends, reaching similarly high cell densities after 12 h of culture. This indicates that the deletion of the minC, minD, or divIVA genes did not have a significant negative impact on the basal growth capacity of Bacillus subtilis. However, BS168△ minJ The growth lag phase of this strain was significantly longer than that of other strains, and its growth rate was slow throughout the 14-hour culture period. The cell density when it finally entered the stationary phase was significantly lower than that of all other strains.
[0049] Example 3: Number of Minicell genes in the chassis with only inactivated key genes The strain BS168△ obtained in Example 1 minC BS168△ minCDand BS168△ divIVA Streak the cells onto LB agar plates and incubate overnight at 37 °C with the plates inverted. Select a single colony with good growth and inoculate it into 5 mL of LB liquid medium. Incubate overnight at 37 °C and 200 rpm to obtain a primary seed culture. Transfer the primary seed culture to 50 mL of LB medium at an inoculation rate of 1% v / v and continue incubating at 37 °C and 200 rpm for 12 h to obtain a large number of cells.
[0050] After culture, Minicell was isolated and purified: First, it was centrifuged at 800×g for 5 minutes at 4 °C, and the supernatant was collected to remove the parent cells; then, the supernatant was centrifuged at 13000×g for 20 minutes at 4 °C, and the precipitate was collected to obtain crude Minicell. The precipitate was resuspended in fresh LB medium and cultured at 37 °C and 250 rpm for 35 minutes. Then, ceftriaxone was added to the bacterial suspension to a final concentration of 200 μg / mL, and the suspension was treated at 37 °C and 250 rpm for 30 minutes to completely lyse any remaining parent cells. After lysis, differential centrifugation was performed again: first, centrifugation at 800×g for 5 minutes to remove cell debris, then centrifugation of the supernatant at 13000×g for 20 minutes, and the resulting precipitate was the purified Minicell. Finally, the Minicell precipitate was washed with sterile PBS buffer and resuspended, and its OD was measured. 600 Values are used to quantify output ( Figure 2 And the absence of maternal cell residue was verified by LB agar plate culture. Figure 3 This demonstrates that the purification effect was good.
[0051] The results showed that different genotypes of the chassis strains exhibited significant differences in their ability to produce Minicell. Among them, BS168△ minCD The strain produced the highest yield of Minicell, with an OD per unit volume. 600 Reaching 0.00635, the Minicell yield is approximately 3.17 × 10⁻⁶. 8 cells / mL. And BS168-△ minJ Minicell has the lowest yield due to severe damage to its own growth.
[0052] Example 4: Size measurement and morphological observation of Minicell in the chassis of the inactivated key gene only. Microscopic imaging techniques were used to objectively characterize the morphological features of Minicell cells produced by Bacillus subtilis after inactivation of different key genes for cell division, and to perform precise statistical analysis on their size. Minicell samples from each strain purified in Example 3 were used to prepare bacterial suspensions and sections, which were then observed under an optical microscope, and multiple fields of view were captured as microscopic images. To ensure the objectivity and representativeness of the measurement results, ImageJ software was used to select multiple microscopic images containing the target cells. Cells in the images were randomly selected without subjective bias (avoiding the artificial selection of larger or smaller cells), and their lengths were subsequently measured and statistically analyzed. The results are as follows: Figure 4 As shown, the Minicell produced by different genotypes of chassis strains were relatively uniform in morphology and size. Statistical analysis indicated that the average size of the Minicell population produced by each strain was 0.4–0.6 μm. Figure 5 ).
[0053] Example 5: Optimization of Minicell Production in Different Culture Media The activated recombinant strain was inoculated into 50 mL of LB, TB, and TSB media at a 1% v / v inoculation rate and cultured at 37°C and 200 rpm for 10 h. After culture, Minicell was purified according to the purification method described in Example 3. The purified Minicell precipitate was resuspended in an equal volume of PBS buffer, and its OD was measured using a UV spectrophotometer. 600 The value was used to quantify the yield of Minicell. Results showed that BS168Δ values were found in various culture media. minCD All strains exhibited the highest Minicell yield ( Figure 6 (D~F in the text). Specifically, the OD per unit volume of Minicell cultured in TB medium... 600 Reaching 0.00883 corresponds to a yield of 4.41 × 10⁻⁶. 8 cells / mL; however, this group had the lowest extraction rate, at only 2.15% ( Figure 6 The result (B) indicates that the separation efficiency of Minicell is limited under high-density culture conditions. In contrast, the yield of Minicell in the LB medium group was slightly lower (4.02 × 10⁻⁶). 8 (cells / mL), but the extraction rate reached a maximum of 4.64%, showing better separation efficiency; in the TSB medium group, all indicators were at an intermediate level, with its OD per unit volume being [missing information]. 600 The value is 0.00789, and the output is approximately 3.94 × 10⁻⁶. 8 The extraction rate was 3.66%, with cells / mL. The results indicate that, considering both the efficiency and cost of separation and purification, LB medium demonstrates an advantage due to its higher extraction rate.
[0054] Example 6: Construction of recombinant strains overexpressing single genes plsX, ftsA, and ftsZ Expression plasmids pHT01-plsX, pHT01-ftsA, and pHT01-ftsZ were constructed using key genes ftsA, ftsZ, and plsX derived from BS168 that are related to cell division and membrane synthesis. The ftsA, ftsZ, and plsX genes are encoded by the amino acid sequences shown in SEQ ID NO. 5–7.
[0055] Table 5 Primer sequences used to construct single-gene expression plasmids
[0056] Specifically, using the BS168 genome as a template, the plsX, ftsA, and ftsZ fragments were amplified by PCR using the primer pairs described in Table 5. The upstream and downstream of these fragments contained homologous sequences of plasmid pHT01 after digestion with BamHI and XbaI, ensuring that plasmid pHT01 could be cloned in one step using the Novizan kit (C112) and PCR fragments after BamHI digestion. This resulted in the successful construction of expression plasmids pHT01-plsX, pHT01-ftsA, and pHT01-ftsZ.
[0057] Take BS168 and BS168△ minCD Competent cells were incubated in a water bath at 45 ℃ for 3-5 min, and 1 μg of pHT01- was added to each cell. plsX pHT01- ftsA or pHT01- ftsZ The expressed plasmid DNA was incubated at 37 °C for 90 min, then plated onto LB agar plates containing 5 μg / mL Kan and incubated at 37 °C for 12 h. Single colonies were picked and streaked onto LB agar plates containing 5 μg / mL chloramphenicol (Chl) and incubated at 37 °C for 12 h. After colonies grew, the correct transformants were picked and incubated overnight at 37 °C. 500 μL of the bacterial culture was then added to 500 μL of 40% glycerol and stored in a preservation tube. Finally, strain BS168 was obtained in this example. △minCD - plsX、 BS168 △minCD - ftsA and BS168 △minCD - ftsZ . BS168△ minCD As a control strain, the above-mentioned strain was cultured in LB medium at 37°C according to the method described in Example 3, and the bacterial culture was treated according to the purification procedure in Example 3. Minicell was collected and resuspended in PBS buffer, and finally its OD was measured. 600 The yield of Minicell was quantified using a value. Results showed that at BS168△ minCD Overexpression of key splitting genes alone did not further increase Minicell production; instead, it produced varying degrees of repression. Figure 7 ). BS168△ minCD Minicell had the highest yield, approximately 4.23 × 10⁻⁶. 8 cells / mL. In contrast, the yield of Minicell in engineered strains overexpressing the plsX, ftsA, or ftsZ genes all decreased significantly, dropping to approximately 2.95 × 10⁻⁶ cells / mL. 8 cells / mL, 3.66×10 8 cells / mL and 3.28×10 8 cells / mL. This result indicates that, in a genetic background where minCD is missing, overexpression of one of the genes alone is detrimental to the specific generation of Minicell.
[0058] Example 7: Construction of a recombinant strain overexpressing the fusion of key multi-genes plsX, plsC, ftsA, and ftsZ Using the key genes plsX, plsC, ftsA, and ftsZ derived from BS 168 that are related to cell division and membrane synthesis, expression plasmids pHT01-plsX-ftsA-ftsZ and pHT01-plsX-plsC-ftsA-ftsZ were constructed. The primer sequences for constructing the corresponding expression plasmids are shown in Table 6. The plsC gene is encoded by the amino acid sequence shown in SEQ ID NO. 8.
[0059] Table 6 Primer sequences used to construct multi-gene fusion expression plasmids
[0060] Construction of recombinant plasmid pHT01-plsX-ftsA-ftsZ: Using the BS168 genome as a template, the plsX fragment was amplified by PCR using primers pHT01-plsX-F2 / R2 (Table 6); the ftsA-ftsZ fragment was amplified using primers pHT01-ftsA-ftsZ-F / R. The plsX and ftsA-ftsZ fragments were then crossed using primers pHT01-plsX-F2 and pHT01-ftsA-ftsZ-R via overlap. PCR yielded the plsX-ftsA-ftsZ fragment, and the upstream and downstream of this fragment contained homologous sequences from the sites of BamHI and XbaHI digestion of plasmid pHT01. This ensured that plasmid pHT01, after being digested with BamHI, could be cloned in one step using the Novizan kit (C112) and the plsX-ftsA-ftsZ fragment to obtain the recombinant plasmid pHT01-plsX-ftsA-ftsZ.
[0061] Construction of recombinant plasmid pHT01-plsX-plsC-ftsA-ftsZ: Using the BS168 genome as a template, and with primers pHT01-plsX-F2 / R3 (Table 6) as primers, the plsX fragment was amplified by PCR; the plsC fragment was amplified using primers pHT01-plsC-F / R; and the ftsA-ftsZ fragment was amplified using primers pHT01-ftsA-ftsZ-F2 / R. The three fragments were then processed... Overlap PCR yielded the plsX-plsC-ftsA-ftsZ fragment, and the upstream and downstream of this fragment contained homologous sequences from the BamHI and XbaHI digestion sites of plasmid pHT01. This ensured that plasmid pHT01, after being digested with BamHI, could be cloned in one step using the Novizan kit (C112) and the plsX-plsC-ftsA-ftsZ fragment to obtain the recombinant plasmid pHT01-plsX-plsC-ftsA-ftsZ.
[0062] Take BS168△ minCD and BS168△ divIVA The competent cells were incubated at 45℃ for 3-5 min in a water bath. 1 μg of expression plasmid DNA from pHT01-plsX-ftsA-ftsZ and pHT01-plsX-plsC-ftsA-ftsZ was added, and the cells were incubated at 37℃ for 90 min. The resulting culture was then plated onto LB agar plates containing 5 μg / mL Kan and incubated at 37℃ for 12 h. Single colonies were picked from the plates and streaked onto LB agar plates containing 5 μg / mL Chl. The colonies were incubated at 37℃ for 12 h. After colonies grew, the correct transformants were picked and incubated overnight at 37℃. 500 μL of the bacterial culture was added to 500 μL of 40% glycerol and stored in a preservation tube to obtain strain BS168△. minCD -pHT01-plsX-ftsA-ftsZ、BS168△ minCD -pHT01-plsX-plsC-ftsA-ftsZ、BS168△ divIVA -pHT01-plsX-ftsA-ftsZ and BS168△ divIVA -pHT01-plsX-plsC-ftsA-ftsZ, see Table 4 for details.
[0063] To determine the optimal production conditions, a two-factor optimization experiment was conducted using induction temperature (25, 30, and 37 °C) and IPTG induction concentration (0.2, 0.5, and 1.0 mM). The strain was cultured in LB medium at 37 °C until mid-log phase (OD2). 600The concentration of IPTG was increased to 0.6–0.8 mM, and different concentrations (0.2, 0.5, or 1.0 mM) were added and the cultures were incubated at the corresponding temperatures (25, 30, or 37°C) for 20 hours. After fermentation, Minicell was purified according to the procedure described in Example 3, and the OD value was determined. 600 The absolute yield and extraction rate were calculated. The results showed that temperature and inducer concentration had a significant impact on the yield of Minicell. Figure 8 37℃ was determined to be the optimal induction temperature, at which the metabolic activity and protein expression levels of the bacteria were more efficient, thus significantly promoting the production of Minicell. Specifically, Minicell production peaked at an IPTG concentration of 0.2 mM. Under these optimal conditions (37℃, 0.2 mM IPTG), the multi-gene fusion strain exhibited superior production performance. The OD of the purified Minicell suspension... 600 The value is the highest, and its output, after conversion, reaches approximately 9.35 × 10⁻⁶. 8 This yield exceeded that of the control chassis strain with only minCD inactivation (4.23 × 10⁻⁶ cells / mL). 8 (cells / mL). Meanwhile, its extraction rate was also increased to 9.37%.
[0064] Example 8: Number of Minicells in Adaptive Laboratory Evolution With BS168△ minCD and BS168△ divIVA The starting strain was continuously passaged to achieve adaptive evolution. The evolutionary process consisted of two parallel experimental groups: a conventional evolution group (continuously passaged in LB medium) and an ethanol stress evolution group (continuously passaged in LB medium containing 0.1% v / v ethanol). The specific procedure was as follows: After streaking activation, the strain was transferred to 50 mL of fresh subculture medium at an inoculum of 1% v / v and incubated at 37°C and 200 rpm for 6 hours to complete one generation. The next subculture was then immediately performed at an inoculum of 1% v / v, and this cycle was repeated. Every 15 generations, samples were taken and cryopreserved. Simultaneously, shake-flask fermentation, Minicell purification, and quantification were performed according to standard methods to monitor dynamic changes in production capacity.
[0065] Conventional evolutionary group: After multiple generations of adaptive evolution, the Minicell production capacity of the two strains exhibits different evolutionary trajectories ( Figure 9 (Generations 1-85). BS168△ minCD From the first generation 3.93×10 8 The yield per cell / mL significantly increased to 5.89 × 10⁻⁶ cells / mL after 70 generations of evolution. 8The number of cells / mL increased by 50%. Meanwhile, the extraction rate remained stable at 5.4%. BS168△ divIVA The strain's evolutionary response was relatively slow. After 30 generations of evolution, the yield increased from 3.65 × 10⁻⁶. 8 The number of cells / mL increased only slightly to 4.22 × 10⁻⁶. 8 The extraction rate was 4.8% (cells / mL).
[0066] Ethanol stress evolutionary group: for BS168△ minCD The production rate of the first generation was 4.72 × 10⁻⁶. 8 cells / mL, after 30 generations of evolution in ethanol-containing medium (cells / mL) Figure 9 The yield of ethanol (generations 1-45) only increased to 4.93 × 10⁻⁶. 8 cells / mL (extraction rate 3.7%). For BS168△ divIVA Ethanol stress only reduced its yield from 4.22 × 10⁻⁶. 8 The number of cells / mL increased to 4.51 × 10⁻⁶. 8 cells / mL (extraction rate 3.4%). This indicates that ethanol, as a stress factor, has a slight impact on its yield increase. This example demonstrates that adaptive laboratory evolution is an effective strategy for improving the production capacity of Bacillus subtilis Minicell. Among them, BS168△ minCD The chassis exhibits optimal evolutionary response, and its production has been significantly improved through 70 generations of evolution.
[0067] Example 9: Application of protein expression (EGFP) in the recombinant strain of Bacillus subtilis Minicell-forming. (1) Construction of engineered strains: strains BS168 and BS168△ minCD After heat-shocking competent cells at 45°C for 3-5 minutes, 1 μg of the expression plasmid pHT01-EGFP carrying the EGFP gene was added. The mixture was incubated at 37°C for 90 minutes, then plated onto LB agar plates containing 5 μg / mL chloramphenicol and incubated at 37°C for 12 hours. Single colonies were picked and streaked onto LB agar plates containing the same antibiotic for purification. Finally, the verified positive transformants BS168-pHT01-EGFP and BS168△ were purified. minCD -pHT01-EGFP was prepared into glycerol bacteria and stored at -80℃. The plasmid pHT01-EGFP was constructed as follows: using the pHT01 plasmid as the vector backbone, the EGFP sequence (as shown in SEQ ID NO.10) was amplified with primers F and R, a BamHI site was introduced upstream, an XmaI site was introduced downstream, and the pHT01 plasmid digested with BamHI was cloned in one step.
[0068] The sequences of primers F and R are shown in SEQ ID NO.59 and SEQ ID NO.60, respectively.
[0069] (2) Fermentation and Induction Expression: The two glycerol bacteria were inoculated into 5 mL of LB liquid medium containing 5 μg / mL chloramphenicol and cultured at 37℃ and 200 rpm for 16 hours to prepare seed culture. The seed culture was then transferred at a 1% v / v inoculation rate to 100 mL of Erlenmeyer flasks containing the same resistant LB medium and cultured at 37℃ and 180 rpm. When the OD of the culture medium... 600 When the value reaches about 0.3, add IPTG inducer to a final concentration of 1 mM, adjust the culture temperature to 25℃, and continue to induce expression at 200 rpm for 20 hours.
[0070] (3) Sample processing and detection: After induction, collect 5 mL of bacterial culture and measure its OD. 600 The sample volume was standardized. After ultrasonic disruption (300 W, 3 s on, 7 s off, total 10 min), 15 μL of the disruption buffer was mixed with 5 μL of 4× protein loading buffer and heated in a 95°C metal bath for 5 min to denature the protein. 10 μL of the denatured sample was then analyzed by SDS-PAGE electrophoresis to observe EGFP protein expression. For accurate quantification, a microplate reader was used at 488 nm. nm The fluorescence intensity of all samples was detected under excitation light, and the readings were finally converted to units of OD. 600 Fluorescence intensity at bacterial cell density (FU / OD) 600 This eliminates the influence of differences in bacterial count on the results.
[0071] SDS-PAGE electrophoresis results showed a distinct protein band at approximately 27 kDa. Figure 10 The value of A in the figure is consistent with the theoretical molecular weight of EGFP, which preliminarily confirms the successful expression of EGFP. Quantitative fluorescence intensity detection results show that (…). Figure 10 In the study, the fluorescence intensity per cell of strain B), BS168△minCD-pHT01-EGFP was significantly higher than that of wild-type control strain BS168-pHT01-EGFP, with an increase of 39.4%.
[0072] After the induction of expression, 10 μL of bacterial suspension from each of the two strains was used to prepare bacterial sections for observation under a fluorescence microscope. The BS168△minCD-pHT01-EGFP strain sample showed a significantly stronger green fluorescence signal. Furthermore, two cell morphologies were clearly observed in its bacterial community: numerous strongly fluorescent rod-shaped mother cells and equally bright fluorescent spherical Minicell cells (see...). Figure 10 (C in the text). In contrast, the BS168-pHT01-EGFP wild-type control group only showed rod cells, and the overall fluorescence intensity was weak.
[0073] This invention provides a concept and method for improving the production of small cells by Bacillus subtilis. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment of the invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.
Claims
1. A method for constructing recombinant Bacillus subtilis for producing small cells, characterized in that, The recombinant Bacillus subtilis knocked down or eliminated the expression of the gene encoding the septum repressor protein and overexpressed the gene encoding the cell septum component and / or the lipid metabolism-related gene. The membrane inhibitory protein encoding gene includes any one or a combination of minC, minD, or minJ; the cell membrane component encoding gene includes ftsA and / or ftsZ; and the lipid metabolism-related gene includes plsX and / or plsC.
2. The construction method according to claim 1, characterized in that, The minC, minD, and minJ genes are encoded by the amino acid sequences shown in SEQ ID NO. 1-3 or their truncated forms, respectively; the ftsA, ftsZ, plsX, and plsC genes are encoded by the amino acid sequences shown in SEQ ID NO. 5-8, respectively.
3. The construction method according to claim 1, characterized in that, The recombinant Bacillus subtilis knocked out the expression of the membrane inhibitory protein encoding genes minC and minD; and overexpressed the cell membrane component encoding genes ftsA and ftsZ and the lipid metabolism-related gene plsX; the minC, minD, ftsA, ftsZ and plsX genes are encoded by the amino acid sequences shown in SEQ ID NO.1~2 and SEQ ID NO.5~7, respectively.
4. The construction method according to claim 1, characterized in that, The recombinant Bacillus subtilis, whose originating strain includes Bacillus subtilis. Bacillus subtilis Any one of 168, PY79, NCIB 3610, DB104, WB600, WB800, QB928, C-3102 or 29784.
5. The recombinant Bacillus subtilis constructed by the construction method according to any one of claims 1 to 4.
6. A method for improving the production of small cells by Bacillus subtilis, characterized in that, The recombinant Bacillus subtilis according to claim 5 is subjected to adaptive evolution; the adaptive evolution involves inoculating the recombinant Bacillus subtilis into a passage medium and passaged it continuously for 10 to 80 generations. The subculture medium comprises 5-15 g / L peptone, 1-5 g / L yeast extract, and 5-10 g / L sodium chloride.
7. The method according to claim 6, characterized in that, The subculture medium contains 0.1–2% v / v stress factor; the stress factor includes any one of ethanol, antibiotics, or metal ions.
8. The application of the recombinant Bacillus subtilis according to claim 5 in the fermentation production of biomacromolecules, characterized in that, The biomolecule in question is green fluorescent protein.
9. The application according to claim 8, characterized in that, The fermentation process involves inoculating recombinant Bacillus into a fermentation medium and culturing it at 18–37 °C until the OD reaches [value missing]. 600 When the concentration is 0.6 to 0.8, add 0.01 to 2.0 mM isopropyl-β-D-thiogalactoside and continue fermentation for 8 to 72 h; wherein the fermentation medium includes any one of LB medium, TB medium or TSB medium.
10. The application of the recombinant Bacillus prepared by the method of claim 6 or 7 in the fermentation production of biomacromolecules, characterized in that, The biomolecule in question is green fluorescent protein.
Citation Information
Patent Citations
Pesticidal minicells and compositions thereof for agricultural applications
US20240196906A1