Rice heading period gene ELD4 and application thereof

Abstract

The invention discloses application of a rice heading stage gene ELD4 in genetic engineering rice for regulating and controlling the rice heading stage. An amino acid sequence coded by the rice heading stage gene ELD4 is shown as SEQ ID No: 1. The heading period of the rice can be promoted by knocking out the eld4 under natural long sunshine, and the heading period of the rice can be delayed when the ELD4 is over-expressed.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the rice heading stage gene ELD4 and its applications. Background Technology

[0002] Rice is one of the world's most important food crops, feeding nearly half the world's population. The heading stage, a key agricultural characteristic of rice, significantly affects rice yield and its adaptability to different regions. Heading too early or too late will more or less affect rice yield and quality. Therefore, identifying key genes related to the rice heading stage and studying the molecular mechanisms of important heading stage genes is crucial for breeders to develop high-quality, high-yield varieties. The rice heading stage is influenced by many external factors, such as light, temperature, and various hormones. Among these, photoperiod, as one of the key elements regulating the rice heading stage, has had its regulatory mechanisms in the model organism Arabidopsis thaliana relatively well elucidated.

[0003] As a short-day plant, the heading stage is a key agronomical trait of rice, directly affecting crop yield and adaptability to different environments. Although previous studies have identified some major genes that significantly influence traits such as plant height and yield, the discovery and utilization of minor genes are particularly important in the context of slowing rice yield growth. These minor genes may have a cumulative effect in the fine regulation of rice growth and development, potentially making a significant contribution to final yield formation. We hope to reveal a new regulatory network for heading stage, providing more genetic resources for rice molecular breeding, thereby promoting the improvement of rice varieties and achieving the goal of high and stable yields. Furthermore, understanding the function and mechanism of action of these minor regulatory genes will also help us better grasp the laws of rice growth and development, providing a theoretical basis for its adaptive improvement and stress-resistant breeding. ELD4 encodes a zinc finger transcription factor containing a B-BOX domain. BBX (B-Box) is a subfamily of zinc finger structural proteins. Its N-terminus contains one or two highly conserved B-Box domains that can bind to Zn ions and participate in protein-protein interactions. Arabidopsis thaliana has 32 B-Box proteins, and rice has 30. These BBX proteins in plants have been reported to play important roles in photomorphogenesis, abiotic stress response, hormone signal transduction, and flowering. Summary of the Invention

[0004] In this study, we discovered a rice mutant with an advanced heading date using EMS mutagenesis. Knocking out eld4 under natural long-day conditions promoted the heading date of rice, while overexpression of Eld4 delayed the heading date.

[0005] The purpose of this invention is to provide a rice heading stage gene ELD4 and its application.

[0006] The technical solution provided by this invention is: the application of the rice heading period gene ELD4 in genetically engineered rice that regulates the rice heading period, wherein the amino acid sequence encoded by the rice heading period gene ELD4 is shown in SEQ ID No: 1.

[0007] In the aforementioned application, the regulation is to obtain genetically engineered rice with an advanced heading date by knocking out the endogenous rice heading date gene ELD4, or to obtain genetically engineered rice with a delayed heading date by overexpressing the rice heading date gene ELD4.

[0008] In the aforementioned application, preferably, the rice is japonica rice, such as Nipponare japonica rice.

[0009] Meanwhile, the present invention provides a method for preparing genetically engineered rice with advanced heading date, which is obtained by knocking out the endogenous rice heading date gene ELD4 through genetic engineering.

[0010] The amino acid sequence encoded by the rice heading stage gene ELD4 is shown in SEQ ID No: 1.

[0011] Preferably, the genetic engineering method described in the method is the CRISPR-Cas9 gene editing method.

[0012] The method is further implemented by constructing a gene knockout vector containing the rice heading period gene ELD4 and introducing it into rice. Specifically, the introduction method is Agrobacterium infection.

[0013] The present invention also provides a method for preparing genetically engineered rice with delayed heading date, which is obtained by overexpressing the rice heading date gene ELD4 in rice through genetic engineering.

[0014] The amino acid sequence encoded by the rice heading stage gene ELD4 is shown in SEQ ID No: 1.

[0015] The above method is further implemented by constructing an overexpression vector containing the gene targeting the rice heading stage gene ELD4 and introducing it into rice. Specifically, the introduction method is Agrobacterium infection.

[0016] Preferably, the rice used in the method is japonica rice, such as Nipponare.

[0017] Furthermore, the method described also involves obtaining homozygous rice varieties through self-pollination and hybridization.

[0018] The present invention has the following beneficial technical effects:

[0019] Knocking out the rice heading gene ELD4 under natural long-day conditions promoted heading, while overexpression of ELD4 delayed it. To further investigate whether the ELD4 knockout mutant affected yield, we analyzed other agronomic traits. Compared to wild-type NIP (Nipponare), the mutants showed a significantly higher seed setting rate per plant. Furthermore, plant height, number of tillers, and number of secondary branches per panicle showed no significant differences between the eld4-4 and eld4-5 mutants and the wild-type WT.

[0020] This invention provides genetic resources for rice molecular breeding, thereby promoting the improvement of rice varieties and achieving the goal of high and stable yields. Furthermore, it helps us better understand the laws governing rice growth and development, providing a theoretical basis for its adaptive improvement and stress-resistance breeding. Attached Figure Description

[0021] Figure 1 The ELD4 gene was knocked out using CRISPR / Cas9 technology in the context of NIP.

[0022] Figure 2 pCAMBIA 1390 vector image.

[0023] Figure 3 mRNA levels of OE-ELD4-1 and OE-ELD4-2.

[0024] Figure 4 Heading phenotypes of ELD4 knockout and overexpression. Detailed Implementation

[0025] This invention uses EMS mutagenesis technology combined with MutMap analysis to discover that the ELD4 gene may be involved in the regulation of the heading stage of rice, and therefore knockout and overexpression experiments were carried out.

[0026] The gene sequence of the ELD4 gene is shown in SEQ ID No. 3, its CDS sequence is shown in SEQ ID No. 2, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 1.

[0027] Example 1

[0028] This invention obtains the eld4 knockout mutant using the CRISPR-Cas9 gene editing method, and simultaneously uses the overexpression vector pCAMBIA 1390 to obtain OE-ELD4 overexpressing transgenic plants. The specific knockout method is as follows:

[0029] I. Construction of gene knockout vector

[0030] a) Design knockout primers for eld4 using the website http: / / crispr.hzau.edu.cn / CRISPR2 / . The primer sequences are as follows:

[0031] eld4CRISPR-F:TGTGTGTGGAAGATACCTGCTCCTA;

[0032] eld4CRISPR-R: AAACTAGGAGCAGGTATCTTCCACA.

[0033] b) Anneal the CRISPR forward and reverse primers. The amplification program was: 94℃ for 10 min, anneal to 15℃ at 0.1℃ / s, and hold at 15℃ for 10 min. The annealed product was then recombined with the sgRNA vector linearized by AarI enzyme. The reaction mixture was as follows: 1 μl sgRNA vector (30 ng / μg), 1 μl annealed product, 0.5 μl 5X infusion enzyme, and 2 μl ddH2O.

[0034] The above mixture was reacted at 50°C for 20 minutes.

[0035] c) The recombinant product was transferred into competent E. coli cells and incubated on ice for 10 min.

[0036] e) Heat shock in a 42℃ water bath for 40 seconds, then place on ice for 5 minutes;

[0037] f) Add 400 μL of liquid LB medium and activate at 37°C and 150 rpm for 1 h on a shaker;

[0038] g) Spread evenly on solid LB medium plates containing spectinomycin and incubate upside down at 37°C for 16 hours;

[0039] h) Select single clones for sequencing, and extract plasmids from the single clones that are correctly sequenced;

[0040] i) The correctly recombinant knockout vector was transferred into Agrobacterium tumefaciens EHA105 using the freeze-thaw method to obtain the ELD4 knockout vector.

[0041] II. Obtaining Transgenic Plants

[0042] 1. Genetically modified callus infection

[0043] a) The callus that grows from the mature embryo of rice (Nipponare (NIP), a well-known and widely used variety, a japonica rice variety) after 2 weeks of induction is transferred to a subculture medium and then induced and cultured for another half month;

[0044] b) Mix the successfully induced callus with Agrobacterium bacterial suspension (OD600 between 0.7 and 1.2) containing the ELD4 knockout vector prepared in the previous step and incubate for 30 min. Blot the bacterial suspension dry with sterile filter paper and transfer it to co-culture medium. Incubate in the dark for 3 days.

[0045] c) 0.2% carboxybenzyl killed uninfected Agrobacterium; callus was transferred to selection medium and screened for 15 days;

[0046] d) Select healthy callus and transfer it to the selection medium again for selection for 15 days;

[0047] e) The selected surviving callus was transferred to differentiation medium and differentiated for 21 days;

[0048] f) After differentiation, transfer to rooting medium for 15 days, and then transplant to a greenhouse or field for growth.

[0049] 2. Identification of transgenic plants

[0050] Amplification primers were designed approximately 200-300 bp upstream and downstream of the knockout target site. DNA was extracted from leaves of T0 generation transgenic plants for PCR amplification, and the editing method was analyzed by sequencing. The sequencing primers for identification are shown below:

[0051] eld4bcexu-F:TGCATATGTGTAACAAGCTTGCT

[0052] eld4bcexu-R: TGCATTTGCTCCTTTGTTACTG

[0053] Sequence sequencing analysis identified two homozygous eld4 knockout mutants with different editing methods. eld4-4 showed a one-T insertion at the third exon, while eld4-5 showed a two-T deletion at the third exon. Both editing methods resulted in frameshift mutations, causing premature termination of the encoded protein. Figure 1 As shown.

[0054] Example 2

[0055] I. Construction of the overexpression vector pCAMBIA1390-ELD4

[0056] 1. Acquisition of the ELD4 gene

[0057] Total RNA was extracted from wild-type Nipponare and reverse transcribed into cDNA. Using cDNA as a template, PCR amplification was performed with ELD4-cds-F and ELD4-cds-R primers to obtain the 633 bp ELD4 gene.

[0058] The primers are as follows:

[0059] ELD4-cds-F:TCTGCACTAGGTACCTGCAGATGCGGACGATCTGCGACGT

[0060] ELD4-cds-R:ATGGATCCGTCGACCTGCAGTTGTTGGCTTCTCGTTCGA

[0061] 2. Construction of ELD4 overexpression vector

[0062] The pCAMBIA1390 vector was digested with the restriction endonuclease Pst I, and approximately 10820 bp of linear plasmid was recovered to obtain the large vector fragment. The pCAMBIA1390 vector circular vector map is shown below. Figure 2 As shown. The 10820 bp linear plasmid was infused with the ELD4 gene obtained in step 1 using Clontech's infusion enzyme (www.clontech.com, catalog number: ST0344) to obtain the recombinant plasmid, named OE-ELD4.

[0063] Sequencing confirmed that the recombinant plasmid OE-ELD4 was obtained by inserting the ELD4 gene between the Pst I restriction sites of the pCAMBIA1390 vector.

[0064] II. Construction of transgenic plants overexpressing the ELD4 gene and identification of transgenic plants

[0065] 1. Construction of transgenic plants

[0066] The recombinant plasmid OE-ELD4 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens EHA105 / OE-ELD4.

[0067] 2. Obtaining rice with ELD4 gene overexpression

[0068] The EHA105 / OE-ELD4 was transferred into the callus tissue of mature embryos of rice Nipponare (Oryza sativa) (hereinafter referred to as recipient rice). The specific steps are as follows:

[0069] (1) Recombinant Agrobacterium EHA105 / OE-ELD4 was cultured in liquid LB medium containing 50 μmol / L kanamycin to obtain a bacterial suspension with OD600nm ≈ 0.5.

[0070] (2) Mature embryogenic callus tissue of rice Nippoare cultured for one month was mixed with the diluted bacterial solution from step (1), and infected for 30 min. After the bacterial solution on the surface of the callus tissue was blotted dry with filter paper, it was transferred to N6 solid co-culture medium (the N6 mixed medium formula is: potassium nitrate (2800 mg / L), ammonium sulfate (463 mg / L), potassium dihydrogen phosphate (400 mg / L), magnesium sulfate (MgSO4•7H2O) (185 mg / L), calcium chloride (CaCl2•2H2O) (165 mg / L), disodium ethylenediaminetetraacetate (37.3 mg / L), ferrous sulfate (FeSO4•7H2O) (27.8 mg / L), manganese sulfate (MnSO4•H2O) (4.4 mg / L), zinc sulfate (ZnSO4•7H2O) (1.5 mg / L), boric acid (1.6 mg / L), potassium iodide (0.8 mg / L). The following ingredients were added: vitamin B1 (thiamine hydrochloride) (1.0 mg / L), vitamin B6 (pyridoxine hydrochloride) (0.5 mg / L), nicotinic acid (0.5 mg / L), glycine (2.0 mg / L), and sucrose (20000 mg / L). 24.1 g of N6 mixed culture medium was weighed, heated and stirred to dissolve in 1000 ml of distilled water, and the pH was adjusted to 5.8 with sodium hydroxide. The medium was then autoclaved at 115℃ for 20 minutes to obtain N6 solid co-culture medium. The medium was co-cultured at 24℃ for 3 days to obtain co-cultured callus tissue.

[0071] (3) The callus tissue after co-culture treatment in step (2) was inoculated on N6 solid screening medium containing hygromycin at a mass concentration of 150 mg / L (the medium obtained by adding hygromycin to N6 solid screening medium, the mass concentration of hygromycin in N6 solid screening medium is 150 mg / L) for the first screening.

[0072] (4) On the 16th day after the first screening, healthy callus tissue was picked and transferred to N6 solid screening medium containing hygromycin at a mass concentration of 200 mg / L (the medium obtained by adding hygromycin to N6 solid screening medium, the mass concentration of hygromycin in N6 solid screening medium is 200 mg / L) for a second screening. Subculture was performed every 15 days for a total of 1 subculture. The resulting healthy callus tissue is the resistant callus tissue.

[0073] (5) Select the resistant callus obtained in step (4) and transfer it to a differentiation medium containing hygromycin at a mass concentration of 150 mg / L (differentiation medium: 6-BA 2 mg, NAA 0.2 mg, N6 mixed medium 4 g, hydrolyzed casein 1 g, inositol 0.1 g, sucrose 25 g, sorbitol 2.4 g, agar powder 7 g, deionized water to 1 L) for differentiation culture. Culture at 24℃ for 45 days (at this time the above-ground part of the plant is about 15 cm tall), open the bottle mouth for 3 days to harden the seedlings, and then transplant them to the greenhouse for cultivation, which is the OE-ELD4 plant (T0 generation).

[0074] 3. PCR identification of ELD4-transformed rice

[0075] Genomic DNA was extracted from T0 and T1 generation ELD4 transgenic rice plants as templates and PCR amplification was performed using 1390-F and ELD4-R primers.

[0076] The primers are as follows:

[0077] 1390-F: TGCCTTCATACGCTATTTATTTGC

[0078] ELD4-R:TTTGTTGGCTTCTCGTTCGA.

[0079] If a transgenic plant can amplify a DNA fragment using the above primers by PCR, it is considered a positive transgenic plant. For a given T0 generation plant, if both the plant and its T1 generation are positive by PCR, it is considered a homozygous ELD4 gene overexpression plant, and the self-crossed offspring of this plant will be an ELD4 gene overexpression line.

[0080] 4. Detection of mRNA expression levels in plants

[0081] To detect the expression level of the ELD4 gene in transgenic progeny, real-time quantitative PCR was used to detect the expression of the ELD4 gene in recipient rice and T0 generation ELD4 transgenic rice. Real-time quantitative PCR was performed on a quantitative PCR instrument (7900 real-time, Applied Biosystems) according to the operating procedures provided by Applied Biosystems, using the rice Ubiqutin gene as an internal control. Primers were annealed at 60℃, and the reaction was performed for 40 cycles, with three replicates per sample. The reaction volume was 20 μl, including 1 μl of reverse transcription product, 0.25 μM of forward and reverse primers, and 12.5 μl of SYBR Green mixture (purchased from Takara).

[0082] The primers used for real-time quantitative PCR identification are as follows:

[0083] ELD4-RT-F: TGCGATGACCAGGGTAACAT

[0084] ELD4-RT-R:TACATGTTGGCACCACTCCT.

[0085] Compared with wild-type rice, the expression level of the ELD4 gene was significantly increased in the T0 generation transgenic ELD4 rice lines OE-ELD4-1 and OE-ELD4-2. Figure 3 ).

[0086] Example 3: Phenotypic and agronomical trait survey of ELD4 transgenic rice

[0087] 1. Heading period survey

[0088] Transgenic rice plants (eld4 mutant and ELD4 overexpressing T1 generation) and recipient rice were planted in Shunyi District, Beijing (a long-day region (NLD), with a day length greater than 15 hours). The heading date was investigated and photographed. The heading date was defined as the number of days from sowing until the first panicle emerges to a visible length of 1-2 cm. Under field conditions, to reduce the potential impact of environmental variations on the data, the heading date was systematically recorded and statistically analyzed every 48 hours. Statistical data were based on the average heading date of at least 15 plants to improve the reliability of the results. The observed results are as follows: Figure 4 As shown, under NLD conditions, the eld4-4 and eld4-5 mutants have an earlier heading date, approximately 4-7 days earlier than the wild type. Figure 4 A, 4C). Furthermore, compared to the wild type, both OE-ELD4-1 and OE-ELD4-2 showed a significant delay in heading date. Specifically, the heading date of OE-ELD4-1 was delayed by an average of approximately 5 days, while the delay of OE-ELD4-2 was more significant, averaging approximately 10 days. Figure 4 (B, 4C). We also analyzed other agronomic traits. Compared to wild-type NIP (Nipponare), the mutants showed a significantly higher seed set per plant. Furthermore, plant height, number of tillers, and number of secondary branches per spike showed no significant differences between the eld4-4 and eld4-5 mutants and the WT mutant.

[0089] The rice Nipponare (also known as wild-type rice, abbreviated as WT) in the above embodiments: This biological material can be obtained by the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.

[0090] pCAMBIA1390 and CRISPR / Cas9 vectors are commercially available: they can be obtained by the public through commercial channels or relevant institutions, or from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0091] The Agrobacterium used in the above examples is Agrobacterium tumefaciens EHA105, which is described in the following literature: New Agrobacterium helper plasmids for gene transfer to plants. Hood, Elizabeth E; Gelvin, Stanton B; Melchers, Leo S; Hoekema, Andre. Transgenic research, 2(4): p.208-218 (1993). This biological material can be obtained from the Institute of Crop Science, Chinese Academy of Agricultural Sciences. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.

Claims

1. The application of a rice heading period gene ELD4 in genetically engineered rice that regulates the heading period of rice, wherein the amino acid sequence encoded by the rice heading period gene ELD4 is shown in SEQ ID No:

1.

2. The application as described in claim 1, characterized in that, The regulation is achieved by knocking out the endogenous rice heading period gene ELD4 to obtain genetically engineered rice with an advanced heading period, or by overexpressing the rice heading period gene ELD4 to obtain genetically engineered rice with a delayed heading period.

3. The application as described in claim 1 or 2, characterized in that, The rice mentioned is japonica rice, such as Nipponare.

4. A method for preparing genetically engineered rice with an advanced heading date, characterized in that, It was obtained by knocking out the endogenous rice heading period gene ELD4 in rice through genetic engineering. The amino acid sequence encoded by the rice heading stage gene ELD4 is shown in SEQ ID No:

1.

5. The method as described in claim 4, characterized in that, The genetic engineering method mentioned is the CRISPR-Cas9 gene editing method.

6. The method as described in claim 5, characterized in that, This is achieved by constructing a gene knockout vector containing the rice heading period gene ELD4 and introducing it into rice. Specifically, the introduction method is Agrobacterium infection.

7. A method for preparing genetically engineered rice with delayed heading date, characterized in that, It was obtained by overexpressing the rice heading stage gene ELD4 in rice using genetic engineering techniques; The amino acid sequence encoded by the rice heading stage gene ELD4 is shown in SEQ ID No:

1.

8. The method as described in claim 7, characterized in that, This is achieved by constructing an overexpression vector containing the gene targeting the rice heading stage gene ELD4 and introducing it into rice. Specifically, the introduction method is Agrobacterium infection.

9. The method according to any one of claims 5 to 8, characterized in that, The rice variety mentioned is japonica rice, such as Nipponare.

10. The method according to any one of claims 5 to 8, characterized in that, They also obtained homozygous rice varieties through self-pollination and hybridization.

Images