SNP marker combination, KASP primer combination and kit for identifying zoysia japonica variety and application of SNP marker combination, KASP primer combination and kit
By developing a technique involving 30 SNP loci and KASP primer combinations, the problem of identifying Zoysia japonica varieties has been solved, enabling efficient and accurate genotyping and DNA fingerprinting, which supports variety management and protection.
Patent Information
- Application Number
- CN202511409863.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2025-11-14
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify the genetic background and kinship of Zoysia japonica varieties, leading to confusion about variety identity and origin, which affects variety management and breeding work.
A marker combination comprising 30 SNP sites and a corresponding KASP primer combination was developed for genotyping and DNA fingerprinting of Zoysia japonica varieties using competitive allele-specific PCR technology. Combined with the highly specific KASP primer combination and kit, efficient and accurate genotyping detection was achieved.
It enables effective SNP genotyping of Zoysia japonica varieties, accurately analyzes genetic background and kinship, supports variety identification and protection, and provides scientific basis.
Smart Images

Figure CN120945113A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, and in particular relates to an SNP marker combination, KASP primer combination, kit, and application for identifying Zoysia japonica varieties. Background Technology
[0002] Zoysia willd. has high value for turf applications and is widely used in urban green spaces, sports field lawns, road and embankment slope protection, airport green spaces, and ornamental lawns. In recent years, with the expansion of Zoysia willd.'s application, its introduction and breeding have received increasing attention, resulting in a rapid increase in the number of new varieties and a gradual narrowing of phenotypic differences between varieties. However, Zoysia willd. varieties are frequently exchanged internationally and regionally, and are difficult to quickly identify based on phenotypic characteristics, leading to confusion regarding variety identity and origin. Single nucleotide polymorphism (SNP) markers are molecular markers recommended by the International Union for the Protection of New Varieties of Plants (IUPAC). Competitive allele-specific PCR (KASP) technology can efficiently detect the genotype of SNP loci, offering advantages such as high throughput, high accuracy, and low cost. Therefore, screening suitable SNP marker combinations to develop KASP primer combinations with strong specificity and good polymorphism, and using them to detect the genetic background and phylogenetic relationships of Zoysia japonica varieties and construct DNA fingerprint maps, can not only help to objectively and comprehensively understand the current status of Zoysia japonica variety identity and application, but also provide technical support for the effective management of variety use, guidance of variety breeding, and strengthening of variety rights protection. Summary of the Invention
[0003] In view of this, the purpose of this invention is to provide an SNP marker combination for identifying Zoysia japonica varieties, which can be used to analyze the genetic background and phylogenetic relationships of Zoysia japonica varieties.
[0004] Another object of the present invention is to provide a KASP primer combination for detecting the SNP marker combination.
[0005] Another object of the present invention is to provide a kit for detecting the SNP marker combination.
[0006] Another object of the present invention is to provide an application of the SNP marker combination, the KASP primer combination, or the kit.
[0007] Another objective of this invention is to provide a method for SNP genotyping of Zoysia japonica varieties.
[0008] Another objective of this invention is to provide a method for constructing a DNA fingerprint of Zoysia japonica varieties.
[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0010] This invention provides a combination of SNP markers for identifying Zoysia japonica varieties. The combination of SNP markers includes 30 preferred SNP sites located on the Z. japonica 'Nagirizaki' reference genome ZJN_r1.1. The location information of the SNP sites is shown in the table below.
[0011] SNP number Scaffold physical location Reference genotype variant genotype SNP number Scaffold physical location Reference genotype variant genotype SNP1 Zjnsc000011.1 85609 T C SNP46 Zjnsc000073.1 695850 G A SNP7 Zjn_sc000017.1 1641088 A G SNP47 Zjn_sc000074.1 523300 A G SNP8 Zjn_sc000019.1 1292979 A G SNP53 Zjn_sc000082.1 254419 G A SNP19 Zjn_sc000034.1 610678 C T SNP56 Zjnsc000088.1 869232 C T SNP25 Zjn_sc000042.1 149423 T C SNP57 Zjn_sc000090.1 61520 C A SNP28 Zjn_sc000045.1 384193 T C SNP60 Zjnsc00013.1 1769664 G A SNP30 Zjnsc000051.1 39892 A G SNP62 Zjnsc00015.1 4091823 A G SNP32 Zjn_sc000054.1 126708 C T SNP65 Zjn_sc00020.1 3526811 C T SNP33 Zjn_sc000055.1 633329 T C SNP66 Zjn_sc00023.1 3011617 G T SNP35 Zjn_sc000057.1 1587860 A C SNP67 Zjn_sc00025.1 2611823 C A SNP38 Zjn_sc000061.1 832721 T C SNP71 Zjn_sc00052.1 1557672 G A SNP39 Zjn_sc000063.1 571049 G C SNP76 Zjn_sc00004.1 1788693 C A SNP41 Zjn_sc000066.1 188747 G A SNP80 Zjn_sc00008.1 488323 G A SNP42 Zjn_sc000067.1 216106 T C SNP81 Zjn_sc00009.1 270090 A G SNP44 Zjn_sc000069.1 140547 T G SNP82 Zjn_sc00010.1 268391 A C
[0012] The present invention also provides a KASP primer set for detecting the SNP marker combination, wherein a set of KASP primers for detecting the corresponding SNP site is set for each SNP site, forming a KASP primer set; the KASP primer set includes two forward primers and one reverse primer, or one forward primer and two reverse primers.
[0013] Preferably, the KASP primer combination includes the primer sequences shown in SEQ ID NO.1 to SEQ ID NO.90.
[0014] Preferably, the 5' end of the forward primer is connected to a fluorescent group.
[0015] Preferably, the KASP primer set includes two forward primers, and the 5' ends of the two forward primers are connected to different fluorescent groups.
[0016] The present invention also provides a kit for detecting the SNP marker combination, the kit comprising the KASP primer combination.
[0017] The present invention also provides an application of the SNP marker combination, the KASP primer combination, or the kit in any of the following:
[0018] (1) SNP genotyping of Zoysia japonica varieties; (2) Analysis of genetic background and kinship of Zoysia japonica varieties; (3) Construction of DNA fingerprinting of Zoysia japonica varieties; (4) Identification of Zoysia japonica varieties; (5) Protection of Zoysia japonica variety rights.
[0019] This invention also provides a method for SNP genotyping of Zoysia japonica varieties, comprising the following steps: extracting genomic DNA from the Zoysia japonica sample to be tested; using the genomic DNA as a template, performing PCR amplification using the KASP primer combination or the kit; detecting the fluorescence signal of the PCR amplification product, and obtaining the genotype of the Zoysia japonica sample at the corresponding SNP locus based on the value of the fluorescence signal.
[0020] Preferably, the PCR amplification reaction system, in 5 μL, comprises the following components: 2.5 μL of 2×KASP master mix, 1.25 μL of the KASP primer set, and 1.25 μL of genomic DNA.
[0021] Preferably, the PCR amplification reaction program includes: initial denaturation at 95°C for 10 min; 10 descending cycles, each cycle consisting of denaturation at 95°C for 20 s and annealing for 60 s, with an annealing starting temperature of 61°C, decreasing by 0.6°C per cycle, and decreasing to 55°C after 10 cycles; 27 standard cycles, each cycle consisting of denaturation at 95°C for 20 s and annealing at 55°C for 60 s; and holding at 25°C for 30 s to read the final fluorescence signal.
[0022] This invention also provides a method for constructing a DNA fingerprint map of a Zoysia japonica variety, comprising the following steps: using the method for SNP genotyping of Zoysia japonica varieties to obtain the genotype of the Zoysia japonica sample at the corresponding SNP locus; and constructing a DNA fingerprint map of the Zoysia japonica variety using the corresponding genotype combinations.
[0023] The beneficial effects of this invention are:
[0024] This invention provides a SNP marker combination for identifying Zoysia japonica varieties. Using this SNP marker combination, effective SNP genotyping of Zoysia japonica varieties can be performed, enabling the detection of genetic background and phylogenetic relationships, and providing a scientific basis for variety identification and protection. This invention also provides a highly specific and polymorphic KASP primer combination for SNP genotyping of Zoysia japonica varieties, which can be used to develop SNP detection kits for Zoysia japonica varieties and provide technical support for constructing DNA fingerprint profiles of Zoysia japonica varieties. Attached Figure Description
[0025] Figure 1 This is an example diagram illustrating the typing effect of the KASP primer group developed based on 30 SNP sites in Example 1;
[0026] Figure 2 This refers to the optimal cluster number for 46 representative Zoysia japonica materials analyzed based on 30 SNP markers in Example 2;
[0027] Figure 3 The population structure of 46 Zoysia japonica materials was analyzed based on 30 SNP markers in Example 2;
[0028] Figure 4 This is a phylogenetic tree for 46 Zoysia japonica materials constructed based on 30 SNP markers in Example 2;
[0029] Figure 5Principal component analysis (PCA) was performed on 46 Zoysia japonica samples based on 30 SNP markers in Example 2.
[0030] Figure 6 In Example 3, DNA fingerprints of 19 Zoysia japonica varieties were constructed based on 30 SNP markers. Detailed Implementation
[0031] This invention provides a SNP marker combination for identifying Zoysia japonica varieties, the SNP marker combination comprising 30 SNP loci located in the Z. japonica 'Nagirizaki' reference genome ZJN_r1.1; the location information of the SNP loci is shown in the table below;
[0032] SNP number Scaffold physical location Reference genotype variant genotype SNP number Scaffold physical location Reference genotype variant genotype SNP1 Zjn_sc000011.1 85609 T C SNP46 Zjn_sc000073.1 695850 G A SNP7 Zjn_sc000017.1 1641088 A G SNP47 Zjn_sc000074.1 523300 A G SNP8 Zjn_sc000019.1 1292979 A G SNP53 Zjn_sc000082.1 254419 G A SNP19 Zjn_sc000034.1 610678 C T SNP56 Zjn_sc000088.1 869232 C T SNP25 Zjn_sc000042.1 149423 T C SNP57 Zjn_sc000090.1 61520 C A SNP28 Zjn_sc000045.1 384193 T C SNP60 Zjn_sc00013.1 1769664 G A SNP30 Zjn_sc000051.1 39892 A G SNP62 Zjn_sc00015.1 4091823 A G SNP32 Zjn_sc000054.1 126708 C T SNP65 Zjn_sc00020.1 3526811 C T SNP33 Zjn_sc000055.1 633329 T C SNP66 Zjn_sc00023.1 3011617 G T SNP35 Zjn_sc000057.1 1587860 A C SNP67 Zjn_sc00025.1 2611823 C A SNP38 Zjn_sc000061.1 832721 T C SNP71 Zjn_sc00052.1 1557672 G A SNP39 Zjn_sc000063.1 571049 G C SNP76 Zjn_sc00004.1 1788693 C A SNP41 Zjn_sc000066.1 188747 G A SNP80 Zjn_sc00008.1 488323 G A SNP42 Zjnsc000067.1 216106 T C SNP81 Zjnsc00009.1 270090 A G SNP44 Zjnsc000069.1 140547 T G SNP82 Zjn_sc00010.1 268391 A C
[0033] The present invention also provides a KASP primer set for detecting the SNP marker combination, wherein a set of KASP primers for detecting the corresponding SNP site is set for each SNP site, forming a KASP primer set; the KASP primer set includes two forward primers and one reverse primer, or one forward primer and two reverse primers.
[0034] In this invention, the preferred design parameters of the KASP primer set include: GC content of 20% to 70%; melting temperature (Tm) of 58℃ to 64℃; and PCR product size of no more than 250bp.
[0035] In some embodiments of the present invention, the KASP primer combination preferably includes the primer sequences shown in SEQ ID NO.1 to SEQ ID NO.90. The primer set for detecting SNP1 includes two forward primers shown in SEQ ID NO.1 to SEQ ID NO.2 and a reverse primer shown in SEQ ID NO.3; the primer set for detecting SNP7 includes two forward primers shown in SEQ ID NO.4 to SEQ ID NO.5 and a reverse primer shown in SEQ ID NO.6; the primer set for detecting SNP8 includes a forward primer shown in SEQ ID NO.7 and two reverse primers shown in SEQ ID NO.8 to SEQ ID NO.9; the primer set for detecting SNP19 includes a forward primer shown in SEQ ID NO.10 and two reverse primers shown in SEQ ID NO.11 to SEQ ID NO.12; the primer set for detecting SNP25 includes two forward primers shown in SEQ ID NO.13 to SEQ ID NO.14 and a reverse primer shown in SEQ ID NO.15; and the primer set for detecting SNP28 includes two forward primers shown in SEQ ID NO.16 to SEQ ID NO.17 and a reverse primer shown in SEQ ID NO.14. The primer set for detecting SNP30 includes the reverse primer shown in SEQ ID NO. 18; the primer set for detecting SNP30 includes the two forward primers shown in SEQ ID NO. 19–SEQ ID NO. 20 and the reverse primer shown in SEQ ID NO. 21; the primer set for detecting SNP32 includes the two forward primers shown in SEQ ID NO. 22–SEQ ID NO. 23 and the reverse primer shown in SEQ ID NO. 24; the primer set for detecting SNP33 includes the two forward primers shown in SEQ ID NO. 25–SEQ ID NO. 26 and the reverse primer shown in SEQ ID NO. 27; the primer set for detecting SNP35 includes the two forward primers shown in SEQ ID NO. 28–SEQ ID NO. 29 and the reverse primer shown in SEQ ID NO. 30; the primer set for detecting SNP38 includes the two forward primers shown in SEQ ID NO. 31–SEQ ID NO. 32 and the reverse primer shown in SEQ ID NO. 33; the primer set for detecting SNP39 includes the primers shown in SEQ ID NO. 34–SEQ ID NO. 29. The primer set for detecting SNP41 includes the two forward primers shown in SEQ ID NO. 35 and the reverse primer shown in SEQ ID NO. 36; the primer set for detecting SNP41 includes the forward primer shown in SEQ ID NO. 37 and the two reverse primers shown in SEQ ID NO. 38 to SEQ ID NO. 39; the primer set for detecting SNP42 includes SEQ ID NO. 40 to SEQ ID NO. 39.The primer set for detecting SNP44 includes the two forward primers shown in SEQ ID NO. 41 and the reverse primer shown in SEQ ID NO. 42; the primer set for detecting SNP44 includes the forward primer shown in SEQ ID NO. 43 and the two reverse primers shown in SEQ ID NO. 44 to SEQ ID NO. 45; the primer set for detecting SNP46 includes the two forward primers shown in SEQ ID NO. 46 to SEQ ID NO. 47 and the reverse primer shown in SEQ ID NO. 48; the primer set for detecting SNP47 includes the two forward primers shown in SEQ ID NO. 49 to SEQ ID NO. 50 and the reverse primer shown in SEQ ID NO. 51; the primer set for detecting SNP53 includes the two forward primers shown in SEQ ID NO. 52 to SEQ ID NO. 53 and the reverse primer shown in SEQ ID NO. 54; the primer set for detecting SNP56 includes the two forward primers shown in SEQ ID NO. 55 to SEQ ID NO. 56 and the reverse primer shown in SEQ ID NO. 57; the primer set for detecting SNP57 includes SEQ ID NO. 41 and the reverse primer shown in SEQ ID NO. 42. The primer set for detecting SNP60 includes two forward primers shown in SEQ ID NO. 58 to SEQ ID NO. 69 and a reverse primer shown in SEQ ID NO. 60; the primer set for detecting SNP60 includes two forward primers shown in SEQ ID NO. 61 to SEQ ID NO. 62 and a reverse primer shown in SEQ ID NO. 63; the primer set for detecting SNP62 includes two forward primers shown in SEQ ID NO. 64 to SEQ ID NO. 65 and a reverse primer shown in SEQ ID NO. 66; the primer set for detecting SNP65 includes two forward primers shown in SEQ ID NO. 67 to SEQ ID NO. 68 and a reverse primer shown in SEQ ID NO. 69; the primer set for detecting SNP66 includes a forward primer shown in SEQ ID NO. 70 and two reverse primers shown in SEQ ID NO. 71 to SEQ ID NO. 72; the primer set for detecting SNP67 includes two forward primers shown in SEQ ID NO. 73 to SEQ ID NO. 74 and a reverse primer shown in SEQ ID NO. 69. The primer set for detecting SNP71 includes the two forward primers shown in SEQ ID NO.76 to SEQ ID NO.77 and the reverse primer shown in SEQ ID NO.78; the primer set for detecting SNP76 includes the two forward primers shown in SEQ ID NO.79 to SEQ ID NO.80 and the reverse primer shown in SEQ ID NO.81; the primer set for detecting SNP80 includes the two forward primers shown in SEQ ID NO.82 to SEQ ID NO.83 and the reverse primer shown in SEQ ID NO.75.The primer set for detecting SNP81 includes the two forward primers shown in SEQ ID NO. 85–SEQ ID NO. 86 and the reverse primer shown in SEQ ID NO. 87; the primer set for detecting SNP82 includes the two forward primers shown in SEQ ID NO. 88–SEQ ID NO. 89 and the reverse primer shown in SEQ ID NO. 90.
[0036] In this invention, the 5' end of the forward primer is preferably connected to a fluorescent group; in some embodiments, if the KASP primer set includes two forward primers, the 5' ends of the two forward primers are preferably connected to different fluorescent groups. The type of fluorescent group can be conventionally selected according to actual needs, including but not limited to FAM fluorescent groups or HEX fluorescent groups; the sequence of the FAM fluorescent group is preferably GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 91); the sequence of the HEX fluorescent group is preferably GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 92).
[0037] This invention provides a highly specific and polymorphic KASP primer combination for SNP genotyping of Zoysia japonica varieties, which can be used to develop SNP detection kits for Zoysia japonica varieties and provide technical support for the construction of DNA fingerprint profiles of Zoysia japonica varieties.
[0038] The present invention also provides a kit for detecting the SNP marker combination, the kit comprising the KASP primer combination.
[0039] The present invention also provides an application of the SNP marker combination, the KASP primer combination, or the kit in any of the following:
[0040] (1) SNP genotyping of Zoysia japonica varieties; (2) Analysis of genetic background and kinship of Zoysia japonica varieties; (3) Construction of DNA fingerprinting of Zoysia japonica varieties; (4) Identification of Zoysia japonica varieties; (5) Protection of Zoysia japonica variety rights.
[0041] This invention also provides a method for SNP genotyping of Zoysia japonica varieties, preferably comprising the following steps: extracting genomic DNA from the Zoysia japonica sample to be tested; using the genomic DNA as a template, performing PCR amplification using the KASP primer combination or the kit; detecting the fluorescence signal of the PCR amplification product, and obtaining the genotype of the Zoysia japonica sample at the corresponding SNP locus based on the value of the fluorescence signal.
[0042] In this invention, the method for extracting genomic DNA from the Zoysia japonica sample to be tested is not particularly limited and can be conventionally selected according to actual needs.
[0043] In this invention, the PCR amplification reaction system can be conventionally selected according to actual needs. In some embodiments, the reaction system, in 5 μL increments, preferably comprises the following components: 2.5 μL of 2×KASP mastermix, 1.25 μL of the KASP primer set, and 1.25 μL of genomic DNA. The concentration of each primer in the KASP primer set is preferably 10 μM; the concentration of the genomic DNA is preferably 20–30 ng / μL.
[0044] In this invention, the PCR amplification reaction program can be conventionally selected according to actual needs. In some embodiments, the reaction program preferably includes: initial denaturation at 95°C for 10 min; 10 falling-point cycles, each cycle consisting of 20 s of denaturation at 95°C and 60 s of annealing, with an annealing starting temperature of 61°C, decreasing by 0.6°C per cycle, and then decreasing to 55°C after 10 cycles; 27 standard cycles, each cycle consisting of 20 s of denaturation at 95°C and 60 s of annealing at 55°C; and holding at 25°C for 30 s to read the final fluorescence signal. In some embodiments, if the fluorescence signal is low and the clustering is scattered after 27 cycles, affecting data analysis, additional cycles can be added, with the program being 20 s of denaturation at 95°C and 60 s of annealing at 55°C, for 3 cycles; if NTC is not amplified, up to 4 additional cycles can be performed.
[0045] This invention also provides a method for constructing a DNA fingerprint map of a Zoysia japonica variety, comprising the following steps: using the method for SNP genotyping of Zoysia japonica varieties to obtain the genotype of the Zoysia japonica sample at the corresponding SNP locus; and constructing a DNA fingerprint map of the Zoysia japonica variety using the corresponding genotype combinations.
[0046] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0047] Unless otherwise specified, the following embodiments are all conventional methods.
[0048] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0049] Example 1
[0050] 1. Test materials: 46 representative materials of Zoysia japonica were deposited at the Institute of Botany, Chinese Academy of Sciences (Nanjing Zhongshan Botanical Garden) in Jiangsu Province. Specific information is shown in Table 1.
[0051] Table 146 Representative Materials of Zoysia japonica
[0052]
[0053] 2. Screening of candidate SNP sites
[0054] Based on the SLAF simplified genome sequencing results of 206 Zoysia japonica germplasm resources, candidate SNP sites were screened using vcftools software according to the following filtering criteria: high marker quality, strong representativeness, high material discrimination of markers (combinations), uniform distribution on the genome, and strong specificity.
[0055] Parameter settings: 1. Remove SNPs with a quality value less than 30; 2. Remove SNPs with an average SNP depth less than 5; 3. Remove SNPs with a detection rate <0.8 (i.e., the site is detected in at least 80% of the samples); 4. Remove SNPs with a secondary genotype frequency less than 0.2 (MAF <0.2); 5. There should be no other site mutations within 100 bp before and after the candidate SNP.
[0056] Based on the above conditions, candidate SNP sites were screened for representative materials of Zoysia japonica. KASP primers were designed based on uniformly distributed SNP sites selected according to the physical location of scaffolds. The genotypes of the 46 samples were detected using 30 sets of KASP primers with good genotyping results. DNA was extracted from the samples using the CTAB method. The obtained DNA stock solution was diluted to 20-30 ng / μL, and the DNA concentration and quality of the samples were detected using a microplate reader and agarose gel electrophoresis. The stock solution was stored at -20℃.
[0057] 3. KASP primer design and synthesis
[0058] Two allele-specific primers and one universal primer were designed based on the genomic sequences 100 bp upstream and downstream of the candidate SNP sites. The KASP primer design parameters were set as follows: GC content 20%–70%; melting temperature (Tm) 58℃–64℃; PCR product size no larger than 250 bp. The primers were synthesized by Universal Biotech (Anhui) Co., Ltd., and universal fluorescent tags were added to the 5' end of the primers: F1 (FAM): GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 91); F2 (VIC): GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 92).
[0059] Table 230 KASP primer sequence information
[0060]
[0061] 4. PCR amplification and genotyping detection
[0062] KASP assays were performed in a 5 μL PCR system, which included 2.5 μL of 2×KASP mastermix, 1.25 μL of KASP primer set (each primer had a concentration of 10 μM), and 1.25 μL of genomic DNA.
[0063] The PCR program is as follows: initial denaturation at 95℃ for 10 min; 10 descending cycles, each cycle consisting of 20 s of denaturation at 95℃ and 60 s of annealing, with an initial annealing temperature of 61℃, decreasing by 0.6℃ each cycle, and then decreasing to 55℃ after 10 cycles; 27 standard cycles, each cycle consisting of 20 s of denaturation at 95℃ and 60 s of annealing at 55℃; and a hold at 25℃ for 30 s. If the fluorescence signal is low and the clusters are scattered after 27 cycles, affecting data analysis, additional cycles can be added, with a program of 20 s of denaturation at 95℃ and 60 s of annealing at 55℃, for 3 cycles. If NTCs are not amplified, a maximum of 4 additional cycles can be performed, and the results are as follows. Figure 1 As shown.
[0064] Figure 1 The blue square in the upper left corner and the orange circle in the lower right corner indicate that these materials have two different homozygous genotypes at this SNP site, while the green triangle in the middle represents heterozygous genotypes. As can be seen from the example figure, the above 30 pairs of KASP primers can effectively distinguish the genotypes of the tested materials.
[0065] Example 2
[0066] 1. Genetic diversity analysis was performed on 46 representative Zoysia japonica materials using 30 sets of KASP primers from Example 1. Genotyping data were analyzed using Excel 2021 software, and information such as expected heterozygosity (Ho), expected heterozygosity (He), polymorphism index (PIC), gene number (Ae), and Shannon diversity index (I) were statistically analyzed using PolyGene V1.7 software. These data can be used to evaluate the polymorphism and resolution of KASP primers. The results are shown in Table 3.
[0067] Table 346 Genetic diversity analysis of representative materials from Zoysia japonica
[0068] SNP Ho He PIC Ae I SNP Ho He PIC Ae I SNP1 0.413 0.471 0.360 1.892 0.664 SNP46 0.341 0.425 0.335 1.740 0.617 SNP7 0.467 0.496 0.373 1.984 0.689 SNP47 0.522 0.485 0.367 1.941 0.678 SNP8 0.205 0.487 0.369 1.951 0.680 SNP53 0.522 0.500 0.375 2.000 0.693 SNP19 0.500 0.460 0.354 1.852 0.653 SNP56 0.130 0.315 0.265 1.459 0.494 SNP25 0.089 0.494 0.372 1.976 0.687 SNP57 0.587 0.471 0.360 1.892 0.664 SNP28 0.422 0.484 0.367 1.939 0.677 SNP60 0.568 0.500 0.375 1.999 0.693 SNP30 0.511 0.475 0.362 1.906 0.668 SNP62 0.111 0.484 0.367 1.939 0.677 SNP32 0.341 0.469 0.359 1.882 0.662 SNP65 0.622 0.500 0.375 1.999 0.693 SNP33 0.267 0.488 0.369 1.953 0.681 SNP66 0.391 0.440 0.343 1.784 0.631 SNP35 0.304 0.364 0.298 1.572 0.550 SNP67 0.578 0.500 0.375 1.999 0.693 SNP38 0.333 0.401 0.321 1.670 0.591 SNP71 0.133 0.498 0.374 1.991 0.691 SNP39 0.304 0.466 0.357 1.873 0.659 SNP76 0.565 0.496 0.373 1.985 0.689 SNP41 0.304 0.466 0.357 1.873 0.659 SNP80 0.558 0.498 0.374 1.990 0.691 SNP42 0.304 0.386 0.311 1.628 0.574 SNP81 0.444 0.494 0.372 1.976 0.687 SNP44 0.372 0.422 0.333 1.730 0.613 SNP82 0.326 0.447 0.347 1.808 0.639
[0069] As can be seen from the results in Table 3, the 30 SNP loci obtained by screening in this invention are basically moderately polymorphic (0.25 < PIC < 0.5) or highly polymorphic (PIC > 0.5), which can effectively distinguish the genotypic differences between representative materials.
[0070] 2. STRUCTURE 2.3.4 was used to determine the optimal number of clusters for 46 representative Zoysia japonica accessions. The parameters were set as follows: aging period of 10,000, MCMC repetitions of 100,000, the optimal number of clusters (K) was determined using the ΔK method (ΔK: 2-10), and the number of iterations was 15. After running the software, the result file with the suffix "_f" was compressed and uploaded to the online website "STRUCTUREHARVESTER". The results are as follows: Figures 2-3 As shown.
[0071] Depend on Figures 2-3 The results show that there is a maximum value when K=3, indicating that the 46 tested materials are divided into 3 groups.
[0072] 3. UPGMA and PCA correlation analysis were performed using PolyGene V1.7, and the online website ChiPlot was used for UPGMA and PCA enhancement. The results are as follows: Figures 4-5 As shown.
[0073] Figures 4-5 The results further proved that the 46 tested materials were divided into 3 groups.
[0074] Example 3
[0075] The above 30 sets of KASP primers were used to perform SNP genotyping on 19 Zoysia japonica varieties and DNA fingerprinting was constructed. The information of the 19 Zoysia japonica varieties is shown in Table 4.
[0076] Table 419 Information on Zoysia japonica Varieties
[0077]
[0078] Genotypes detected at 30 preferred SNP loci were converted to letter codes. Homozygous genotypes were represented by AA = red, TT = green, CC = purple, and GG = blue; heterozygous genotypes were represented by yellow; and undetectable genotypes were converted from NA to the sixth type and represented by gray. DNA fingerprinting of the tested varieties was plotted using R software. Figure 6 Each row represents a sample, and each column represents a SNP marker, which can be used for the identification of Zoysia japonica varieties.
[0079] As demonstrated by the above embodiments, the 30 preferred SNP marker combinations provided by this invention can accurately perform SNP genotyping on Zoysia japonica varieties, which can be used for the analysis of the genetic background and phylogenetic relationships of Zoysia japonica varieties. The application of this set of SNP marker combinations to construct DNA fingerprint profiles for 19 Zoysia japonica varieties can provide a scientific basis for the identification of Zoysia japonica varieties and the protection of variety rights.
[0080] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A SNP marker combination for identifying Zoysia japonica varieties, characterized in that, The SNP marker combination includes 30 SNP sites located in the Zoysiajaponica 'Nagirizaki' reference genome ZJN_r1.1; the location information of the SNP sites is shown in the table below; 2. A KASP primer combination for detecting the SNP marker combination of claim 1, characterized in that, Each SNP site corresponds to a set of KASP primers for detecting the corresponding SNP site, forming a KASP primer set; the KASP primer set includes two forward primers and one reverse primer, or one forward primer and two reverse primers.
3. The KASP primer combination according to claim 2, characterized in that, The KASP primer combination includes the primers shown in SEQ ID NO.1 to SEQ ID NO.
90.
4. The KASP primer combination according to claim 2, characterized in that, The 5' end of the forward primer is connected to a fluorescent group; if the KASP primer set includes two forward primers, the 5' ends of the two forward primers are connected to different fluorescent groups.
5. A kit for detecting the SNP marker combination of claim 1, characterized in that, The kit contains the KASP primer combination as described in any one of claims 2 to 4.
6. The use of the SNP marker combination of claim 1, the KASP primer combination of any one of claims 2 to 4, or the kit of claim 5 in any of the following: (1) SNP genotyping of Zoysia japonica varieties; (2) Analysis of the genetic background and phylogenetic relationships of Zoysia japonica varieties; (3) Construction of DNA fingerprinting profiles for Zoysia japonica varieties; (4) Identification of Zoysia japonica varieties; (5) Protection of Zoysia japonica variety rights.
7. A method for SNP genotyping of Zoysia japonica varieties, characterized in that, The procedure includes the following steps: extracting genomic DNA from the Zoysia japonica sample to be tested; using the genomic DNA as a template, performing PCR amplification using the KASP primer combination described in any one of claims 2 to 4 or the kit described in claim 5; detecting the fluorescence signal of the PCR amplification product, and obtaining the genotype of the Zoysia japonica sample at the corresponding SNP site based on the value of the fluorescence signal.
8. The method according to claim 7, characterized in that, The PCR amplification reaction system, in 5 μL units, comprises the following components: 2×KASP mastermix 2.5 μL, KASP primer set as described in any one of claims 2 to 4 1.25 μL, and genomic DNA 1.25 μL.
9. The method according to claim 7, characterized in that, The PCR amplification reaction program includes: initial denaturation at 95°C for 10 min; 10 descending cycles, each cycle consisting of denaturation at 95°C for 20 s and annealing for 60 s, with an annealing starting temperature of 61°C, decreasing by 0.6°C per cycle, and then decreasing to 55°C after 10 cycles; 27 standard cycles, each cycle consisting of denaturation at 95°C for 20 s and annealing at 55°C for 60 s; and holding at 25°C for 30 s to read the final fluorescence signal.
10. A method for constructing a DNA fingerprint of a Zoysia japonica variety, characterized in that, The method includes the following steps: using the method described in any one of claims 7 to 9, obtaining the genotype of the Zoysia japonica sample at the corresponding SNP locus; and constructing a DNA fingerprint map of Zoysia japonica varieties using the corresponding genotype combinations.
Citation Information
Patent Citations
Molecular marking method for identifying variety of Suzhi No.1 hybrid zoysia
CN103602742A
Construction method of zoysia japonica AFLP molecular fingerprint spectrum library and application of construction method
CN112080575A
SSR marker primer developed based on zoysia japonica genomic sequence and application of SSR marker primer
CN118792436A
Construction method and application of zoysia japonica germplasm resource fingerprint spectrum
CN119859698A
Zoysia japonica SNP (Single Nucleotide Polymorphism) molecular marker combination, SNP fingerprint sequence, DNA (Deoxyribose Nucleic Acid) fingerprint spectrum and application thereof
CN121160910A