Functional molecular marker of wheat tall1-3b gene and application thereof
By developing functional molecular markers for the wheat TaUFD1-3B gene and using KASP marker technology to detect variations at SNP 40, the problem of predicting wheat flag leaf length and thousand-grain weight was solved, enabling efficient breeding and the construction of high-yield new wheat varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-13
- Publication Date
- 2026-03-24
AI Technical Summary
The effects of natural variations in the wheat TaUFD1-3B gene on wheat flag leaf length and thousand-grain weight, as well as related molecular markers, have not been reported, thus affecting the breeding process for high and stable wheat yields.
Functional molecular markers targeting the wheat TaUFD1-3B gene were developed. Using KASP marker technology, specific primers were designed for PCR amplification by detecting allelic variations at SNP 40, the genotype of the wheat TaUFD1-3B gene was determined, and flag leaf length and thousand-grain weight were predicted based on the genotype.
It provides effective molecular markers, improves the selection efficiency of wheat breeding, saves costs, enables rapid identification of superior alleles, constructs high-yielding new wheat varieties, significantly increases wheat flag leaf length and thousand-grain weight, and enhances yield per plant.
Smart Images

Figure CN120945117B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to functional molecular markers and their applications, in particular to a functional molecular marker of a wheat TaUFD1-3B gene and its application in assisted breeding, and belongs to the technical field of crop selection and cultivation. BACKGROUND
[0002] Wheat (Triticum aestivum L.) is a key source of about 20% of the world's caloric intake, and its yield improvement is of great significance to global food security. Ubiquitin Fusion Degradation Protein 1 (UFD1) is an important component of the CDC48 complex, which can mediate the degradation of proteins in chloroplasts through the ubiquitination protease pathway. Previous studies have found that the wheat TaUFD1-3A gene can interact with the wheat TaHAL3-7A gene and co-express, and has certain application potential in regulating the pigment content and yield of wheat. However, the effects of natural variation of the wheat TaUFD1-3B gene on flag leaf length and thousand-grain weight and related molecular markers have not been reported. Therefore, it is of great significance to realize high and stable yield of wheat to mine the functional molecular markers of the wheat TaUFD1-3B gene and apply them. SUMMARY
[0003] The present application provides a functional molecular marker of a wheat TaUFD1-3B gene and its application in identifying wheat yield traits, aiming to provide effective gene resources and molecular markers for crop genetic improvement.
[0004] To achieve the above-mentioned goal, the present application adopts the following technical solutions:
[0005] The functional molecular marker of the wheat TaUFD1-3B gene is located on the 3B chromosome of wheat, the genomic sequence is shown as SEQ ID NO: 1, the CDS sequence is shown as SEQ ID NO: 2, there are 19 SNP variations in the promoter region, 52 SNP variations and 5 InDel variations in the gene region, and the marker shows complete co-segregation. The functional molecular marker is a KASP marker, which is directed to the SNP 40 site variation, the allelic variation base of the SNP 40 site is A / G, and the KASP marker can be amplified by one forward primer shown as SEQ ID NO: 3 and two reverse primers shown as SEQ ID NO: 4 and SEQ ID NO: 5. The nucleotide sequence of the molecular marker of the GG genotype is shown as SEQ ID NO: 6, and the nucleotide sequence of the molecular marker of the AA genotype is shown as SEQ ID NO: 7.
[0006] The method for predicting the flag leaf length and the thousand kernel weight of the wheat by using the functional molecular marker of the wheat TaUFD1-3B gene comprises the following steps:
[0007] (1) taking the genomic DNA of the wheat to be detected as a template, and performing PCR amplification by using one forward primer shown in SEQ ID NO: 3 and two reverse primers shown in SEQ ID NO: 4 and SEQ ID NO: 5;
[0008] (2) determining the genotype of the wheat TaUFD1-3B gene according to the molecular marker obtained by the PCR amplification;
[0009] (3) predicting the flag leaf length and the thousand kernel weight of the wheat according to the genotype of the wheat TaUFD1-3B gene, and specifically, the GG genotype has a shorter flag leaf length and a heavier thousand kernel weight than the AA genotype.
[0010] The present application has the advantages that:
[0011] (1) the present application develops a new KASP marker, the KASP marker is derived from the natural variation analysis of the TaUFD1-3B gene in the natural population of the wheat, and provides an effective molecular marker for the genetic improvement of the yield traits (the flag leaf length and the thousand kernel weight) of the wheat, and can accelerate the breeding process;
[0012] (2) by applying the KASP marker developed in the present application, it can be judged whether the wheat variety to be detected contains the excellent allele of the TaUFD1-3B gene, thereby predicting the flag leaf length and the thousand kernel weight of the wheat, which not only can save the cost, but also can greatly improve the selection efficiency, and provides an assisted breeding technology for efficiently screening the excellent allele of the TaUFD1-3B gene and constructing a new wheat variety with high yield. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 is a SNP variation site and haplotype typing result diagram of the wheat TaUFD1-3B gene;
[0014] Figure 2 is a part of the detection result of the enzyme marker of the KASP marker developed in the present application;
[0015] Figure 3 is a haplotype of the wheat TaUFD1-3B gene and a result diagram of the correlation analysis of the flag leaf length of the wheat, and ** represents P<0.01;
[0016] Figure 4 is a haplotype of the wheat TaUFD1-3B gene and a result diagram of the correlation analysis of the thousand kernel weight of the wheat, and ** represents P<0.01. DETAILED DESCRIPTION
[0017] The application will be specifically described below in combination with the drawings and examples.
[0018] I. Obtaining of wheat TaUFD1-3B gene polymorphic sites and haplotypes
[0019] 1. Obtaining of wheat TaUFD1-3B gene polymorphic sites
[0020] Based on the genome resequencing data of 140 genetic diversity hexaploid wheat materials obtained in the early stage, the sequence (SEQ ID NO: 1) of the wheat TaUFD1-3B genome (2K promoter region + gene region) was retrieved from the Chinese spring wheat reference genome sequence RefSeq v2.1, wherein the CDS sequence of the wheat TaUFD1-3B gene is shown in SEQ ID NO: 2.
[0021] The alignment analysis showed that there were 71 SNP variations and 5 InDel variations in the wheat TaUFD1-3B genome, wherein there were 19 SNP variations in the promoter region, 52 SNP variations and 5 InDel variations in the gene region, and the variations were completely co-segregated.
[0022] 2. Obtaining of haplotypes of wheat TaUFD1-3B gene
[0023] Based on the variation types of the wheat TaUFD1-3B gene, a total of 2 haplotypes, TaUFD1-3B-Hapl I and TaUFD1-3B-Hapl II, were detected, as shown in Figure 1
[0024] II. Development of molecular markers of wheat TaUFD1-3B gene
[0025] For the SNP 40 site variation (the allelic variation base is A / G), a specific primer was designed by using the KASP primer design tool (http: / / 202.194.139.32 / snprimer / ).
[0026] The specific primer designed is composed of one forward primer (KASP-SNP40-F) and two reverse primers (KASP-SNP40-R1 and KASP-SNP40-R2), and the nucleotide sequences of the primers are as follows:
[0027] KASP-SNP40-F:
[0028] CAATACTGTCACGGTACATGAAAATA (SEQ ID NO: 3);
[0029] KASP-SNP40-R1:
[0030] GAAGGTGACCAAGTTCATGCTCAACCTTAGGAACCGTACTGAC (SEQ ID NO: 4);
[0031] KASP-SNP40-R2:
[0032] GAAGGTCGGAGTCAACGGATTCAACCTTAGGAACCGTACTGAT (SEQ ID NO: 5).
[0033] The nucleotide sequence of the molecular marker of GG genotype is shown in SEQ ID NO: 6, and the nucleotide sequence of the molecular marker of AA genotype is shown in SEQ ID NO: 7.
[0034] Three, identification of the genotype of SNP 40 site of wheat TaUFD1-3B gene
[0035] The DNA of a total of 239 wheat natural population materials in Table 1-1, Table 1-2, Table 1-3, Table 1-4, Table 1-5 and Table 1-6 was subjected to PCR amplification by using the primers KASP-SNP40-F, KASP-SNP40-R1 and KASP-SNP40-R2. The PCR reaction system and amplification program are as follows:
[0036] (1) The PCR reaction system is 1.622 μL, which specifically includes: 0.8 μL of DNA template (30 ng / μL), 0.8 μL of 2xKASP Master Mix (Laboratory of the Government Chemist, KBS-1050-201) and 0.022 μL of KASP Assay Mix. Among them, the preparation method of KASP Assay Mix is as follows: uniformly mix 30 μL of KAPS-SNP40-F with a concentration of 100 μM, 12 μL of KAPS-SNP40-R1 labeled with a fluorescent group with a concentration of 100 μM, 12 μL of KAPS-SNP40-R2 labeled with a fluorescent group with a concentration of 100 μM and 46 μL of ddH2O;
[0037] (2) The amplification program is as follows: 95°C heat activation for 15 min; 95°C denaturation for 20 s, 65-55°C reannealing for 60 s, 10 cycles, each cycle decreasing by 1°C; 95°C denaturation for 20 s, 55°C reannealing for 60 s, 30 cycles; 95°C denaturation for 5 min; 95°C denaturation for 20 s, 55°C reannealing for 60 s, 5 cycles.
[0038] The PCR amplification product was subjected to fluorescence intensity scanning detection by using a high-throughput scanner, and genotyping was performed by using the software SNPviewer, which is as follows:
[0039] If the fluorescence signal of the PCR amplification product of the to-be-tested wheat is red, the genotype of the to-be-tested wheat TaUFD1-3B gene at the SNP40 locus is GG, the haplotype is TaUFD1-3B-Hapl I, and the nucleotide sequence of the corresponding PCR amplification product is shown in SEQ ID NO: 6;
[0040] If the fluorescence signal of the PCR amplification product of the to-be-tested wheat is blue, the genotype of the to-be-tested wheat TaUFD1-3B gene at the SNP40 locus is AA, the haplotype is TaUFD1-3B-Hapl II, and the nucleotide sequence of the corresponding PCR amplification product is shown in SEQ ID NO: 7.
[0041] The haplotype typing results of the TaUFD1-3B gene of 239 wheat natural population materials are shown in Table 1-1, Table 1-2, Table 1-3, Table 1-4, Table 1-5 and Table 1-6, and the fluorescence scanning detection results of KASP markers of part of the wheat natural population materials are shown in Table 1-7, Table 1-8, Table 1-9, Table 1-10 and Table 1-11. Figure 2 .
[0042] Table 1-1 Haplotype typing results of TaUFD1-3B gene of 1-30th wheat natural population materials
[0043]
[0044] Table 1-2 Haplotype typing results of TaUFD1-3B gene of 31-72nd wheat natural population materials
[0045]
[0046] Table 1-3 Haplotype typing results of TaUFD1-3B gene of 73-114th wheat natural population materials
[0047]
[0048] Table 1-4 Haplotype typing results of TaUFD1-3B gene of 115-156th wheat natural population materials
[0049]
[0050] Table 1-5 Haplotype typing results of TaUFD1-3B gene of 157-198th wheat natural population materials
[0051]
[0052] Table 1-6 Haplotype typing results of TaUFD1-3B gene of 199-239th wheat natural population materials
[0053]
[0054] Four, Correlation analysis of wheat TaUFD1-3B gene haplotype and yield traits
[0055] The haplotype typing results of 239 wheat natural population materials TaUFD1-3B gene in Table 1-1, Table 1-2, Table 1-3, Table 1-4, Table 1-5 and Table 1-6 were correlated with the phenotypic data of wheat flag leaf length and thousand kernel weight in 5 environments (2021 Yantai Lai Mountain, 2021 Yantai Zhifu, 2021 Shijiazhuang Luancheng, 2023 Yantai Lai Mountain, 2023 Yantai Zhifu) in two years. The Best Linear Unbiased Estimator (BLUE) of wheat flag leaf length and thousand kernel weight in 5 environments was calculated by R language lme4 package.
[0056] The data were statistically analyzed by Excel software, and Student's t-test was used for significance analysis. The results of multi-environment flag leaf length correlation analysis of wheat TaUFD1-3B gene are shown in Table 2 and Figure 3 , and the results of thousand kernel weight correlation analysis are shown in Table 3 and Figure 4 .
[0057] Table 2 Correlation analysis results of wheat TaUFD1-3B gene multi-environment flag leaf length
[0058]
[0059] Note: ** indicates P<0.01.
[0060] Table 3 Correlation analysis results of wheat TaUFD1-3B gene multi-environment thousand kernel weight
[0061]
[0062] Note: ** indicates P<0.01.
[0063] Correlation analysis showed that compared with TaUFD1-3B-Hapl II type (the genotype of TaUFD1-3B gene at SNP 40 site is AA), the flag leaf length of TaUFD1-3B-Hapl I type (the genotype of TaUFD1-3B gene at SNP 40 site is GG) wheat was significantly reduced by 5.29-11.46% (shorter flag leaf length can reduce organic matter consumption, thereby increasing organic matter accumulation, thereby achieving the effect of increasing yield), and the thousand kernel weight was significantly increased by 4.98-10.04%.
[0064] The above results show that the two haplotypes of the wheat TaUFD1-3B gene are significantly associated with the flag leaf length and the thousand-grain weight of wheat, and the wheat of the TaUFD1-3B-Hapll type has higher single-plant yield by comprehensively considering the flag leaf length and the thousand-grain weight, and the TaUFD1-3B-Hapll type is an excellent haplotype of the wheat TaUFD1-3B gene and has potential value in the breeding of high-yield varieties.
[0065] The KASP marker developed by the present application for the SNP 40 site of the wheat TaUFD1-3B gene can be used to identify the flag leaf length and the thousand-grain weight of wheat and has certain breeding application potential.
[0066] It should be noted that the above examples are only examples for clearly illustrating the present application, and are not intended to limit the embodiments of the present application. Based on the above description, other different forms of changes or variations can also be made by those of ordinary skill in the art. Here, all the embodiments cannot be exhausted. Any obvious changes or variations derived from the technical scheme of the present application are still within the protection scope of the present application.
Claims
1. A method for predicting wheat flag leaf length and thousand-grain weight, characterized in that, Includes the following steps: (1) Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using one forward primer shown in SEQ ID NO:3 and two reverse primers shown in SEQ ID NO:4 and SEQ ID NO:5; (2) The genotype of wheat TaUFD1-3B gene was determined based on the molecular markers obtained by PCR amplification. The nucleotide sequence of the molecular marker for the GG genotype is shown in SEQ ID NO: 6, and the nucleotide sequence of the molecular marker for the AA genotype is shown in SEQ ID NO:
7. (3) Based on the genotype of wheat TaUFD1-3B gene, the flag leaf length and thousand-grain weight of wheat were predicted. The GG genotype had a shorter flag leaf length and a heavier thousand-grain weight than the AA genotype.