Rice heading period gene OsPRR95 and application thereof

CN120944950APending Publication Date: 2025-11-14INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511246710.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-02
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the heading stage of rice, affecting yield and quality, especially given the current slowdown in rice yield growth and the lack of discovery and utilization of micro-effect genes.

Method used

By knocking out the endogenous OsPRR95 gene in rice using CRISPR-Cas9 gene editing technology and introducing it into a gene engineering vector using Agrobacterium tumefaciens infection, genetically engineered rice with an advanced heading date was obtained. This technology was specifically applied to japonica rice varieties such as Nipponbare and Zhonghua 11.

Benefits of technology

Under natural long-day conditions, knocking out the OsPRR95 gene promotes earlier heading in rice, provides genetic resources to improve rice varieties, achieves high and stable yields, and provides a theoretical basis for adaptive improvement and stress-resistant breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses application of a rice heading period gene OsPRR95 in genetic engineering rice for regulating and controlling the rice heading period. An amino acid sequence coded by the rice heading period gene OsPRR95 is shown as SEQ ID No: 1. The heading period of the rice can be promoted by knocking out the OsPRR95 under natural long-day sunlight.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the rice heading stage gene OsPRR95 and its applications. Background Technology

[0002] Rice is one of the world's most important food crops, feeding nearly half the world's population. The heading stage, a key agricultural characteristic of rice, significantly affects rice yield and its adaptability to different regions. Heading too early or too late will more or less affect rice yield and quality. Therefore, identifying key genes related to the rice heading stage and studying the molecular mechanisms of important heading stage genes is crucial for breeders to develop high-quality, high-yield varieties. The rice heading stage is influenced by many external factors, such as light, temperature, and various hormones. Among these, photoperiod, as one of the key elements regulating the rice heading stage, has had its regulatory mechanisms in the model organism Arabidopsis thaliana relatively well elucidated.

[0003] As a short-day plant, the heading stage is a key agronomical trait of rice, directly affecting crop yield and adaptability to different environments. Although previous studies have identified some major genes that significantly influence traits such as plant height and yield, the discovery and utilization of minor genes are particularly important in the context of slowing rice yield growth. These minor genes may have a cumulative effect in the fine regulation of rice growth and development, potentially making a significant contribution to final yield formation. We hope to reveal a new regulatory network for heading stage, providing more genetic resources for rice molecular breeding, thereby promoting rice variety improvement and achieving the goal of high and stable yields. Furthermore, understanding the function and mechanism of action of these minor regulatory genes will also help us better grasp the laws of rice growth and development, providing a theoretical basis for its adaptive improvement and stress-resistant breeding. OsPRR95 encodes a pseudo-response regulator containing a CCT domain and is a member of the rice PRR (pseudo-response regulator) family. The PRR family has five members in both rice and Arabidopsis thaliana. Members of the PRR family have been reported to participate in processes such as rice heading stage, biological clock, and ABA stress response. Summary of the Invention

[0004] In this study, OsPRR95 was found to be an interacting protein with ELD4 during the heading stage, which was studied in our laboratory. Knocking out OsPRR95 under natural long-day conditions can promote the heading stage of rice. OsPRR95 is a clock-regulating gene and has been reported to participate in the ABA signaling regulation of seed germination pathway (Wang YP, Wu FQ, Zhou SR, Chen WW, Li CN, DuanEC, Wang JC, Cheng ZJ, Zhang X, Lin Q et al. Clock component OsPRR59 delays heading date by repressing transcription of Ehd3 in rice. Crop J. 2022: 10(6): 1570-1579. https: / / doi.org / 10.1016 / j.cj.2022.04.007.).

[0005] The purpose of this invention is to provide the function and application of the rice heading stage gene OsPRR95.

[0006] The technical solution provided by this invention is: the application of the rice heading period gene OsPRR95 in genetically engineered rice that regulates the rice heading period, wherein the amino acid sequence encoded by the rice heading period gene OsPRR95 is shown in SEQ ID No: 1.

[0007] In the aforementioned application, the regulation is further described as obtaining genetically engineered rice with an advanced heading date by knocking out the endogenous rice heading date gene OsPRR95.

[0008] In the aforementioned application, preferably, the rice is japonica rice, such as Nipponare or / and Zhonghua 11 (ZH11).

[0009] Meanwhile, the present invention also provides a method for preparing genetically engineered rice with advanced heading date, which is obtained by knocking out the endogenous rice heading date gene OsPRR95 through genetic engineering.

[0010] The amino acid sequence encoded by the rice heading stage gene OsPRR95 is shown in SEQ ID No: 1.

[0011] The method further includes a CRISPR-Cas9 gene editing method.

[0012] The method is further implemented by constructing a gene knockout vector containing the rice heading period gene OsPRR95 and introducing it into rice. Specifically, the introduction method is Agrobacterium infection.

[0013] Preferably, the rice in the method is japonica rice, such as Nipponare or / and Zhonghua 11 (ZH11).

[0014] Furthermore, the method described also involves obtaining homozygous rice varieties through self-pollination and hybridization.

[0015] The present invention has the following beneficial technical effects:

[0016] Knocking out the rice heading date gene OsPRR95 under natural long-day conditions can promote and advance the heading date of rice. This invention provides genetic resources for rice molecular breeding, thereby promoting the improvement of rice varieties and achieving the goal of high and stable yields. Furthermore, it helps us better understand the laws of rice growth and development, providing a theoretical basis for its adaptive improvement and stress-resistance breeding. Attached Figure Description

[0017] Figure 1 The OsPRR95 gene was knocked out using CRISPR / Cas9 technology in the context of NIP.

[0018] Figure 2 Basic properties of OsPRR95.

[0019] Figure 3 Heading phenotype of the Osprr95 mutant under natural long-day conditions.

[0020] Figure 4 Heading period traits of the Osprr95 mutant under natural long-day and natural short-day conditions.

[0021] Figure 5 The OsPRR95 gene was knocked out using CRISPR / Cas9 technology in the ZH11 background.

[0022] Figure 6 Heading period of the Osprr95 mutant under natural long-day conditions in the ZH11 background. Detailed Implementation

[0023] This invention discovered that the OsPRR95 gene may be involved in the regulation of rice heading stage when screening ELD4 interacting proteins, and therefore conducted a knockout experiment.

[0024] The gene sequence of the OsPRR95 gene is shown in SEQ ID No. 3, its CDS sequence is shown in SEQ ID No. 2, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 1.

[0025] Example 1: Obtaining the mutant and transgenic rice

[0026] This invention relates to the Osprr95 knockout mutant obtained through CRISPR-Cas9 gene editing. The specific knockout method is as follows:

[0027] I. Construction of gene knockout vector

[0028] a) Design knockout primers for Osprr95 using the website http: / / crispr.hzau.edu.cn / CRISPR2 / .

[0029] The primers are as follows: Osprr95CRISPR-F:AGATGATCCGTGGCACTAGCGGCGGGGGAATGGGTTTTAGAGCTATGC Osprr95CRISPR-R:GCATAGCTCTAAAACCCATTCCCCCGCCGCTAGTGCCACGGATCATCT.

[0030] b) Anneal the CRISPR forward and reverse primers. The amplification program was: 94℃ for 10 min, anneal to 15℃ at 0.1℃ / s, and hold at 15℃ for 10 min. The annealed product was then recombined with the sgRNA vector linearized by AarI enzyme. The reaction mixture was as follows: 1 μl sgRNA vector (30 ng / μg), 1 μl annealed product, 0.5 μl 5X infusion enzyme, and 2 μl ddH2O.

[0031] The above mixture was reacted at 50°C for 20 minutes.

[0032] c) The recombinant product was transferred into competent E. coli cells and incubated on ice for 10 min.

[0033] e) Heat shock in a 42℃ water bath for 40 seconds, then let stand on ice for 5 minutes.

[0034] f) Add 400 μL of liquid LB medium and activate at 37°C and 150 rpm for 1 h on a shaker.

[0035] g) Spread evenly on solid LB agar plates containing spectinomycin and incubate upside down at 37°C for 16 hours.

[0036] h) Select single clones for sequencing, and extract plasmids from the single clones that are correctly sequenced.

[0037] i) The correctly recombinant knockout vector was transferred into Agrobacterium using the freeze-thaw method to obtain the OsPRR95 knockout vector Agrobacterium tumefaciens EHA105 (MJ Cho et al., Agrobacterium-mediated high-frequency transformation of an elite commercial maize (Zea maysL.) inbred line. Plant Cell Rep., 33(10):1767-77 (2014).).

[0038] II. Obtaining Transgenic Plants

[0039] 1. Genetically modified callus infection

[0040] a) Transfer of callus that grew from mature embryos of rice (Nipponare (NIP), a japonica rice variety) after 2 weeks of induction.

[0041] Induced culture was carried out again for half a month on the subculture medium;

[0042] b) The successfully induced callus was mixed with Agrobacterium bacterial suspension (OD600 between 0.7 and 1.2) containing the OsPRR95 knockout vector prepared in the previous step and incubated for 30 min. The bacterial suspension was then blotted dry with sterile filter paper and transferred to co-culture medium and incubated in the dark for 3 days.

[0043] c) 0.2% carboxybenzyl killed uninfected Agrobacterium; callus was transferred to selection medium and screened for 15 days;

[0044] d) Select healthy callus and transfer it to the selection medium again for selection for 15 days;

[0045] e) The selected surviving callus was transferred to differentiation medium and differentiated for 21 days;

[0046] f) After differentiation, transfer to rooting medium for 15 days, and then transplant to a greenhouse or field for growth.

[0047] 2. Identification of transgenic plants

[0048] Amplification primers were designed approximately 200-300 bp upstream and downstream of the knockout target site. DNA was extracted from leaves of T0 generation transgenic plants for PCR amplification, and the editing method was analyzed by sequencing. The primers were identified by sequencing as follows:

[0049] Osprr95bcexu-F:TACAGATATTTCGTGCGCGG

[0050] Osprr95bcexu-R:GCCACTCGTGACAACAATTC.

[0051] Sequence sequencing analysis identified two homozygous Osprr95 knockout mutants with different editing methods. Osprr95-1 showed a two-base T deletion near the promoter, while Osprr95-2 showed an eight-base CCCCCATT deletion near the promoter. Both editing methods resulted in frameshift mutations, causing premature termination of the encoded protein. Figure 1 As shown.

[0052] Example 2: Investigation of the heading stage of transgenic OsPRR95 rice

[0053] OsPRR95 T1 transgenic rice and recipient rice were planted in Shunyi District, Beijing (a long-day region (NLD), with a day length greater than 15 hours). The heading date was investigated and photographed. The heading date was defined as the number of days from sowing until the first panicle emerges to a visible length of 1-2 cm. Under field conditions, to reduce the potential impact of environmental variations on the data, the heading date was systematically recorded and statistically analyzed every 48 hours. Statistical data were based on the average heading date of at least 15 plants to improve the reliability of the results.

[0054] First, we analyzed the expression pattern of OsPRR95. The results showed that OsPRR95 exhibited high expression levels in leaves, leaf sheaths, and panicles. Figure 2 (A). Meanwhile, OsPRR95 was observed to exhibit a regular rhythmic expression pattern under both long-day (LD) and short-day (SD) conditions, with the lowest expression level at dawn and the highest expression level at dusk. Figure 2 B, Figure 2 (C). Simultaneously, we detected its subcellular localization by transforming the constructed OsPRR95-GFP vector into rice protoplasts. The results showed that OsPRR95 was localized in the nucleus and cell membrane. Figure 2 (D).

[0055] Next, the homozygous T1 transgenic plants were planted, and the field phenotypes of the knockout mutant and wild-type Nipponare were investigated and photographed under natural long-day conditions in Beijing. The results are as follows: Figure 3 and Figure 4As shown, under natural long-day conditions in Beijing, the knockout mutant exhibited an earlier heading date compared to the wild type. However, under natural short-day (NSD) conditions, there was no significant difference in heading date between the knockout mutant and the wild type. In the Zhonghua 11 (ZH11) genus, OsPRR95 was knocked out using CRISPR / Cas9 editing technology, resulting in two homozygous families (Osprr95-3 and Osprr95-4). Phenotypic observation revealed that Osprr95-3 showed an insertion of one base A near the promoter, while Osprr95-4 showed a deletion of eight bases (AAAATGGA) near the promoter. Figure 5 The heading date survey showed that under NLD conditions, the heading dates of the Osprr95-3 and Osprr95-4 mutants were approximately 5 days earlier than those of ZH11. Figure 6 (Choose A from the middle school, and B from the middle school)

Claims

1. The application of a rice heading period gene OsPRR95 in genetically engineered rice that regulates the heading period of rice, wherein the amino acid sequence encoded by the rice heading period gene OsPRR95 is shown in SEQ ID No:

1.

2. The application as described in claim 1, characterized in that, The regulation was achieved by knocking out the endogenous rice heading period gene OsPRR95 to obtain genetically engineered rice with an advanced heading period.

3. The application as described in claim 1 or 2, characterized in that, The rice variety is japonica rice, such as Nipponare or / and Zhonghua 11.

4. A method for preparing genetically engineered rice with an advanced heading date, characterized in that, It was obtained by knocking out the endogenous rice heading period gene OsPRR95 in rice through genetic engineering. The amino acid sequence encoded by the rice heading stage gene OsPRR95 is shown in SEQ ID No:

1.

5. The method as described in claim 4, characterized in that, The genetic engineering method mentioned is the CRISPR-Cas9 gene editing method.

6. The method as described in claim 5, characterized in that, This is achieved by constructing a gene knockout vector containing the rice heading period gene OsPRR95 and introducing it into rice. Specifically, the introduction method is Agrobacterium infection.

7. The method according to any one of claims 4 to 6, characterized in that, The rice variety is japonica rice, such as Nipponare or / and Zhonghua 11.

8. The method according to any one of claims 4 to 6, characterized in that, They also obtained homozygous rice varieties through self-pollination and hybridization.