Application of TaTIFY11c protein and coding gene thereof in regulation and control of plant drought resistance

Abstract

The invention discloses application of a TaTIFY11c protein and a coding gene thereof in regulation and control of plant drought resistance, and belongs to the technical field of biology. The invention aims to solve the technical problem of how to regulate and control the drought resistance of plants. The protein TaTIFY11c disclosed by the invention is a protein TaTIFY11c-4A, a protein TaTIFY11c-4B and / or a protein TaTIFY11c-4D, and the sequences of the protein TaTIFY11c-4A, the sequence of the protein TaTIFY11c-4B and the sequence of the protein TaTIFY11c-4B and the sequence of the protein TaTIFY11c-4D are SEQ ID No.2, SEQ ID No.5 and SEQ ID No.8 respectively. The protein TaTIFY11c-4D disclosed by the invention is a protein TaTIFY11c-4D. Experiments prove that the drought resistance of the plant can be improved by knocking out the TaTIFY11c gene in the plant, and the TaTIFY11c protein and the encoding gene thereof can regulate and control the drought resistance of the plant and have great production and application potential.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the TaTIFY11c protein and its encoding gene in regulating plant drought resistance. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is one of China's three major grain crops, and wheat production is crucial for ensuring food security. In recent years, due to climate change and frequent extreme weather events, abiotic stresses such as drought have severely affected wheat growth and development, directly leading to reduced yields. Therefore, identifying genes related to wheat drought resistance is an important means to accurately select target traits and improve breeding efficiency, and can provide a theoretical basis for breeding drought-resistant varieties. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to regulate the drought resistance of plants.

[0004] To address the aforementioned technical problems, the present invention first provides any of the following applications of proteins or substances that regulate the content or activity of said proteins: D1) Regulating plant drought resistance; D2) Preparing products that regulate plant drought resistance; D3) Cultivating plants with altered drought resistance; D4) Preparing and cultivating products that have altered drought resistance. The protein is derived from wheat ( Triticum aestivum L.), whose name is TaTIFY11c protein, specifically TaTIFY11c-4A protein, TaTIFY11c-4B protein, and / or TaTIFY11c-4D protein: The TaTIFY11c-4A protein is as follows: (A1), (A2), or (A3) A1) A protein whose amino acid sequence is SEQ ID No. 2; A2) A protein that has more than 75% identity with A1) and has the same function, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing; A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2); The TaTIFY11c-4B protein is as follows (H1), (H2), or (H3): H1) The amino acid sequence is that of SEQ ID No. 5; H2) The amino acid sequence shown in SEQ ID No. 5 in the sequence listing is modified by substitution and / or deletion and / or addition of one or more amino acid residues, and has more than 75% identity with H1) and has the same function; H3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of H1) or H2). The TaTIFY11c-4D protein is as follows: (I1), (I2), or (I3) I1) A protein whose amino acid sequence is SEQ ID No. 8; I2) A protein that has more than 75% identity with and has the same function as I1) by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 8 in the sequence listing; I3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of I1) or I2).

[0005] In the proteins mentioned above (A2), (H2), and (I2), the "75% or more identity" refers to an identity of 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96%, 97%, 98%, or 99%. Identity refers to the identity of the amino acid sequence. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Perresidue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0006] In the above applications, the substance may be any one of B1) to B9): B1) A nucleic acid molecule encoding the TaTIFY11c protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) A transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2); B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2); B8) A nucleic acid molecule that reduces the content or activity of the TaTIFY11c protein; B9) An expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue, or transgenic plant organ containing the nucleic acid molecule described in B8).

[0007] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0008] Those skilled in the art can readily mutate the nucleotide sequence encoding the TaTIFY11c protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the TaTIFY11c protein of this invention, as long as they encode and function the TaTIFY11c protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0009] In application B1) above, the nucleic acid molecule encoding the TaTIFY11c-4A protein is a DNA molecule whose coding sequence is positions 411-1007 of SEQ ID No. 1; the nucleic acid molecule encoding the TaTIFY11c-4B protein is a DNA molecule whose coding sequence is positions 296-895 of SEQ ID No. 4; and the nucleic acid molecule encoding the TaTIFY11c-4D protein is a DNA molecule whose coding sequence is positions 448-1080 of SEQ ID No. 7.

[0010] Specifically, in B1), the nucleic acid molecule encoding the TaTIFY11c-4A protein may be the DNA molecule shown in positions 411-1007 of SEQ ID No. 1, the DNA molecule shown in SEQ ID No. 1, or the DNA molecule shown in SEQ ID No. 3; the nucleic acid molecule encoding the TaTIFY11c-4B protein may be the DNA molecule shown in positions 296-895 of SEQ ID No. 4, the DNA molecule shown in SEQ ID No. 4, or the DNA molecule shown in SEQ ID No. 6; and the nucleic acid molecule encoding the TaTIFY11c-4D protein may be the DNA molecule shown in positions 448-1080 of SEQ ID No. 7, the DNA molecule shown in SEQ ID No. 7, or the DNA molecule shown in SEQ ID No. 9.

[0011] In the above application, the expression cassette (TaTIFY11c gene expression cassette) containing a nucleic acid molecule encoding the TaTIFY11c protein described in B2) refers to DNA capable of expressing the TaTIFY11c protein in host cells. This DNA may include not only a promoter to initiate TaTIFY11c gene transcription but also a terminator to terminate TaTIFY11c gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120: 979-992); chemically induced promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by methyl jasmonic acid); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)); and promoters specific to seed storage proteins (e.g., beta-gammaglobulin, napin, ...). The promoters of oleosin and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full.Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol.Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627.

[0012] Recombinant vectors containing the TaTIFY11c gene expression cassette can be constructed using existing expression vectors.

[0013] In the above applications, the vector can be a plasmid, a granule, a bacteriophage, or a viral vector. Specifically, the plasmid can be the pBUE414 vector.

[0014] B8) The nucleic acid molecule that reduces TaTIFY11c content may be an sgRNA that targets the gene encoding TaTIFY11c.

[0015] B9) The recombinant vector may be a recombinant vector prepared using the CRISPR / Cas9 system capable of editing the TaTIFY11c gene. The recombinant vector can transcribe sgRNA targeting the nucleic acid molecule described in B1). The target sequence of the sgRNA may be positions 439-457 and / or 575-593 of SEQ ID No. 3 (i.e., positions 650-668 and / or 792-810 of SEQ ID No. 6, and positions 482-500 and / or 636-654 of SEQ ID No. 9).

[0016] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi. Among them, bacteria can be Agrobacterium, such as Agrobacterium tumefaciens EHA105.

[0017] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0018] In the above applications, the substance that regulates the content or activity of TaTIFY11c protein is a substance that reduces the content or activity of TaTIFY11c protein; the substance that regulates plant drought resistance is a substance that improves plant drought resistance; and the substance that cultivates drought-resistant plants is a substance that cultivates plants with improved drought resistance.

[0019] The present invention also provides any of the following methods: X1) Methods to improve plant drought resistance include: reducing the content or activity of TaTIFY11c protein in plants, or knocking out the gene encoding TaTIFY11c protein in plants, or reducing the expression level of the gene encoding TaTIFY11c protein in plants, thereby improving plant drought resistance. X2) Methods for cultivating plants with improved drought resistance include: reducing the content or activity of TaTIFY11c protein in plants, knocking out the gene encoding TaTIFY11c protein in plants, or reducing the expression level of the gene encoding TaTIFY11c protein in plants to obtain plants with improved drought resistance.

[0020] In the above methods, methods X1) and X2) can be achieved by editing the gene encoding the TaTIFY11c protein to alter the function of the protein encoded by that gene. The gene encoding the protein can be the nucleic acid molecule described in B1).

[0021] The editing can be achieved using the CRISPR / Cas9 method.

[0022] Gene editing of the encoded gene using the CRISPR / Cas9 method can be achieved by introducing a recombinant vector encoding Cas9 and capable of transcribing sgRNA that targets the encoded gene into plants and screening to obtain the target plant with the encoded gene edited.

[0023] In one embodiment of the present invention, the target plant, TaTIFY11c -4A genome deletion of 135 nucleotides (i.e. deletion of positions 443-577 of SEQ ID No. 3); TaTIFY11c The deletion of positions 378-682 and 795-800 of SEQ ID No. 6 in the -4B genome leads to an aberration in the translation of the start codon; TaTIFY11c - A deletion of one nucleotide in the 4D genome (i.e., deletion of position 639 of SEQ ID No. 9) results in a frameshift mutation and premature termination of translation.

[0024] In one embodiment of the present invention, the target plant, TaTIFY11cThe -4A genome has an insertion of nucleotide T between positions 441-442 of SEQ ID No. 3 and a deletion between positions 578-582 of SEQ ID No. 3, resulting in a frameshift mutation; TaTIFY11c The insertion of nucleotide T between positions 652-653 and between positions 794-795 of SEQ ID No. 6 in the -4B genome resulted in a frameshift mutation and premature termination of translation. TaTIFY11c The -4D genome replaces ggggg at positions 484-488 of SEQ ID No. 9 with gggggg and deletes 5 nucleotides (i.e., deletes positions 639-643 of SEQ ID No. 9).

[0025] The target plant is understood to include not only first-generation plants containing the TaTIFY11c protein or its encoding gene that have been altered, but also their progeny. For the target plant, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The target plant includes seeds, callus tissue, intact plants, and cells.

[0026] The TaTIFY11c protein, or the substances that regulate the content or activity of the TaTIFY11c protein, are also within the scope of protection of this invention.

[0027] In this invention, the plant is M1, M2, M3, or M4. M1) Monocotyledons; M2) Gramineae; M3) Triticum; M4) Wheat.

[0028] In one embodiment of the present invention, the drought resistance is seedling drought resistance.

[0029] Experiments have shown that knocking out [certain substances] in plants TaTIFY11c Genes can enhance the drought resistance of plants. The TaTIFY11c protein and its encoding gene of this invention can regulate the drought resistance of plants and have great potential for production application.

[0030] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0031] Figure 1 This refers to sequence changes in gene-edited strains.

[0032] Figure 2 The results are for drought resistance testing. (a) WT and [other parameters] under drought stress during the seedling stage.TaTIFY11c Phenotype of the mutant. (b) Soil moisture content during drought treatment and rewatering. (c) Survival rate. Detailed Implementation

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.

[0034] The data in the following examples were processed using SPSS 27 statistical software. The experimental results are expressed as mean ± standard deviation. An independent samples t-test was used, and P < 0.05 (*) indicates a significant difference.

[0035] Fielder wheat: A gift from Professor Xin Mingming's laboratory at China Agricultural University. Hexaploid common wheat, bred in the United States in 1974, is commonly used for Agrobacterium-mediated transformation and gene editing receptors. Reference: Sato K, Abe F, Mascher M, Haberer G, Gundlach H, Spannagl M, Shirasawa K, Isobe S. Chromosome-scale genome assembly of the transformation-amenable common wheatcultivar 'Fielder'. DNA Res. 2021 Jun 25;28(3):dsab008. doi: 10.1093 / dnares / dsab008. PMID: 34254113; PMCID: PMC8320877. It is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0036] Agrobacterium tumefaciens EHA105: Reference: Torisky RS, Kovacs L, Avdiushko S, Newman JD, Hunt AG, Collins GB. Development of a binary vector system for plant transformation based on the supervirulent Agrobacterium tumefaciens strain Chry5. Plant Cell Reports , (1997)17:102-108.; The public can obtain it from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0037] Example 1TaTIFY11c Genes can regulate the drought resistance of wheat. This embodiment discovered a gene in wheat (Chinese spring variety) that can regulate drought resistance; its name is... TaTIFY11c The three TaTIFY11c homologous genes are respectively TaTIFY11c-4A , TaTIFY11c-4B , TaTIFY11c- 4D .

[0038] In the Chinese New Year, TaTIFY11c-4A The full-length cDNA of the gene is shown in SEQ ID No. 1 in the sequence listing. Nucleotides 411-1007 are open reading frames that encode the TaTIFY11c-4A protein shown in SEQ ID No. 2. Its genomic sequence is shown in SEQ ID No. 3. TaTIFY11c The full-length cDNA of the -4B gene is shown in SEQ ID No. 4 in the sequence listing. Nucleotides 296-895 are open reading frames that encode the TaTIFY11c-4B protein shown in SEQ ID No. 5. Its genomic sequence is shown in SEQ ID No. 6. TaTIFY11c The full-length cDNA of the -4D gene is shown in SEQ ID No. 7 in the sequence listing. Nucleotides 448-1080 are open reading frames that encode the TaTIFY11c-4D protein shown in SEQ ID No. 8, whose genomic sequence is shown in SEQ ID No. 9.

[0039] I. Preparation of Genetically Modified Wheat Using wheat Fielder as the receptor, knockout TaTIFY11c Genes, Fielder TaTIFY11c -4A、 TaTIFY11c -4B、 TaTIFY11c The cDNA, genome sequence, and encoded protein of the -4D are all identical to those of the Chinese Spring.

[0040] 1) Construction of recombinant gene editing vectors 1. Utilize online websites ( http: / / www.e-crisp.org / E-CRISP / ) predict TaTIFY11c Gene editing sites 。

[0041] 2. According to TaTIFY11c Genome Search TaTIFY11c -4A、 TaTIFY11c -4B TaTIFY11c -4D conservative area design TaTIFY11cThe gene target sites are identified as positions 439-457 and 575-593 in SEQ ID No. 3, positions 650-668 and 792-810 in SEQ ID No. 6, and positions 482-500 and 636-654 in SEQ ID No. 9. Four primers were then designed according to the vector instructions: upstream primer F (5′-aataatggtctcAGGCgGCGAACCTGCTGCCCCCGG-3′), F0 (5′-gGCGAACCTGCTGCCCCCGG-3′), and F0 (5′-gGCGAACCTGCTGCCCCCGG-3′). gttttagagctagaaatagc -3′) and downstream primer R(5′-ATTATT) GGTCTCTAAAC GACCATGGAGCTCTTCCCC-3′), R0 (5′-GACCATGGAGCTCTTCCCCCGCTTCTTGGTGCC-3′). 3. Dissolve and mix the four primers ( TaTIFY11c- The target sequence (MT1T2 F / F0 / R0 / R) was ligated using T4 DNALigase and the restriction enzyme BasI (both products of NEB) in a digestion-ligation-as-a-time manner. The Golden Gate vector construction method was employed, using pCBC-MT1T2 as the intermediate vector and pBUE414 as the final vector to construct a vector for editing. TaTIFY11c Gene recombination vectors, i.e. TaTIFY11c The gene-edited wheat vector was able to simultaneously transcribe two sgRNAs targeting SEQ ID No. 3, 6, and 9.

[0042] 4. TaTIFY11c After the gene-editing wheat vector was introduced into Agrobacterium tumefaciens EHA105, wheat Fielder was transformed using Agrobacterium-mediated genetic transformation to obtain gene-edited plants. Specific primers were then synthesized targeting the editing site to amplify the target gene, followed by sequencing to identify the editing status. TaTIFY11c Gene-edited strain CR-3 、 CR-4.

[0043] Use a pair TaTIFY11c -4A genome-specific primers F (5′-CTTCCGCTCCCATCCATC-3′) and R (5′-CAAGAACTCCATGGGAAGACG-3′), a pair TaTIFY11c -4B genome-specific primers F (5′-CACATGCAACAAATACAC-3′) and R (5′-CCGATTCCACGGACAGTATG-3′), a pair TaTIFY11cAmplification was performed using genome-specific primers F (5′-GAAACCGATCAGAGCCCAG-3′) and R (5′-CCAACGGTCCAACAAGCAA-3′) for the -4D genome. Sequencing revealed sequence changes in the two gene-edited lines (CR-3 and CR-4) as follows: Figure 1 As shown, the details are as follows: CR-3: TaTIFY11c -4A genome deletion of 135 nucleotides (i.e. deletion of positions 443-577 of SEQ ID No. 3); TaTIFY11c The deletion of positions 378-682 and 795-800 of SEQ ID No. 6 in the -4B genome leads to an aberration in the translation of the start codon; TaTIFY11c - A deletion of one nucleotide in the 4D genome (i.e., deletion of position 639 of SEQ ID No. 9) results in a frameshift mutation and premature termination of translation.

[0044] CR-4: TaTIFY11c The -4A genome has an insertion of nucleotide T between positions 441-442 of SEQ ID No. 3 and a deletion between positions 578-582 of SEQ ID No. 3, resulting in a frameshift mutation; TaTIFY11c The insertion of nucleotide T between positions 652-653 and between positions 794-795 of SEQ ID No. 6 in the -4B genome resulted in a frameshift mutation and premature termination of translation. TaTIFY11c The -4D genome replaces ggggg at positions 484-488 of SEQ ID No. 9 with gggggg and deletes 5 nucleotides (i.e., deletes positions 639-643 of SEQ ID No. 9).

[0045] III. Drought Resistance Assessment The wheat samples tested were the transgenic recipient wheat variety Fielder (wild-type control, WT) and the gene-edited lines CR-3 and CR-4. The experiment was divided into two groups: a drought treatment group and a control group.

[0046] 1. Treat the wheat seeds to be tested with 1% hydrogen peroxide for 1 day to break dormancy.

[0047] 2. Select seedlings with consistent germination and growth and plant them in the same plastic box (56 cm × 38 cm × 11 cm). Sow 30 seeds for each line. Bury the plastic box in the outdoor soil environment and keep the height of the plastic box at the same level as the ground.

[0048] 3. Seedlings that have grown to the three-leaf stage were subjected to drought treatment (i.e., watering was stopped). After 12 days of drought treatment (i.e., when there was a significant difference in phenotype between the wild type and the gene-edited line), they were rehydrated. The survival rate was counted 3 days after rehydration, and the soil moisture content was measured at each stage. Three independent biological replicates were set up. The seedlings that had not undergone drought treatment (normal watering) were used as a control.

[0049] The seedling survival rate is calculated using the following formula: Survival rate (%) = Number of surviving plants / Number of planted plants (30) × 100%.

[0050] The results are as follows Figure 2 As shown, compared with the wild type, the leaves of the gene-edited lines exhibited significant wilting under drought stress. Figure 2 (a) During drought treatment, soil moisture content gradually decreased and significantly increased after rehydration. The survival rate of wild-type strains after rehydration was significantly lower than that of gene-edited lines. Figure 2 (b) and (c) indicate that TaTIFY11c It can regulate the drought resistance of wheat seedlings.

[0051] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Any of the following applications of proteins or substances that regulate the content or activity of said proteins: D1) Regulates plant drought resistance; D2) Preparation of products that regulate plant drought resistance; D3) Cultivating drought-resistant modified plants; D4) Preparation and cultivation of drought-resistant modified plant products; The protein is TaTIFY11c-4A protein, TaTIFY11c-4B protein, and / or TaTIFY11c-4D protein: The TaTIFY11c-4A protein is as follows: (A1), (A2), or (A3) A1) The amino acid sequence of this protein is SEQ ID No. 2; A2) A protein having more than 75% identity with and the same function as A1) by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing; A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2); The TaTIFY11c-4B protein is as follows: (H1), (H2), or (H3) H1) The amino acid sequence is that of the protein in SEQ ID No. 5; H2) A protein that has more than 75% identity with H1) and has the same function as the amino acid sequence shown in SEQ ID No. 5 in the sequence listing, by substitution and / or deletion and / or addition of one or more amino acid residues; The fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of H1) or H2) (H3); The TaTIFY11c-4D protein is as follows: (I1), (I2), or (I3) I1) The amino acid sequence of this protein is that of SEQ ID No. 8; I2) A protein that has more than 75% identity with I1) and has the same function as the amino acid sequence shown in SEQ ID No. 8 in the sequence listing, by substitution and / or deletion and / or addition of one or more amino acid residues; I3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of I1) or I2).

2. The application according to claim 1, characterized in that: The substance is any one of B1) to B9) below: B1) The nucleic acid molecule that encodes the protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); B8) Nucleic acid molecules that reduce the content or activity of the protein; B9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues or transgenic plant organs containing the nucleic acid molecules described in B8).

3. The application according to claim 2, characterized in that: The nucleic acid molecule encoding the TaTIFY11c-4A protein is a DNA molecule whose coding sequence is from positions 411 to 1007 of SEQ ID No. 1; The nucleic acid molecule encoding the TaTIFY11c-4B protein is a DNA molecule whose coding sequence is from position 296 to 895 of SEQ ID No. 4; The nucleic acid molecule encoding the TaTIFY11c-4D protein is a DNA molecule whose coding sequence is from position 448 to 1080 of SEQ ID No.

7.

4. The application according to any one of claims 1-3, characterized in that: The substance that regulates the content or activity of the protein is a substance that reduces the content or activity of the protein; the substance that regulates plant drought resistance is a substance that improves plant drought resistance; and the substance that cultivates drought-resistant plants is a substance that cultivates plants that improve drought resistance.

5. The application according to any one of claims 1-4, characterized in that: The plant is M1, M2, M3, or M4. M1) Monocotyledons; M2) Gramineae plants; M3) Triticum species; M4 wheat.

6. Any of the following methods: X1) Methods to improve plant drought resistance include: The drought resistance of plants can be improved by reducing the content or activity of the protein described in claim 1 in plants, knocking out the gene encoding the protein described in claim 1 in plants, or reducing the expression level of the gene encoding the protein described in claim 1 in plants. X2) A method for cultivating plants with improved drought resistance, comprising: reducing the content or activity of the protein described in claim 1 in the plant, or knocking out the coding gene of the protein described in claim 1 in the plant, or reducing the expression level of the coding gene of the protein described in claim 1 in the plant, to obtain a target plant with improved drought resistance.

7. The method according to claim 6, characterized in that: Methods X1) and X2) are implemented by editing the gene encoding the protein described in claim 1.

8. The method according to claim 6 or 7, characterized in that: The plant is M1, M2, M3, or M4. M1) Monocotyledons; M2) Gramineae plants; M3) Triticum species; M4 wheat.

9. The protein of claim 1 or any of the substances in claims 1-3 that regulate the content or activity of the protein.

Images