Method for regulating and controlling resistance of rice to plant diseases and insect pests by using gene OsCYTC1
By knocking out or downregulating the expression of the rice OsCYTC1 gene using the CRISPR/Cas9 system, the problems of rice resistance to pests and diseases and high yield were solved, resulting in enhanced resistance to pests and diseases and reduced production costs.
Patent Information
- Application Number
- CN202511165742.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-11-14
AI Technical Summary
Existing technologies are insufficient to effectively regulate rice's resistance to pests and diseases, and traditional pesticide spraying methods pollute the environment and increase production costs.
By using gene editing technology, especially the CRISPR/Cas9 system, the expression of the rice OsCYTC1 gene can be knocked out or downregulated to regulate the resistance of rice to pests and diseases, and to cultivate pest-resistant and high-yielding rice varieties.
It enhances rice's resistance to brown planthopper, rice blast, and bacterial blight, increases thousand-grain weight, reduces pesticide use, and lowers environmental pollution and production costs.
Smart Images

Figure SMS_2 
Figure HDA0005556517170000011 
Figure HDA0005556517170000012
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural biotechnology and relates to a method for regulating the resistance of rice to pests and diseases using the gene OsCYTC1. Specifically, it relates to a method for improving the resistance of rice to pests and diseases by knocking out or downregulating the expression of the gene OsCYTC1. Background Technology
[0002] The dynamic balance of ROS (reactive oxygen species) in plant cells depends on the synergistic effects of their production, scavenging, and transport (Mittler et al., 2022). ROS are a class of highly reactive molecules produced from O2 via electron reduction or excited-state reactions, with typical members including superoxide anion (O2-), hydrogen peroxide (H2O2), and hydroxyl radicals (-OH) (Waszczak et al., 2018). These molecules act as second messengers in plant processes, transmitting pathogen or stress signals downstream in a cascade (Ahammed et al., 2024; Mittler, 2017; Qi et al., 2017). ROS bursts are mostly catalyzed by the NADPH oxidase family (NOXs, also known as respiratory burst oxidase homologues RBOHs), and the immune response generated by this mechanism is relatively conserved. In plants, RBOH-mediated ROS surges can be triggered at both the PTI and ETI stages. Taking the early stage of PTI as an example, flg22 induces the assembly of the PRR-BAK1 receptor complex and its binding to the ligand. RLCK member BIK1 or PBL1 is induced to phosphorylate RBOHD, thereby rapidly increasing intracellular ROS levels and activating the defense cascade (Couto and Zipfel, 2016; Loo et al., 2022). Furthermore, in wheat infected with WYMV, decreased TaVTC2 enzyme activity also induces a ROS burst, thereby inhibiting viral proliferation (Zhang et al., 2023b); while the MAPK-AL7 module, by inhibiting the expression of ROS scavenging genes, synergizes with NLR-mediated immune responses (Zhang et al., 2023a). Although low doses of ROS can act as signaling molecules, excessive ROS oxidizes lipids and proteins, causing cytotoxicity. Therefore, plants must finely regulate the generation, scavenging, and translocation of ROS to maintain redox homeostasis (Jaspers and...). (2010).
[0003] As a byproduct of aerobic metabolism, reactive oxygen species (ROS) can form in chloroplasts, mitochondria, peroxisomes, and any cellular compartment (Mittler, 2017). Under light conditions, chloroplasts and peroxisomes are the main sources of ROS; while in non-photosynthetic tissues or in dark environments, mitochondria become the core site of ROS generation (Navrot et al., 2007). Mitochondrial ROS is mainly produced in the electron transport chain (ETC), where electrons leak out and combine with O2 to form O2-. Cytochrome c (CYTc), as an electron carrier between ETC complexes III and IV, participates in both electron transport and ROS scavenging. In Arabidopsis thaliana CYTC-1 deletion mutants, reduced CYTc content leads to upregulation of antioxidant enzyme gene expression, resulting in a decrease in overall ROS levels (Welchen et al., 2012), and the plants exhibit stunted vegetative growth (Racca et al., 2018; Welchen et al., 2012). Conversely, plants overexpressing CYTC-1 showed more vigorous growth, indicating that CYTc is a positive factor in the plant growth regulatory network (Racca et al., 2018). Further research revealed that the growth defects in CYTC-1 mutants were closely related to defects in gibberellin signaling and TOR activation (Canalet et al., 2024; Racca et al., 2018). Furthermore, abscisic acid negatively regulates the expression of another CYTc gene, CYTC-2, leading to delayed seed germination in a low CYTc background (Racca et al., 2022).
[0004] Given that ROS plays a crucial role in plant immunity, research on ROS-related genes is of great significance for studying the resistance mechanism of rice and developing resistant varieties. Summary of the Invention
[0005] In our research on the mechanism of ROS-related genes in rice resistance and the development of resistant varieties, our research group constructed overexpression and knockout materials of the rice cytochrome c gene OsCYTC1 and conducted basic research. We found that OsCYTC1 can inhibit rice seed germination and seedling growth, but the thousand-grain weight of the OsCYTC1 knockout material increased. This is because it affects the broad-spectrum resistance of rice to various diseases by inhibiting the production and accumulation of reactive oxygen species. Experiments have confirmed that, compared with the wild type, CRISPR / Cas9 knockout of the rice OsCYTC1 gene enhances the resistance of mutant rice to diseases and pests such as brown planthopper, rice blast, and / or bacterial blight. This result indicates that the OsCYTC1 gene and its encoded protein can be used to regulate rice resistance to diseases and pests, and the rice OsCYTC1 gene can be applied to rice insect resistance breeding. Based on this, the present invention provides the following technical solution.
[0006] The first aspect of the present invention provides a method for regulating rice resistance to pests and diseases using the cytochrome c (CYTc) gene OsCYTC1.
[0007] Specifically, the above method involves downregulating, inactivating, weakening or knocking out the OsCYTC1 gene in rice, thereby improving resistance to pests and diseases.
[0008] On the other hand, this method is also a way to increase the thousand-grain weight of rice. That is, the above method can be used to breed disease- and pest-resistant and / or high-yielding rice varieties.
[0009] The aforementioned pests and diseases especially refer to the infestation by brown planthoppers, rice blast pathogens, and / or bacterial blight pathogens.
[0010] The above-mentioned rice varieties are japonica or indica rice, selected from varieties such as Nanjing 46 (NJ46), Koshihikari, Longjing 31 (LG31), Kongyu 131, HP486, HP274, HP119, HP341, HP362, HP327, HP492, HP577, HP396, GP72, HP407, GP134, GP3, GP51, HP263, GP669, GP567, GP677, HP91, and UR28. HP48, HP103, HP314, GP551, HP11, HP390, GP688, GP104, GP124, GP536, XA384, XA85, XF1822, Wuyunjing 7, Guanglu Ai 4, Nipponbare (NPB), Kasa, Huahui 8612, ZH11, Hejiang 19, Kendao 8, Nanjing 38, Longhua 96-1513, Huanghuazhan, Zhongjiazao 17, Wuyoudao 4.
[0011] For example, the gene OsCYTC1 mentioned above could be gene number LOC_Os01g66180 (http: / / rice.plantbiology.msu.edu), with the full gene sequence being SEQ ID NO:3 and the coding region CDS sequence being SEQ ID NO:4.
[0012] In one specific implementation, the expression, inactivation, functional attenuation, or knockout of the OsCYTC1 gene is achieved through the following methods:
[0013] (1) Knock out the OsCYTC1 gene in the chromosome of wild-type rice;
[0014] (2) Down-regulate the expression level of the gene OsCYTC1 in the chromosomes of wild-type rice;
[0015] (3) Replace the OsCYTC1 gene in the chromosome of wild-type rice with a mutant of the OsCYTC1 gene that has lost or downregulated coding function; and / or
[0016] (4) Block, inhibit or interfere with the expression of the gene OsCYTC1 in the chromosome of wild-type rice.
[0017] Furthermore, the above method (2) is selected from the following group:
[0018] (2-1) Mutations in the promoter region and / or coding region of the OsCYTC1 gene lead to downregulation of the expression level of the OsCYTC1 gene;
[0019] (2-2) Mutations in the upstream regulators of the OsCYTC1 gene lead to downregulation of OsCYTC1 expression; or
[0020] (2-3) Introduce cytochrome c (CYTc) interacting proteins into wild-type rice to alter the function of the OsCYTC1 gene.
[0021] Furthermore, the mutation in the coding region described in the above method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of OsCYTC1.
[0022] In one implementation, the mutation in the coding region described in method (2-1) is a frameshift mutation, selected from the following group of forms:
[0023] (a) An A base was inserted after position 154 in the coding region of the OsCYTC1 gene, which caused premature termination of translation of cytochrome c protein.
[0024] (b) Deleting four bases CAGC at positions 152-155 in the coding region of the OsCYTC1 gene caused premature termination of translation of cytochrome c protein.
[0025] Optionally, the above methods (1), (2), (3) or (4) are implemented through gene editing technology, antisense nucleic acid or transcriptional regulation.
[0026] Although it is theoretically possible to improve the resistance of rice to diseases and pests by overexpressing the exogenous gene OsCYTC1 inactivating mutant, considering that overexpression of exogenous genes often leads to abnormal physiological homeostasis in plants, the above-mentioned steps of downregulating, inactivating, weakening or knocking out the expression of OsCYTC1 in the chromosomes of wild-type rice are preferably implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.
[0027] The gene editing technology described above can be selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT. Preferably, the gene editing technology uses the CRISPR / Cas9 system.
[0028] In one specific embodiment, the CRISPR / Cas9 system is used to knock out the OsCYTC1 gene in rice. The CRISPR / Cas9 system contains a specific sgRNA designed for OsCYTC1. The forward and reverse primers for synthesizing and cloning vectors for the sgRNA gene include the following:
[0029] Forward primer OsCYTC1-F; 5'-AGGCCGCCGGCCACAAGCAT gttttagagctagaaat -3'(SEQ IDNO:1);
[0030] Reverse primer OsCYTC1-R: 5'-ATGCTTGTGGCCGGCGGCCTC ggcagccaagccagca -3'(SEQ IDNO:2).
[0031] The underlined segment in the above nucleotide sequence is the linker.
[0032] Furthermore, the OsCYTC1 gene knockout in rice implemented using the above-mentioned CRISPR / Cas9 system includes the following steps: synthesizing forward primer SEQ ID NO:1 and reverse primer SEQ ID NO:2, annealing in vitro to form complementary oligonucleotide double-stranded sgRNA gene fragments, cloning the sgRNA gene fragments into pU6-sgRNA vectors carrying Ubi-driven Cas9; after Agrobacterium-mediated transformation of rice plants, homozygous knockout mutants are obtained by PCR sequencing screening.
[0033] This invention has discovered that the OsCYTC1 gene can be used to regulate rice resistance to pests and diseases and even thousand-grain weight, providing a very valuable gene resource for developing new rice varieties that are resistant to pests and diseases and have high yields. Therefore, the OsCYTC1 gene is of great significance for solving the damage caused by pests and diseases, which are one of the most important pests in rice production, reducing the use of pesticides, protecting rice yields, and ensuring food security. Attached Figure Description
[0034] Figure 1 The results show the detection and analysis of OsCYTC1 gene knockout and overexpression materials in rice. A: Schematic diagram of the oscytc1 knockout site; B: Detection of OsCYTC1 gene expression in OsCYTC1 overexpression materials.
[0035] Figure 2 The expression of the gene OsCYTC1 in different tissues of rice was shown.
[0036] Figure 3 The effects of the OsCYTC1 gene on agronomic traits of growth and development are shown. A: Statistical results of thousand-grain weight in OsCYTC1 gene-edited materials; B: Seedling phenotype; C: Statistical results of germination rate; D: Statistical results of seedling root length; E: Statistical results of seedling shoot length.
[0037] Figure 4 The responses of the OsCYTC1 gene to pests and diseases are shown. A: OsCYTC1 response to brown planthopper feeding; B: OsCYTC1 response to rice blast; C: OsCYTC1 response to bacterial blight.
[0038] Figure 5 The results show the identification of BPH resistance in brown planthoppers from OsCYTC1 gene-edited materials. A: Phenotypic photographs of individual plants exhibiting BPH resistance in the OsCYTC1 gene-edited material; B: Phenotypic photographs of small populations exhibiting BPH resistance in the OsCYTC1 gene-edited material; C: Mortality statistics for small populations exhibiting BPH resistance.
[0039] Figure 6 The results show the identification of rice blast resistance in OsCYTC1 gene-edited materials. A: Photographs of blast lesions on detached leaves 14 days after inoculation (scale bar: 1 cm); B: Statistics on blast lesion size.
[0040] Figure 7 The image shows the identification of bacterial blight resistance in OsCYTC1 gene-edited materials. A: Photographs of lesions 14 days after inoculation with bacterial blight using the leaf-cutting method (scale bar: 1 cm); B: Statistical analysis of lesion length. Detailed Implementation
[0041] Brown planthoppers, rice blast, and bacterial blight are all pests and diseases that seriously affect rice yield. Traditionally, the method to mitigate these pests and diseases is to spray pesticides, which not only pollutes the environment but also greatly increases the cost of rice production.
[0042] Improving rice's resistance to diseases and pests through genetic engineering and cultivating disease- and pest-resistant rice varieties is a research and development trend with broad application prospects. In our research on rice disease and pest resistance, through screening and analysis of ROS-related genes, we found that the OsCYTC1 gene is negatively correlated with rice's resistance to diseases and pests. Compared with wild-type rice, after knocking out the OsCYTC1 gene using CRISPR / Cas9, the mutant oscytc1-1 and oscytc1-2 plants showed enhanced resistance to diseases and pests, and even the thousand-grain weight of rice was increased to some extent. The overexpression lines OsCYTC1-OE11 and OsCYTC1-OE15, obtained by constructing an OsCYTC1 overexpression vector and using Agrobacterium-mediated transformation, exhibited lower thousand-grain weight, faster germination rates, and significantly increased root and shoot lengths in the young shoots. Conversely, oscytc1-1 and oscytc1-2 showed the opposite. This indicates that OsCYTC1 regulates rice grain weight, germination, and shoot growth, demonstrating the crucial role of cytochrome c in rice growth and development. The overexpression lines OsCYTC1-OE11 and OsCYTC1-OE15 were highly susceptible to brown planthopper and bacterial blight pathogens, with significant differences in BPH mortality rates. These experimental results suggest that the OsCYTC1 gene can serve as a target for enhancing rice resistance to pests and diseases, and for breeding disease-resistant and / or high-yielding transgenic varieties.
[0043] As used in this article, the term "wild-type (WT)" refers to an original rice variety, such as ZH11, that has a normal phenotype and expresses the normal cytochrome c (CYTc) gene OsCYTC1.
[0044] Correspondingly, the terms "transgenic rice" and "genetically engineered rice" in this article have the same meaning, referring to rice that has been genetically modified from wild-type rice or rice with the original normal biological phenotype to have resistance to diseases and pests.
[0045] In some implementations, the terms “(resistance to pests and diseases and / or thousand-grain weight) improvement” or “enhancement” can mean an improvement of at least 10% compared to a reference level (such as normal rice), for example, an improvement of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any improvement between 10% and 100%, or an improvement of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.
[0046] In this document, for the sake of simplicity, the name of a protein, such as CYTC1, and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, OsCYTC1, when used to describe the function or class of cytochrome c, refers to a protein; when used as a gene description, it refers to the gene encoding the enzyme.
[0047] There are various techniques for inactivating, attenuating, knocking out, and / or preventing the expression of the OsCYTC1 gene in plants. These techniques can be used individually or in combination. For example, one inactivation method is to mutate the OsCYTC1 gene, causing an alteration in the amino acid sequence of the polypeptide CYTc and / or termination of translation.
[0048] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).
[0049] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention.
[0050] Example
[0051] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.
[0052] In the embodiments, if the operating temperature is not specifically specified, it generally refers to room temperature (15-35°C).
[0053] Materials and general methods
[0054] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.
[0055] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).
[0056] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (4th Edition), edited by M.R. Green and J. Sambrook (USA), translated by He Fuchu, Science Press, Beijing, 2017. Specific experimental conditions can be determined through simple experiments if necessary.
[0057] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.
[0058] The primer synthesis and gene sequencing in this embodiment were outsourced to Sangon Biotech (Shanghai) Co., Ltd.
[0059] Molecular biology methods, including the construction of OsCYTC1 overexpression plasmids, CRISPR / Cas9 plasmid construction, Agrobacterium-mediated transformation, and gene editing technology, as well as transgenic plant construction methods, are carried out using techniques commonly used in this field.
[0060] Main experimental contents and rice materials
[0061] 1. Test materials: The representative variety of japonica rice (Oryza sativa L. subsp. japonica) Zhonghua 11 (ZH11) was selected for the experiment. In summer, the materials were planted at the Shanghai Songjiang Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, under conventional field management. In winter, they were planted in the artificial climate chamber of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, with the environment set at 29℃±1℃, relative humidity of 50-70%±5%, and a photoperiod of 07:00-19:00.
[0062] 2. CRISPR / Cas9 vector construction: Specific sgRNAs targeting OsCYTC1 were designed. Complementary oligonucleotides (forward primer SEQ ID NO:1 and reverse primer SEQ ID NO:2) were synthesized and annealed in vitro to form a double-stranded sgRNA fragment. This fragment was then cloned into the pOs-sgRNA intermediate vector and subsequently cloned and integrated into the pH-Ubi-cas9 vector. Detailed vector information can be found in the reference (Miao et al., 2013).
[0063] 3. Genetic transformation: Rice transformation was carried out based on the Agrobacterium-mediated transformation method reported by Hiei et al. (1994), combined with the optimized process of our laboratory.
[0064] 4. Germination test: 100 mature, dried seeds of each rice variety were selected and soaked in ddH2O; the number of germinated seeds was recorded every 12 hours, and the experiment was repeated 3 times.
[0065] 5. Seedling Culture and Growth Measurement: Take 25 dried seeds from each rice variety and sow them in a 96-well plate. Culture conditions: 25℃, 1.5L water, 12 hours light / 12 hours dark. After 10 days of culture, measure root length and shoot length.
[0066] 4. Single-plant brown planthopper resistance test: After soaking and germinating the seeds, individual seedlings were sown in small plastic pots and managed with standard water and fertilizer for 4 weeks until the early tillering stage. A transparent plastic cylinder, 40cm high and 8cm in diameter, was used as an escape-proof cover, with a 6cm×10cm mesh ventilation window on the side wall. The cylinder was covered with the seedlings, and the top was sealed with mesh. Approximately 15 third-instar brown planthopper nymphs were then introduced into each rice plant. The number of live planthoppers was counted for the first time the following day. Observation continued for 5-8 days under standard growing conditions, and the damage to the plants was observed and recorded.
[0067] 5. Small-group brown planthopper resistance test: Germinated seeds were planted in blue plastic boxes at a density of 5 rows × 10 plants / row, with the treatment and control arranged symmetrically. When the seedlings grew to two leaves and one bud, brown planthoppers were evenly inoculated at a density of 10 nymphs per plant. Subsequently, the plant phenotype was recorded and photographed daily, and the plant mortality rate was counted. Three biological replicates were set.
[0068] 6. Rice blast resistance test
[0069] Rice blast fungus TH12 was cultured on MS medium at 28°C under 12h light / 12h dark conditions for 10 days. The spores were then washed with sterile water and filtered to adjust the spore concentration to 1×10⁻⁶. 5 spores mL -1 Take healthy rice plants at the four-leaf stage, cut 6cm sections of leaves from the middle section, and place them in a petri dish lined with moist cotton to maintain a humid environment. Using a sterile pipette tip, lightly prick three wounds on the leaf surface, spaced 1.5cm apart, and drip 5μL of spore suspension into each wound. First, incubate at 25℃ in the dark for 24 hours, then transfer to a 14h light / 10h dark cycle for 14 days. Observe the expansion of lesions, photograph them, and measure the length of the lesions.
[0070] 7. Test for resistance to bacterial blight
[0071] Xoo strain PXO99A was cultured on PSA medium at 28°C for 2-3 days, then resuspended in sterile water and adjusted to OD600 = 0.5. Inoculation was performed using the leaf-cutting method, 1-2 cm from the tip of the rice flag leaf. A maximum of 3 leaves were cut at a time, with scissors soaked in the bacterial solution, and 20 leaves were treated per sample. Photos were taken after 14 days, and the length of lesions was measured for statistical analysis.
[0072] Some of the PCR primers used in the examples are listed in Table 1.
[0073] Table 1. Some PCR primers used in the examples
[0074]
[0075] In Table 1, "-F" in the name represents positive; "-R" represents negative.
[0076] Example 1: Construction of OsCYTC1 gene knockout mutant
[0077] The OsCYTC1 gene sequence number is LOC_Os01g66180 (http: / / rice.plantbiology.msu.edu / ). We used the CRISPR / Cas9 system to target and edit this gene. Specific sgRNAs for OsCYTC1 were designed (forward primer SEQ ID NO:1 and reverse primer SEQ ID NO:2 were designed based on the sgRNAs), complementary oligonucleotides were synthesized, and double-stranded fragments were formed by in vitro annealing. These fragments were then cloned into the pU6-sgRNA vector carrying Ubi-driven Cas9. After Agrobacterium-mediated transformation, multiple homozygous knockout mutants were obtained by PCR sequencing. We analyzed two homozygous lines, oscytc1-1 and oscytc1-2, and their sequence information is as follows: Figure 1 As shown in Figure A. Compared to the wild type, oscytc1-1 has an insertion of "A" at one site in the genome, while oscytc1-2 has a deletion of 4 bases "CAGC", both resulting in frameshift mutations.
[0078] The primers designed based on the OsCYTC1 gene-specific sgRNA gene are as follows:
[0079] Forward primer OsCYTC1-F; 5'-AGGCCGCCGGCCACAAGCAT gttttagagctagaaat -3'(SEQ IDNO:1);
[0080] Reverse primer OsCYTC1-R: 5'-ATGCTTGTGGCCGGCGGCCTC ggcagccaagccagca -3'(SEQ IDNO:2).
[0081] The underlined segment in the above nucleotide sequence is the linker.
[0082] The method for constructing gene knockout mutants includes the following steps:
[0083] 1. The knockout target sequence was designed using the online website http: / / skl.scau.edu.cn. Based on information such as the sequence, location, positive and negative strands, GC content, potential off-target sites, and estimation of candidate targets, the nucleic acid fragment “AGGCCGCCGGCCACAAGCAT” in the conserved region of the OsCYTC1 gene was selected as the target sequence.
[0084] 2. PCR was performed using primers UF and OsCYTC1-R, and OsCYTC1-F and gR-R, respectively, to introduce the target sequence downstream of the U3 / U6 promoter and upstream of the sgRNA sequence;
[0085] UF: CTCCGTTTTACCTGTGGAATCG,
[0086] OsCYTC1-R:ATGCTTGTGGCCGGCGGCCTCggcagccaagccagca,
[0087] OsCYTC1-F: AGGCCGCCGGCCACAAGCATgttttagagctagaaat,
[0088] gR-R: CGGAGGAAAATTCCATCCAC.
[0089] 3. After recovering the two fragments separately, the mixture of the above products was subjected to PCR using primers Pps-R and Pgs-2 and the products were purified. The promoter, target site and sgRNA were then constructed into a complete expression cassette.
[0090] Pps-R:TTCAGAggtctcTaccgACTAGTCACGCGTATGGAATCGGCAGCAAA,
[0091] Pgs-2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC.
[0092] 4. Using Bsa I enzyme and T4 DNA ligase, the sgRNA expression cassette was assembled into the pYLCRISPR / Cas9 vector using a cut-and-ligate method;
[0093] 5. After the vector was verified by sequencing, it was transformed into Agrobacterium EHA105 strain;
[0094] 6. The vector was transformed into the immature embryos of rice ZH11 using Agrobacterium-mediated transformation to obtain CRISPR transgenic rice.
[0095] The transgenic rice obtained through the above methods was identified at the genome level, and OsCYTC1 gene knockout mutants oscytc1-1 and oscytc1-2 were obtained, respectively.
[0096] Example 2: Construction of OsCYTC1 overexpression mutant
[0097] The full-length CDS sequence of OsCYTC1 was inserted into the p1301-35S-Nos vector via homologous recombination, and then introduced into the wild japonica rice variety Zhonghua 11 using Agrobacterium-mediated genetic transformation. After hygromycin resistance screening and qRT-PCR verification, two independent overexpression lines, OsCYTC1-OE11 and OsCYTC1-OE15, were obtained, with transcriptional levels several hundred times higher than the wild type. Figure 1 (B)
[0098] The method for constructing gene overexpression mutants includes the following steps:
[0099] 1. The CDS fragment of OsCYTC1 was amplified from the cDNA of ZH11 using primers OsCYTC1-FL-F and OsCYTC1-FL- and then purified.
[0100] OsCYTC1-FL-F:ATGGCGACATTCTCCGATGC,
[0101] OsCYTC1-FL-R: (TGCTGTGGCGTTCTTCAGGT;
[0102] 2. Homologous recombination of the CDS fragment of OsCYTC1 into the p1301-35sNos vector was performed using the XbalI and Kpn-I sites;
[0103] 3. After the vector was verified by sequencing, it was transformed into Agrobacterium EHA105 strain;
[0104] 4. The vector was transformed into the immature embryos of rice ZH11 using Agrobacterium-mediated transformation to obtain transgenic rice overexpressing OsCYTC1.
[0105] The transgenic rice obtained through the above methods was identified at the genome level, and OsCYTC1 overexpression lines OsCYTC1-OE11 and OsCYTC1-OE15 were obtained, respectively.
[0106] Implementation Results
[0107] 1. Expression of gene OsCYTC1 in different tissues of rice
[0108] To investigate the function of OsCYTC1, we examined its expression in different tissues of rice, including root, stem, young leaf, mature leaf, leaf sheath, and spikelet. The results showed that OsCYTC1 was expressed in all these tissues, with higher expression levels in root and young leaf. Figure 2 This suggests that it may regulate early growth or immunity in rice.
[0109] 2. Effects of OsCYTC1 on rice growth and development
[0110] To investigate whether the OsCYTC1 gene affects rice growth and development, we conducted phenotypic observations and statistical analyses of growth and developmental traits in OsCYTC1 gene-edited materials. The results showed that, compared to the wild type, the thousand-grain weight of rice materials overexpressing OsCYTC1-OE was lower. Figure 3 (A) germinates faster. Figure 3 (C), and the root length and shoot length of the young shoots both increased significantly (C). Figure 3 The results showed that OsCYTC1 regulates rice grain weight, germination, and shoot growth, indicating that cytochrome c plays a crucial role in rice growth and development. (B, D, and E)
[0111] 3. Expression response of OsCYTC1 to brown planthopper feeding and rice blast damage
[0112] To preliminarily verify whether the OsCYTC1 gene plays a role in rice immunity, we examined the expression levels of OsCYTC1 in wild-type rice ZH11 after infection by brown planthoppers, rice blast fungus, and bacterial blight fungus. The results showed that OsCYTC1 expression was upregulated after feeding by brown planthoppers or infection by bacterial blight fungus, while its expression was initially downregulated and then upregulated after rice blast infection, indicating that OsCYTC1 responds to brown planthopper feeding and rice blast damage. Figure 4 ).
[0113] 4. The OsCYTC1 gene negatively regulates rice resistance to brown planthopper.
[0114] Using two brown planthopper resistance evaluation systems—single-plant and small-group tests—we systematically analyzed OsCYTC1 loss-of-function mutants (oscytc1-1, oscytc1-2) and overexpression lines (OsCYTC1-OE11, OsCYTC1-OE15) and statistically analyzed BPH mortality rates. Data showed that, regardless of whether tested as a single plant or in a small group, the knockout lines exhibited a significant brown planthopper resistance phenotype, while the overexpression lines showed high sensitivity, with a significant difference in BPH mortality rates. Figure 5 The results indicate that OsCYTC1 plays a negative regulatory role in rice resistance to brown planthopper.
[0115] 5. Knockout of OsCYTC1 rice materials showed resistance to rice blast in their leaves.
[0116] We identified the resistance of OsCYTC1 gene-edited rice plants to the rice blast strain TH12 using an in vitro leaf inoculation method. The results showed that 14 days after inoculation with rice blast, the leaf lesion size of oscytc1-1 and oscytc1-2 was significantly smaller than that of the wild type, while there was no significant difference between the leaves of rice overexpressing OsCYTC1 and the wild type. Figure 6 This indicates that the leaves of oscytc1-1 and oscytc1-2 rice plants exhibit a rice blast resistance phenotype.
[0117] 6. The OsCYTC1 gene negatively regulates rice resistance to bacterial blight.
[0118] We inoculated rice leaves with bacterial blight using the leaf-cutting method. Fourteen days later, we measured and counted the length of leaf lesions to identify the bacterial blight resistance phenotypes of OsCYTC1 overexpressing and knockout materials. The results showed that, 14 days after inoculation with bacterial blight, compared with the wild type, the leaf lesion length of OsCYTC1 knockout rice was significantly smaller, while the lesion length of overexpressing materials was significantly increased. Figure 7 In summary, OsCYTC1 negatively regulates rice resistance to bacterial blight.
[0119] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
[0120] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be construed as an admission that such documents are prior art or common general knowledge.
[0121] References
[0122] Ahammed,GJ,Li,Z.,Chen,JY,Dong,YF,Qu,KH,Guo,TM,Wang,FH,Liu,AR,Chen,SCand Li,X.(2024)Reactive oxygen species signaling inmelatonin-mediated plant stress response.Plant Physiol Bioch207.
[0123] Canal,M.V.,Mansilla,N.,Gras,D.E.,Ibarra,A.,Figueroa,C.M.,Gonzalez,D.H.and Welchen,E.(2024)Cytochrome levels affect the TOR pathway to regulategrowth and metabolism under energy-deficient conditions.New Phytol241,2039-2058.
[0124] Couto,D.and Zipfel,C.(2016)Regulation of pattern recognition receptorsignalling in plants.Nat Rev Immunol16,537-552.
[0125] Jaspers,P.and J.(2010)Reactive oxygen speciesin abioticstress signaling.Physiol Plantarum138,405-413.
[0126] Loo,E.P.I.,Tajima,Y.,Yamada,K.,Kido,S.,Hirase,T.,Ariga,H.,Fujiwara,T.,Tanaka,K.,Taji,T.,Somssich,I.E.,Parker,J.E.and Saijo,Y.(2022)Recognitionof Microbe-and Damage-Associated Molecular Patterns by Leucine-Rich RepeatPattern Recognition Receptor Kinases Confers Salt Tolerance in Plants.MolPlant Microbe In35,554-566.
[0127] Mittler,R.(2017)ROS Are Good.Trends Plant Sci22,11-19.
[0128] Mittler,R.,Zandalinas,S.I.,Fichman,Y.and Van Breusegem,F.(2022)Reactive oxygen species signalling in plant stress responses.Nat Rev Mol CellBio23,663-679.
[0129] Navrot,N.,Rouhier,N.,Gelhaye,E.and Jacquot,J.P.(2007)Reactive oxygenspecies generation and antioxidant systemsin plant mitochondria.PhysiolPlantarum129,185-195.
[0130] Qi,J.S.,Wang,J.L.,Gong,Z.Z.and Zhou,J.M.(2017)Apoplastic ROSsignaling in plant immunity.Curr Opin Plant Biol38,92-100.
[0131] Racca,S.,Gras,D.E.,Canal,M.V.,Ferrero,L.V.,Rojas,B.E.,Figueroa,C.M.,Ariel,F.D.,Welchen,E.and Gonzalez,D.H.(2022)Cytochrome and the transcriptionfactor ABI4establish a molecular link between mitochondria and ABA-dependentseed germination.New Phytol235,1780-1795.
[0132] Racca,S.,Welchen,E.,Gras,D.E.,Tarkowská,D.,Turecková,V.,Maurino,V.G.and Gonzalez,D.H.(2018)Interplay between cytochrome and gibberellinsduring Arabidopsis vegetative development.Plant Journal94,105-121.
[0133] Waszczak,C.,Carmody,M.and J.(2018)Reactive Oxygen SpeciesinPlant Signaling.Annu Rev Plant Biol69,209-236.
[0134] Welchen,E.,Hildebrandt,T.M.,Lewejohann,D.,Gonzalez,D.H.and Braun,H.P.(2012)Lack of cytochrome in decreases stability of Complex IV and modifiesredox metabolism without affecting Complexes I and III.Bba-Bioenergetics1817,990-1001.
[0135] Zhang,D.L.,Gao,Z.Y.,Zhang,H.,Yang,Y.Z.,Yang,X.X.,Zhao,X.F.,Guo,H.L.,Nagalakshmi,U.,Li,D.W.,Dinesh-Kumar,S.P.and Zhang,Y.L.(2023a)The MAPK-Alfin-like7 module negatively regulates ROS scavenging genesto promote NLR-mediatedimmunity.PNatl Acad Sci USA120.
[0136] Zhang,T.Y.,Hu,H.C.,Wang,Z.Q.,Feng,T.Y.,Yu,L.,Zhang,J.,Gao,W.Q.,Zhou,Y.L.,Sun,M.H.,Liu,P.,Zhong,K.L.,Chen,Z.H.,Chen,J.P.,Li,W.and Yang,J.(2023b)Wheatyellow mosaic virus NIb targets TaVTC2 to elicit broad-spectrum pathogenresistance in wheat.Plant Biotechnol J。
Claims
1. A method for regulating rice resistance to diseases and pests using the cytochrome c gene OsCYTC1, characterized in that, This can downregulate, inactivate, weaken, or knock out the OsCYTC1 gene in rice, thereby improving its resistance to pests and diseases.
2. The method as described in claim 1, characterized in that, The pests and diseases mentioned are brown planthoppers, rice blast pathogens, and / or bacterial blight pathogens.
3. The method as described in claim 1, characterized in that, The gene number of the OsCYTC1 gene is LOC_Os01g66180 (http: / / rice.plantbiology.msu.edu).
4. The method as described in claim 1, characterized in that, The following methods can be used to downregulate, inactivate, weaken, or knock out the expression of the OsCYTC1 gene: (1) Knock out the OsCYTC1 gene in the chromosome of wild-type rice; (2) Down-regulate the expression level of the gene OsCYTC1 in the chromosomes of wild-type rice; (3) Replace the OsCYTC1 gene in the chromosome of wild-type rice with a mutant of the OsCYTC1 gene that has lost or downregulated coding function; and / or (4) Block, inhibit or interfere with the expression of the gene OsCYTC1 in the chromosome of wild-type rice.
5. The method as described in claim 4, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the OsCYTC1 gene lead to downregulation of the expression level of the OsCYTC1 gene; (2-2) Mutations in the upstream regulators of the OsCYTC1 gene lead to downregulation of OsCYTC1 expression; or (2-3) Introduce cytochrome c interaction proteins into wild-type rice to alter the function of the OsCYTC1 gene.
6. The method as described in claim 5, characterized in that, The mutation in the coding region described in method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of OsCYTC1.
7. The method as described in claim 6, characterized in that, The mutation in the coding region described in method (2-1) is a frameshift mutation, selected from the following group of forms: (a) An A base was inserted after position 154 in the coding region of the OsCYTC1 gene, resulting in a frameshift mutation in the cytochrome c gene. (b) Deleting four bases CAGC at positions 152-155 in the coding region of the OsCYTC1 gene resulted in a frameshift mutation in the cytochrome c gene.
8. The method as described in claim 4, characterized in that, The methods (1), (2), (3) or (4) are implemented through gene editing technology, antisense nucleic acid or transcriptional regulation.
9. The method as described in claim 8, characterized in that, The gene editing technology used employs the CRISPR / Cas9 system.
10. The method as described in claim 9, characterized in that, The CRISPR / Cas9 system is used to knock out the OsCYTC1 gene in rice. The CRISPR / Cas9 system contains a specific sgRNA designed for OsCYTC1, and specific primers are designed based on the sgRNA sequence. Forward primer OsCYTC1-F; 5'-AGGCCGCCGGCCACAAGCAT gttttagagctagaaat -3'(SEQ ID NO:1); Reverse primer OsCYTC1-R: 5'-ATGCTTGTGGCCGGCGGCCTC ggcagccaagccagca -3'(SEQ ID NO:2), The underlined segment in the above nucleotide sequence is the linker. Furthermore, the OsCYTC1 gene knockout in rice implemented using the CRISPR / Cas9 system includes the following steps: synthesizing forward primer SEQ ID NO:1 and reverse primer SEQ ID NO:2, annealing in vitro to form complementary oligonucleotide double-stranded sgRNA gene fragments, cloning the sgRNA gene fragments into pU6-sgRNA vectors carrying Ubi-driven Cas9; after Agrobacterium-mediated transformation of rice plants, homozygous knockout mutants are obtained by PCR sequencing.