Method for quantitatively detecting content of sheep-derived component in meat product through dual real-time fluorescent PCR (Polymerase Chain Reaction)

Abstract

The invention provides a sheep-derived component rapid quantitative detection method based on dual real-time fluorescent PCR. According to the method, a single-copy nuclear gene GAPDH is taken as a target spot, a sheep specific primer and a probe are designed in a hypervariable region of the single-copy nuclear gene GAPDH, and an internal reference primer and a probe capable of identifying various common animal-derived components are designed in a conserved region of the single-copy nuclear gene GAPDH. As the target and the internal reference are located in the same gene and coexist in the same cell according to the proportion of 1: 1, quantitative deviation caused by gene copy number difference or expression fluctuation in a traditional two-step method is remarkably reduced. The detection strategy constructed by the invention has double advantages of specific recognition and broad-spectrum reference, is clear in quantitative basis and simple and convenient to operate, is suitable for rapid recognition and quantitative adulteration analysis of sheep-derived components in meat products, and has wide application prospects and supervision values.

Description

Technical Field

[0001] This invention belongs to the field of food testing, and specifically relates to a method for detecting the content of sheep-derived components in meat products. Background Technology

[0002] With the improvement of people's living standards and the integration of Chinese and Western dietary cultures, the proportion of mutton in China's meat consumption is constantly increasing. However, driven by economic interests, adulteration is rampant in the meat processing industry and markets, especially the mixing of low-priced meats (such as pork, chicken, and duck) into high-priced beef products. Such practices not only harm consumer rights and disrupt market order, but may even trigger sensitive issues such as religious beliefs and social stability. Therefore, establishing efficient and accurate technologies for identifying animal-derived components and detecting adulteration is of significant practical importance.

[0003] Currently, the main methods for detecting adulterated meat include traditional morphological methods, species-specific protein-based detection methods, and nucleic acid-based detection methods. Traditional morphological methods mainly rely on visual observation and microscopic morphological characteristics, but this method is not suitable for the identification of processed meats and cannot quantitatively analyze the proportion of mixed meats (Ballin NZ et al., Authentication of meat and meat products. Meat Sci 2010, 86(3):577-587.). Protein-based methods, such as enzyme-linked immunosorbent assay (ELISA), mass spectrometry (MS), and high-performance liquid chromatography (UPLC), have certain quantitative potential, but they are prone to protein degradation or denaturation under high-temperature processing conditions, which in turn affects the accuracy and repeatability of the detection results (Stachniuk A, et al., Liquid Chromatography-Mass Spectrometry Bottom-up Proteomic Methods in Animal Species Analysis of Processed Meat for Food Authentication and the Detection of Adulterations. Mass Spectrom Rev2021,40(1):3-30; Von Bargen C, et al., Meat authentication: a new HPLC-MS / MS based method for the fast and sensitive detection of horse and pork in highly processed food. J Agric Food Chem 2014,62(39):9428-9435.).

[0004] In recent years, nucleic acid-based detection methods have developed rapidly, especially droplet digital PCR (ddPCR). With its high sensitivity, high precision, and ability to achieve absolute quantification without a standard curve, it has gradually become a hot topic in meat adulteration detection (MaXY et al., A Droplet Digital PCR-Based Approach for Quantitative Analysis of the Adulteration of Atlantic Salmon with Rainbow Trout. Foods 2023, 12(23); Ren J et al., A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food. PLoS One 2017, 12(3):e0173567; Shehata HR et al., Droplet digital polymerase chain reaction (ddPCR) assays integrated with an internal control for quantification of bovine, pocine, chicken and turkey species in food and feed. PLoS One 2017, 12(8):e0182872; Yu N et al., An effective analytical droplet digital...). PCR approach for identification and quantification of fur-bearing animal meat in raw and processed food. Food Chem 2021, 355:129525. However, while ddPCR can accurately detect the copy number of target DNA in a sample, it cannot directly determine whether food has been adulterated. This is mainly due to the complexity of determining adulteration in animal-derived foods. In actual food processing, to enhance flavor and texture, compound seasonings such as chicken essence, bone broth, or animal fats are often added. These additives may carry trace amounts of non-labeled animal-derived components.Although such components can be identified in nucleic acid testing, this does not necessarily indicate that the food has been adulterated (Artavia G et al., Selected Instrumental Techniques Applied in Food and Feed: Quality, Safety and Adulteration Analysis. Foods 2021, 10(5); Mortas M et al., Adulteration detection technologies used for halal / kosher food products: an overview. Discov Food 2022, 2(1): 15.). For example, the detection of trace amounts of chicken or pork DNA in braised beef products may only originate from the ingredients rather than a substitute for the main ingredient. Therefore, adulteration determination cannot rely solely on the detection of foreign components, but must be based on accurate quantification of their relative content to scientifically assess whether malicious adulteration has occurred.

[0005] Currently, most commonly used methods for quantifying animal-derived components (mass) employ a "two-step method," which first converts the DNA copy number into DNA content, and then further converts the DNA content into the corresponding mass ratio of animal-derived components (Cai Y et al., Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR. PLoS One 2017, 12(8):e0181949.). This method requires the establishment of two standard curves, is cumbersome to operate, and is prone to cumulative errors, affecting the accuracy of the final quantification. To improve the efficiency and accuracy of quantitative analysis, some studies in recent years have attempted to directly convert DNA copy number into the proportion of target components by introducing internal reference genes or multiplier factors (conversion factors), thereby reducing the introduction of errors (Xu H et al., A Droplet Digital PCR Based Approach for Identification and Quantification of Porcine and Chicken Derivatives in Beef. Foods 2022, 11(20); Masuyama M et al., Quantitative change in mitochondrial DNA content in various mouse tissues during aging. Biochim Biophys Acta 2005, 1723(1-3):302-308; Yuxuan He et al., An effective droplet digital PCR method for identifying and quantifying meat adulteration in raw and processed food of beef (Bos taurus) and lamb (Ovis aries). Frontiers in Sustainable Food Systems 2023, 7). However, this type of method relies on the assumption that the copy number ratio of the target gene to the internal reference gene remains constant across different tissues and species. But actual studies have shown that this ratio often varies across different species and even different tissues within the same species, severely impacting the accuracy of the ratio conversion and the reproducibility of the method (Ruan W et al., Actin, a reliable marker of internal control? Clin Chim Acta 2007, 385(1-2):1-5).

[0006] Some studies have attempted to introduce internal reference genes for signal normalization, but since commonly used internal reference genes (such as β-actin, 18S rRNA, etc.) and target genes may be located on different chromosomes and in different organelles (such as mitochondrial and nuclear genes), their expression levels and stability in different tissues or samples vary significantly, leading to bias [19,24]. In addition, high temperature, salting, fermentation and other operations in food processing inevitably lead to DNA degradation, affecting detection efficiency and result accuracy (Gryson N, Effect of food processing on plant DNA degradation and PCR-based GMOanalysis: a review. Anal Bioanal Chem 2010, 396(6):2003-2022; Sajali N et al., The Challenges of DNA Extraction in Different Assorted Food Matrices: A Review. J Food Sci 2018, 83(10):2409-2414).

[0007] To address the aforementioned problems, this invention establishes a method for detecting sheep-derived components based on dual real-time fluorescence PCR. This method targets the single-copy GAPDH gene, designing sheep-specific primers and probes in its hypervariable region, and designing internal control primers and probes in the conserved region that can recognize most animal-derived components. Since the target gene and the internal control gene are located at the same gene locus and coexist in the same cell at a 1:1 ratio, their copy number ratio directly reflects the ratio of sheep cells to total animal cells, thus achieving accurate quantification of sheep-derived components in food, such as mutton. This invention also systematically evaluated the sensitivity, repeatability, reproducibility, and applicability of this method, showing good stability and reliability in the detection of sheep-derived components. This invention provides an efficient and practical molecular detection technology for adulteration identification and quality control of mutton products. Summary of the Invention

[0008] According to one aspect of the present invention, a primer and probe set for detecting sheep-derived components based on dual real-time fluorescence PCR is provided, the primer and probe set comprising a first set of primers and probes and a second set of primers and probes, wherein the first set of primers and probes and the second set of primers and probes target the GAPDH gene, the first set of primers and probes being sheep-specific primers and probes targeting its hypervariable region, and the second set of primers and probes being internal reference primers and probes targeting its conserved region that can recognize multiple animal-derived components.

[0009] Preferably, the sequences of the first set of primers and probes are as follows:

[0010] F:CACTGAGGACCAGGTTGTCT;

[0011] R: CCCAGCATCGAAGGTAGAAGA;

[0012] P: FAM-CCTGCGACTTCAACAGCGACACT-BHQ1.

[0013] More preferably, the sequences of the second set of primers and probes are as follows:

[0014] F: CGACCACTTTGTCAAGCTCA;

[0015] R: TACTCCTTGGAGGCCATGTG;

[0016] P: VIC-CCACCACCCTTGTTGCTGTAGCCG-BHQ2.

[0017] According to another aspect of the present invention, a method for detecting sheep-derived components based on dual real-time fluorescence PCR technology is provided, which includes using sample genomic DNA as a template and performing dual real-time fluorescence PCR detection with the aforementioned primer and probe set.

[0018] According to another aspect of the present invention, a kit for detecting sheep-derived components based on dual real-time fluorescence PCR is provided, the kit comprising the aforementioned primer and probe set.

[0019] According to another aspect of the present invention, a use is provided for detecting sheep-derived components in a sample using the primer and probe set or the detection kit, wherein the detection process includes: using the sample genomic DNA as a template, performing dual real-time fluorescent PCR detection using the primer and probe set or the detection kit; wherein, if the copy number ratio of the sheep-derived target gene to the internal reference gene is within the range of 1.00±0.05, it is preliminarily determined that no other meat is mixed in; otherwise, it is preliminarily determined that non-sheep-derived animal meat is included. Preferably, the products containing sheep-derived components include, but are not limited to: lamb leg, lamb neck, lamb chops, lamb scorpion, and lamb fat; preferably, the mixed non-sheep-derived animal meat is pork.

[0020] The advantages of this invention are:

[0021] This invention, based on dual real-time fluorescence PCR technology, constructs a novel method for the quantitative detection of sheep-derived components in meat products, possessing clear technological innovations and practical application value. The invention designs a pair of primers and probes targeting a target region (sheep-specific region) and an internal reference region (conserved region), respectively, both targeting the same single-copy gene, GAPDH. Since the target sequences recognized by the two sets of primers coexist in the same cell and at the same locus, their copy numbers theoretically exist collinearly in a 1:1 ratio, effectively avoiding the systematic bias caused by copy number differences between the target gene and the internal reference gene in traditional methods. This strategy enables the direct deduction of meat cell proportions from DNA copy number and further estimates the mass percentage of mutton in mixed meat products, providing a more reproducible and stable analytical pathway for the accurate quantification of animal-derived components.

[0022] In terms of specificity verification, the designed sheep-derived specific primers and probes only generated amplification signals in mutton samples and showed no cross-reactivity with 10 common livestock and poultry (such as pigs, cattle, chickens, and ducks). Meanwhile, the internal control primers and probes amplified the GAPDH gene fragment in 12 animal-derived samples, indicating that the detection system achieved an effective balance between target recognition and universality. This design not only improved the specificity and stability of the detection but also laid the foundation for subsequent expansion into multi-species systems.

[0023] The established amplification standard curves showed good linear correlation (R0). 2 =0.9996 and 0.9950), with amplification efficiencies greater than 95%. The detection results in simulated adulterated samples showed high consistency with theoretical values ​​(Relative Standard Deviation (RSD) < 5%). The target / internal reference ratio remained stable in tissue samples from different sites, indicating that the method has good accuracy, stability, and practicality. The detection strategy constructed in this invention combines the advantages of specific identification and broad-spectrum reference, has a clear quantitative basis, and is easy to operate. It is suitable for the rapid identification and quantitative analysis of sheep-derived components in meat products, and has broad application prospects and regulatory value. Attached Figure Description

[0024] Figure 1: Species-specificity test results of primers and probes. Figure 1a. Real-time fluorescent PCR amplification curves of Control-F / R / P primers and probes on 12 animal-derived DNA templates. All samples showed amplification signals, indicating that this primer set has broad species universality and can be used as an internal control. Figure 1b. Real-time fluorescent PCR amplification curves of Ovis-F / R / P primers and probes on 12 animal-derived DNA templates. Only goat and sheep (Ovis aries) samples showed amplification signals, while other species did not amplify, indicating that this primer set has good sheep-derived specificity.

[0025] Figure 2: Sensitivity evaluation of the primer-probe system. Figure 2a. Real-time fluorescence PCR amplification curves of Ovis-F / R / P primers and probes under different concentration gradients (100 ng / μL, 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL) of sheep DNA template. High amplification efficiency, with a detection limit as low as 0.001 ng / μL. Figure 2b. Amplification curves of Control-F / R / P primers and probes under different concentration gradients (10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, 0.0001 ng / μL) of sheep DNA template. The amplification curves showed good consistency, with Ct values ​​varying with concentration, and a detection limit as low as 0.001 ng / μL, making it suitable for use as an internal control.

[0026] Figure 3: Establishment of quantitative detection standard curves for the real-time PCR method. Figure 3a: Standard curve for internal reference gene; Figure 3b: Standard curve for sheep quantitative detection. Detailed Implementation

[0027] The present invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit the invention.

[0028] Example 1: Sample Preparation

[0029] Fresh mutton and pork samples were purchased from the market. All samples were washed with sterile distilled water, chopped, and dried in an oven at 80°C for 72 hours, then ground into an ultrafine powder using a mortar and pestle in liquid nitrogen. The preparation of the mixed mutton is shown in Table 1.

[0030] Table 1. Preparation ratio of mixed meat sheep

[0031]

[0032]

[0033] Example 2: Genomic DNA Extraction from Samples

[0034] Approximately 100 mg of powder from each mixed sample was placed in a 1.5 mL RNase-free / DNase-free centrifuge tube, and an appropriate amount of lysis buffer was added. The procedure was followed according to the instructions of the Blood / Tissue / Cell Genome Extraction Kit (DP304, Tiangen Biotech Co., Ltd.). The samples underwent proteinase K digestion, lysis, binding column adsorption, rinsing, and elution steps to obtain total DNA. The elution volume was 100 μL of nuclease-free water. The concentration and purity of the extracted DNA samples were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) (assessed using the A260 / A280 ratio). Based on the measurement results, the DNA was diluted to 10 ng / μL and stored at –80°C. Negative controls were included in all sample extraction processes to exclude contamination. Real-time fluorescence PCR amplification was performed immediately after DNA extraction or the samples were used within one week.

[0035] Example 3: Primer and probe design

[0036] According to GenBank, the following animals are listed: goat (Capra hircus, XM_005680968.3), sheep (Ovis ariesHM043737.1), buffalo (Bubalus bubalis, XM_006065800.4), cattle (Bos taurus, NM_001034034.2), yak (Bos grunniens, EU195062.1), pig (Sus scrofa, NM_001206359.1), horse (Equus caballus, NM_001163856.1), donkey (Equus asinus, XM_070494252.1), chicken (Gallus gallus, NM_204305.2), duck (Anas platyrhynchos, XM_038180584.2), and goose (Anser). DNA sequences of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from 12 species, including *Anser* (MG674174.1) and *Oryctolagus cuniculus* (NM_001082253.1), were obtained. Sequence alignment was performed using DNAMAN software. Primers and probes specific to sheep-derived components were designed in the hypervariable regions of the target gene, while universal internal control primers and probes capable of recognizing all 12 common animal-derived components were designed in the conserved regions. Through primer specificity verification experiments, a primer-probe combination specifically recognizing sheep-derived components (Ovis-F / R / P) and a control primer-probe combination capable of recognizing all 12 animal-derived components (Control-F / R / P) were finally obtained. Specific sequence information is shown in Table 2.

[0037] Table 2 Primer and probe sequences obtained from the experimental screening.

[0038]

[0039] Example 4: Fluorescent PCR reaction

[0040] Real-time fluorescence PCR reactions were performed on an ABI QuantStudio 7 system (Applied Biosystems, USA). Each 25 μL reaction volume contained: 12.5 μL 2× fluorescence PCR premix, 0.4 μmol / L target primers, 0.2 μmol / L target probe, 0.4 μmol / L internal control primers, 0.2 μmol / L internal control probe, 2 μL template DNA (approximately 10–100 ng), and RNase-free / DNase-free water to the final volume. All reactions were performed in 0.1 mL eight-tube PCR systems, with template-free negative controls (NTC) and positive controls included.

[0041] The PCR amplification program was set as follows: pre-denaturation at 95℃ for 5 minutes; followed by 40 cycles, each cycle consisting of 15 seconds of denaturation at 95℃ and 30 seconds of annealing / extension at 60℃. Fluorescence signals were acquired in real time during each annealing / extension stage. The FAM channel was used to detect the amplification of the target primer, and the VIC channel was used to detect the amplification of the internal control primer. A Ct value below 40 was considered a positive amplification, while no Ct value or a Ct value greater than 40 was considered a negative result. Each sample group was tested in triplicate.

[0042] Example 5: Primer specificity test

[0043] To evaluate the species specificity of the designed target primers and probes, muscle tissue samples were collected from 12 common livestock and poultry species, including goats, sheep, buffalo, cattle, yaks, pigs, horses, donkeys, chickens, ducks, geese, and rabbits, and DNA was extracted. Fluorescent PCR amplification reactions were performed using the genomic DNA of these species as templates to test the specificity of the primers and probes. A template-free control (NTC) was included in each amplification experiment to eliminate contamination interference, and all specificity tests were repeated three times.

[0044] Using extracted DNA as templates, real-time fluorescent PCR amplification was performed using primer and probe combinations of Ovis-F / R / P and Control-F / R / P, respectively, to verify their specificity. As shown in Figure 1, the Control-F / R / P primers and probes showed significant amplification signals in all 12 species, with stable Ct values, indicating that the primer combination has good broad-spectrum and universality (Figure 1a). In contrast, Ovis-F / R / P only produced significant amplification signals in goat and sheep samples, with no amplification observed in other species, indicating its strong species specificity (Figure 1b). These results further validate the effectiveness of the primer and probe screening and are suitable for subsequent specific detection of sheep-derived components.

[0045] Example 6: Sensitivity Test

[0046] Fresh mutton was used as a sample, and genomic DNA was extracted from the sample. The concentration of the genomic DNA was determined, and the concentration was adjusted to 100 ng / μL. Subsequently, the genomic DNA was serially diluted 10-fold to 100 ng / μL, 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, and 0.001 ng / μL, respectively. Using an optimized dual-reaction system, the diluted DNA solution was used as a template for detection to verify the sensitivity of the detection reaction.

[0047] The experimental results are shown in Figure 2. Ovis-F / R / P (Figure 2a) produced obvious amplification curves in all six concentration gradients, and the Ct value showed a regular delay as the template concentration decreased, with a detection limit as low as 0.001 ng / μL, indicating that this primer-probe set has good detection sensitivity. Control-F / R / P (Figure 2b) also successfully amplified in samples of each gradient, with stable signal intensity, showing good amplification efficiency and internal reference value. The above results verify that the sheep-derived specific primers and probes designed in this invention still have reliable amplification capabilities at low template concentrations, meeting the requirements for the detection of trace DNA samples and suitable for the identification and analysis of trace sheep-derived components in food.

[0048] Example 7: Establishment of a standard curve for quantitative detection using real-time PCR.

[0049] To evaluate the quantitative performance of the established real-time PCR method, a standard plasmid carrying both a sheep-derived target gene and a universal internal reference gene was serially diluted 10-fold to six copy number gradients (102). 12 101 0 10 8 10 6 10 4 10 2 (Copies / μL). Three parallel reactions were set up for each concentration, and the experiment was repeated five times. The average Ct value was used to plot the standard curve. (Using Log...) 10 Copy number was plotted on the x-axis, and Ct value on the y-axis to construct standard curves for the internal reference gene and the target gene, respectively. The regression equation for internal reference gene amplification was y = -3.3512x + 48.154, with a correlation coefficient R0. 2 =0.995, the PCR amplification efficiency was 98.79% (Figure 3a); the regression equation for sheep-derived target gene amplification was y = -3.4226x + 49.402, and the correlation coefficient R was 0.995. 2 =0.9996, with an amplification efficiency of 95.21% (Figure 3b). Both standard curves showed a good linear relationship (R² = 0.9996). 2The high amplification efficiency (E>95%) and the high quantitative fluorescence PCR system indicate that the established system has excellent quantitative ability and detection sensitivity, and is suitable for the accurate quantitative detection of sheep-derived components in food.

[0050] Example 8: Copy number ratio of target sequence to internal reference sequence in different body parts of sheep

[0051] To verify the applicability of the quantitative real-time PCR standard curve in actual samples, 50 mg of different parts of sheep tissue (including sheep leg, sheep neck meat, sheep chops, sheep scorpion, and sheep fat) were weighed, and genomic DNA was extracted. Dual real-time PCR was used to simultaneously amplify the sheep-derived target gene and the universal internal reference gene. The copy number of each gene was calculated according to the standard curve established in Example 7, and the copy number ratio of the target gene to the internal reference gene was further calculated. The results are shown in Table 3. The results showed that the copy number ratio of the sheep-derived target gene to the internal reference gene remained within the range of 1.00 ± 0.05 in samples from different tissue sources, indicating that this method has good amplification consistency and quantitative stability in samples from different tissue sources, demonstrating that the established standard curve has good applicability and accuracy.

[0052] Table 3. Copy number ratio of internal reference sequence to target sequence in different parts of sheep.

[0053] Different parts of a sheep Internal parameter copy number Sheep copy number Copy number ratio leg of lamb 5655024 5891581 1.04 Lamb neck meat 2561339 2431353 0.97 Lamb chops 2903653 2781440 0.96 Lamb spine 2919730 2888207 0.99 mutton fat 3350443 3699514 1.13

[0054] Example 9: Quantitative Analysis and Detection of Simulated Samples

[0055] To further verify the effectiveness of the quantitative detection method for sheep-derived components established in this invention, artificial sheep / pig mixed simulated samples with different mass percentages (10%–90%) were prepared (see Table 1). The method was applied to detect and analyze the sheep-derived components in each mixed sample. The results showed that as the proportion of sheep-derived components increased, the Ct value of the target gene (sheep Ct) gradually decreased, while the Ct value of the internal reference gene remained basically stable. Through standard curve conversion, the measured sheep-derived component content was highly consistent with the theoretical addition ratio, and the relative standard deviation (RSD) of the relevant samples was less than 5%, demonstrating good repeatability and precision. In summary, the results indicate that this quantitative detection method possesses good accuracy and stability and is suitable for the accurate quantitative analysis of sheep-derived components in actual samples.

[0056] Table 4. Quantitative detection results of sheep / pig mixed simulated samples with different mass percentages.

[0057]

[0058] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0059] The above description is a further detailed explanation of the present invention in conjunction with specific preferred embodiments. It should not be considered that the specific embodiments of the present invention are limited to this. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection of the present invention as defined by the submitted claims.

Claims

1. A primer and probe set for detecting sheep-derived components based on dual real-time fluorescence PCR, characterized in that: The primer and probe set includes a first set of primers and probes and a second set of primers and probes. The first and second sets of primers and probes target the GAPDH gene. The first set of primers and probes are sheep-specific primers and probes that target its hypervariable region, and the second set of primers and probes are internal reference primers and probes that target its conserved region and can recognize multiple animal-derived components.

2. The primer and probe set as described in claim 1, characterized in that: The sequences of the first set of primers and probes are as follows: F:CACTGAGGACCAGGTTGTCT; R: CCCAGCATCGAAGGTAGAAGA; P: FAM-CCTGCGACTTCAACAGCGACACT-BHQ1.

3. The primer and probe set as described in claim 1 or 2, characterized in that: The sequences of the second set of primers and probes are as follows: F: CGACCACTTTGTCAAGCTCA; R: TACTCCTTGGAGGCCATGTG; P: VIC-CCACCACCCTTGTTGCTGTAGCCG-BHQ2.

4. A method for detecting sheep-derived components based on dual real-time fluorescence PCR, characterized in that: Using the sample genomic DNA as a template, dual real-time fluorescence PCR detection was performed using the primer and probe sets as described in any one of claims 1-3.

5. A reagent kit for detecting sheep-derived components based on dual real-time fluorescence PCR, characterized in that: The kit contains a set of primers and probes as described in any one of claims 1-3.

6. The use of the primer and probe set as described in any one of claims 1-3 or the detection kit as described in claim 5 in detecting sheep-derived components in a sample, characterized in that: The detection process includes: using the sample genomic DNA as a template, performing dual real-time fluorescence PCR detection using the primer and probe set or detection kit; wherein, if the copy number ratio of the sheep-derived target gene to the internal reference gene is within the range of 1.00±0.05, it is preliminarily determined that no other meat is mixed in; otherwise, it is preliminarily determined that non-sheep-derived animal meat is included.

7. The use as described in claim 6, characterized in that: The non-sheep-derived animal meat that was adulterated was pork.

Images