Shellfish aquatic product hepatitis A virus nano PCR primer pair and rapid detection kit

Abstract

The invention belongs to the field of food safety, and discloses a shellfish aquatic product hepatitis A virus nano PCR primer pair and a rapid detection kit. According to long-term experimental accumulation, a hepatitis A virus conserved sequence as shown in SEQ ID NO.3 is determined as a detection target, and the specific amplification efficiency is very good. By adding colloidal gold particles into a reaction system, the sensitivity of the kit for detecting the hepatitis A virus is further improved, the sensitivity is improved by 104 times compared with that of a common PCR detection method, and the kit has no cross reaction on common pathogenic microorganisms in shellfish aquatic products. The kit disclosed by the invention does not need expensive instruments and equipment, is high in specificity and sensitivity, and can be suitable for detecting a large batch of samples.

Description

Technical Field

[0001] This invention belongs to the field of food safety, specifically relating to nano-PCR primer pairs and rapid detection kits for hepatitis A virus in shellfish. Background Technology

[0002] Hepatitis A virus (HAV) is a major cause of foodborne infectious diseases worldwide. The primary transmission route of HAV is fecal-oral, through the consumption of contaminated food and drinking water, as well as through daily contact. Occasionally, it can also be transmitted through blood transfusions and blood products. Currently, research in various countries worldwide has demonstrated that shellfish are a significant carrier of HAV. Because shellfish filter seawater through their digestive systems to obtain food, they accumulate the virus in their bodies, making them more susceptible to viral foodborne illnesses. As early as 1988, approximately 300,000 people in Shanghai, my country, became infected with HAV after consuming blood clams, subsequently leading to a human-to-human transmission epidemic. HAV infection can cause acute hepatitis, with clinical manifestations including fever, vomiting, diarrhea, fatigue, dark urine, and jaundice of the skin and mucous membranes. Pain in the liver area is also a prominent clinical manifestation of hepatitis A. Since the inclusion of the hepatitis A vaccine in the National Immunization Program in 2008, the number of cases has significantly decreased. Currently, due to improved environmental sanitation, the immunity of HAV in the population has generally declined, and HAV has become a problem that cannot be ignored.

[0003] Currently, comprehensive data on the economic, social, and medical costs caused by HAV worldwide is lacking. However, food safety incidents triggered by HAV are showing a year-on-year increasing trend, posing a serious threat not only to food safety but also having a significant impact on public safety. Therefore, my country has issued national standards for HAV detection in shellfish (GB / T 22287-2008, conventional RT-PCR method and real-time fluorescent RT-PCR method) and national inspection and quarantine industry standards for HAV detection in imported and exported food (SN / T 5325.2-2020, digital PCR method). Conventional RT-PCR is a widely used detection method, but it has low sensitivity and specificity, especially limiting its effectiveness in detecting low levels of HAV. Real-time fluorescent RT-PCR has advantages such as high specificity and sensitivity; however, it requires expensive equipment and demands high technical skills from primer design and operators. Digital PCR has advantages such as quantitative, qualitative, and high sensitivity, and has been applied to the detection of aquatic products, vegetables, and other foods; however, the equipment used in this method is very expensive and requires highly skilled operators, generally making it unsuitable for large-scale sample testing.

[0004] HAV has a low infectious dose; even a small number of viral particles can cause human infection. Furthermore, viral particles maintain their infectivity as non-living biological macromolecules outside the body. In addition, HAV gene sequences exhibit significant variation, resulting in numerous serotypes. Therefore, HAV detection in shellfish faces several challenges: 1) long in vitro culture periods make rapid detection and analysis difficult; 2) low efficiency in purifying RNA from the virus; 3) the complex growth environment of shellfish introduces numerous interfering impurities during detection and purification; and 4) low HAV concentrations in shellfish make them difficult to detect. These challenges present new requirements for HAV detection in shellfish. Currently, domestic and international HAV detection technologies mainly include virus isolation, electron microscopy observation, serological detection, and molecular biological detection. HAV is difficult to culture in cells and has a long culture period, and it does not produce cytopathic effects; therefore, cell culture methods are generally not used for HAV detection. Electron microscopy allows direct observation of viral particle morphology, but it suffers from low sensitivity, relatively cumbersome operation, expensive equipment, and the inability to identify specific viral species. Immunological methods detect HAV specifically through antigen-antibody binding. However, due to their low sensitivity, they cannot detect HAV in foods like shellfish where the concentration is low, leading to frequent false negatives. Currently, DNA microarray assays can replace traditional PCR to identify single nucleotide polymorphisms in sample sequences; however, the equipment is expensive and unsuitable for routine laboratory testing. In recent years, several novel HAV detection technologies have been reported, such as enzyme-linked immunosorbent assay (ELISA), near-infrared immunochromatography (NIIR), and electrochemical immunosensors. These technologies, however, require expensive equipment, involve complex procedures, and have high costs, limiting their widespread application. Summary of the Invention

[0005] The purpose of this invention is to overcome at least one deficiency of the prior art and to provide a nano-PCR primer pair and rapid detection kit for hepatitis A virus in shellfish.

[0006] The technical solution adopted in this invention is: The first aspect of the present invention provides: A specific detection primer pair for detecting hepatitis A virus in shellfish aquatic products, the specific detection primer pair comprising primer HAV VP3 F and primer HAV VP3 R, the nucleic acid sequence of primer HAV VP3 F is shown in SEQ ID NO. 1, and the nucleic acid sequence of primer HAV VP3 R is shown in SEQ ID NO. 2.

[0007] A second aspect of the present invention provides: A nano-PCR rapid detection kit for hepatitis A virus in shellfish, the nano-PCR rapid detection kit comprising a premix containing the specific detection primer pair described in the first aspect of the present invention.

[0008] In some instances, the premix contains colloidal gold particles.

[0009] In some instances, the kit also includes positive and negative standards.

[0010] In some instances, the positive standard is a recombinant nucleic acid sequence of hepatitis A virus as shown in SEQ ID NO.3.

[0011] In some instances, the negative standard is nuclease-free water.

[0012] In some instances, the colloidal gold particles have a diameter of 15–30 nm.

[0013] In some instances, the colloidal gold particles have a diameter of 20 nm.

[0014] In some instances, the concentration of the colloidal gold particles is 0.05–0.2 mg / mL.

[0015] In some examples, the PCR reaction conditions were: 95 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 51 °C annealing for 30 s, 72 °C extension for 30 s, 35 cycles; 72 °C final extension for 10 min, and the amplification products were observed by 1.2% agarose gel electrophoresis.

[0016] The beneficial effects of this invention are: The nano-PCR rapid detection kit for hepatitis A virus in shellfish products of the present invention is suitable for rapid detection and screening of hepatitis A virus at low titers in shellfish products. Compared with the prior art, the present invention has the following advantages: 1. The nano-PCR rapid detection kit for hepatitis A virus in shellfish products of the present invention contains colloidal gold particles that are uniform in size, well dispersed, and have good light transmittance, which can improve the sensitivity of the kit in detecting hepatitis A virus.

[0017] 2. The reagent kit of the present invention is easy to operate during detection, does not require expensive instruments and equipment, and saves detection costs.

[0018] 3. The kit of the present invention exhibits high sensitivity during detection, with a 10% improvement in sensitivity compared to conventional PCR detection methods. 4 times.

[0019] 4. The kit of the present invention has high specificity during detection and no cross-reaction with common pathogenic microorganisms in shellfish aquatic products.

[0020] 5. The kit of the present invention does not require expensive instruments and equipment, has high specificity and high sensitivity, and is suitable for the detection of large batches of samples. Attached Figure Description

[0021] Figure 1 Photograph of a solution containing 20 nm colloidal gold particles.

[0022] Figure 2 To determine the 20 nm colloidal gold particle solution using a UV-Vis spectrophotometer.

[0023] Figure 3 The results are from transmission electron microscopy of 20 nm colloidal gold particles.

[0024] Figure 4 To amplify the hepatitis A virus VP3 Genetic results. M represents DL 2000 DNA Marker, 1 represents negative control, and 2 represents hepatitis A virus. VP3 Gene amplification results.

[0025] Figure 5 To optimize the concentration of 20 nm colloidal gold particles, M represents DL 2000 DNA Marker, 1 represents the negative control, 2 represents adding 0.5 μL of colloidal gold particle solution, 3 represents adding 1.0 μL of colloidal gold particle solution, 4 represents adding 1.5 μL of colloidal gold particle solution, 5 represents adding 2.0 μL of colloidal gold particle solution, 6 represents adding 2.5 μL of colloidal gold particle solution, 7 represents adding 3.0 μL of colloidal gold particle solution, 8 represents adding 3.5 μL of colloidal gold particle solution, and 9 represents adding 4.0 μL of colloidal gold particle solution.

[0026] Figure 6 To optimize the primer content for detecting hepatitis A virus. M represents DL 2000 DNA Marker, 1 represents negative control, 2 represents 0.1 μL of each primer added, 3 represents 0.5 μL of each primer added, 4 represents 1.0 μL of each primer added, 5 represents 1.5 μL of each primer added, and 6 represents 2.0 μL of each primer added.

[0027] Figure 7 These are the results of a sensitivity test for a rapid hepatitis A virus (HBV) nano-PCR detection kit for shellfish. A represents the HBV nano-PCR sensitivity test, B represents the HBV PCR sensitivity test, M represents the DL 2000 DNA Marker, 1 represents the negative control, and 2 represents the HBV standard positive plasmid concentration of 1.73 × 10⁻⁶. 7copies / μL, 3 indicates the concentration of the hepatitis A virus standard positive plasmid is 1.73 × 10⁻⁶. 6 copies / μL, 4 indicates the concentration of the hepatitis A virus standard positive plasmid is 1.73 × 10⁴. 5 copies / μL, 5 indicates the concentration of the hepatitis A virus standard positive plasmid is 1.73 × 10⁵. 4 copies / μL, 6 indicates the concentration of the hepatitis A virus standard positive plasmid is 1.73 × 10⁶. 3 copies / μL, 7 indicates the concentration of the hepatitis A virus standard positive plasmid is 1.73 × 10⁷ copies / μL. 2 copies / μL, 8 indicates the concentration of the standard positive plasmid for hepatitis A virus is 1.73 × 10⁸. 1 copies / μL, 9 indicates the concentration of the standard positive plasmid for hepatitis A virus is 1.73 × 10⁹. 0 copies / μL.

[0028] Figure 8 This represents the specificity test results of the nano-PCR rapid detection kit for hepatitis A virus in shellfish. M represents DL 2000 DNA Marker, 1 represents negative control, 2 represents hepatitis A virus, 3 represents norovirus GII genotype, 4 represents hepatitis E virus, 5 represents group A rotavirus, 6 represents human astrovirus, and 7 represents Vibrio parahaemolyticus.

[0029] Figure 9 This is the amplification result of the positive control without colloidal gold particles. M represents DL 2000 DNA Marker, 1 represents the negative control, and 2 represents hepatitis A virus without colloidal gold particles. VP3 Gene amplification results; 3 indicates hepatitis A virus with 0.5 μL colloidal gold particles added. VP3 Gene amplification results. Detailed Implementation

[0030] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0031] Example 1: Acidification and Silicate Treatment of Glassware First, thoroughly scrub the dust and dirt off the glassware, then rinse it with plenty of tap water, and finally rinse and dry it with deionized water. Next, soak the cleaned glassware in the cleaning solution for 48 hours, then rinse it repeatedly with tap water 15 times, then wash it with distilled water 15 times, and finally wash it with deionized water 15 times. Dry it in a 90°C oven for later use.

[0032] Immerse the acidified glassware in the fume hood in a chloroform solution containing 5% dichlorodimethylsilane for 10 minutes. After immersion, remove the glassware and allow the organic matter to completely evaporate. Then, wash the glassware with tap water, distilled water, and deionized water, and dry it in a 90°C oven for later use.

[0033] Example 2: Preparation and Identification of 20 nm Colloidal Gold Particles 20 nm colloidal gold particles were prepared using the trisodium citrate reduction method. 1.0 mL of 1% HAuCl4 solution was added to 99.0 mL of deionized water and heated on a hot plate until boiling. After boiling for 2-3 min, 1.5 mL of 1% trisodium citrate solution was added. Heating and stirring were continued continuously. The solution color changed sequentially from colorless to light gray, black, purple, and wine red. After the color stabilized, heating was continued for another 6 min. Heating was then stopped, and the mixture was cooled to room temperature and stored at 4 ℃ protected from light.

[0034] Quality assessment of the prepared 20 nm colloidal gold particles: 1) Visual observation: High-quality colloidal gold particle solutions are clear and transparent, without suspended matter or precipitated impurities, such as... Figure 1 As shown. 2) Measurement using a UV-Vis spectrophotometer: The maximum absorption wavelength and maximum absorbance value were measured within a specific wavelength range. The results are as follows. Figure 2 As shown, the UV-Vis spectrophotometer measured the colloidal gold solution, and the maximum absorbance was approximately 1.377 at a wavelength of 520 nm. 3) Transmission electron microscopy was used to identify the colloidal gold particles, analyzing their aggregation, size, dispersion, and particle diameter. The results are as follows. Figure 3 As shown, the colloidal gold particles observed by transmission electron microscopy are uniform in size and have good homogeneity, with a particle diameter of approximately 20 nm.

[0035] Example 3: Construction of recombinant plasmid pMD-18T-VP3 The complete genome sequence of hepatitis A virus was obtained from the GenBank database. Conserved gene sequences of hepatitis A virus were analyzed. The selected conserved gene sequence of hepatitis A virus is: ctgatccgtcccagggtggtgggatcaaaattactcattttactacttggacatctattccaactttggctgctcagtttccatttaatgcttcagactcagttggtcaacaaattaaagttattccagttgacccatattttttccaaatgacaaatacaaatcctgaccaaaaatg tataactgctttggcttctatttgtcagatgttttgtttttggagaggagatcttgtctttgattttcaagtttttcccaccaaatatcattcaggtagattactgttttgttttgttcctggcaatgagctaatagatgtttctggaatcacattaaagcaagcaactactgctccttgtgcagtaatggatattacaggagtgcagtcaactttgagatttcgtgttccctg (SEQ ID NO. 3). Based on the conserved gene sequence of hepatitis A virus, a pair of specific primers were designed using Primer Premier 5.0 software. The specific primer pair for detecting hepatitis A virus includes primer HAV VP3 F and primer HAV VP3 R. The nucleic acid sequence of primer HAV VP3 F is: CTGATCCGTCCCAGGGTG (SEQ ID NO. 1), and the nucleic acid sequence of primer HAV VP3 R is: CAGGGAACACGAAATCTCAAA (SEQ ID NO. 2).

[0036] RNA was extracted from hepatitis A virus samples using the TRIzol method. The specific steps were as follows: 200 μL of sample solution was placed in an RNase-free EP tube, 1 mL of TRIzol solution was added, and the mixture was vortexed for 30 s and incubated at room temperature for 5 min. 0.2 mL of chloroform was added, and the mixture was vortexed for 30 s and incubated at room temperature for 5 min. The mixture was then centrifuged at 12,000 rpm for 15 min. The supernatant was collected and placed in a new RNase-free EP tube, and an equal volume of isopropanol solution was added. The mixture was incubated at room temperature for 30 min and then centrifuged at 12,000 rpm for 15 min. The precipitate was washed with 1 mL of 75% ethanol and centrifuged at 8,000 rpm for 15 min. The supernatant was discarded, and the RNA in the precipitate was allowed to evaporate at room temperature. 20 μL of RNase-free ddH2O was added to dissolve the RNA precipitate, and the precipitate was immediately stored at -80°C for later use. Further reverse transcription was performed using a kit such as NovoScript. ® Obtain cDNA using the 1st Strand cDNA Synthesis Kit. Add reagents sequentially to a sterile PCR tube: 1 μL total RNA, 1 μL Random N6, and 5× NovoScript. ® RTBuffer 4 μL, RNaseInhibitor 1 μL, gDNA Purge 1 μL, dNTPs (10 mmol / L each) 2 μL, NovoScript ® II. Add 1 μL of Reverse Transcriptase and bring the volume to 20 μL with RNase-Free Water. Incubate at 65°C for 5 min, then cool on ice; subsequently incubate at 25°C for 5 min, then at 50°C for 15 min. Terminate the reaction by heating at 70°C for 5 min, thus obtaining cDNA.

[0037] Using viral cDNA as a template, PCR amplification was performed using primers HAV VP3 F and HAV VP3 R. The PCR reaction conditions for hepatitis A virus were: 95 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 51 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for 35 cycles; followed by a final extension at 72 ℃ for 10 min. The amplification products were observed by 1.2% agarose gel electrophoresis. The results are as follows: Figure 4 As shown, the size of the target fragment obtained is 412 bp, which is consistent with the expected fragment size.

[0038] Purify the amplified product to the target sequence according to the instructions of a DNA gel extraction kit (such as an agarose gel DNA extraction kit). Cut a single target DNA band from the agarose gel and place it in a sterile EP tube. Add 3 volumes of sol-gel buffer (PE) to the gel block and incubate at 25°C for 10 min, continuously rotating the centrifuge tube during this time. Add the solution to the adsorption column, incubate at room temperature for 5 min, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid. Add 600 μL of wash buffer to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid. Centrifuge again at 12,000 rpm for 2 min, discarding as much wash buffer as possible. Place the adsorption column in a clean EP centrifuge tube, add 30 μL of elution buffer to the adsorption membrane, incubate at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min, collect the DNA solution, and determine its concentration. The purified target sequence was ligated into the cloning vector pMD-18T. The sequence was identified by PCR and verified by sequencing. The sequencing results were consistent with those shown in SEQ ID NO. 3 of the sequence listing, and the positive recombinant plasmid pMD-18T-VP3 was obtained.

[0039] Example 4: Optimization of Hepatitis A Virus Nanoparticle PCR Reaction Conditions (1) Determine the content of colloidal gold particles The positive recombinant plasmid pMD-18T-VP3 (1.73×10⁻⁶) was used. 7 Using copies / μL as a template, the optimal reaction system for hepatitis A virus nanoparticle PCR was determined. The reaction system consisted of 20 μL, including 10.0 μL of 2×HiFi Taq enzyme, 0.5 μL of template, 0.5 μL of HAV VP3 F (10 μmol / L), and 0.5 μL of HAV VP3 R (10 μmol / L). Then, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, and 4.0 μL of 20 nm colloidal gold particle solution were added, respectively. The volume was then adjusted to 20 μL with RNase-free ddH2O, followed by PCR amplification. The PCR reaction conditions were as follows: 95 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 51 °C annealing for 30 s, 72 °C extension for 30 s, 35 cycles; 72 °C final extension for 10 min. RNase-free ddH2O was used as a negative control. The PCR amplification products were observed by 1.2% agarose gel electrophoresis to determine the optimal content of 20 nm colloidal gold particles in the solution.

[0040] The results are as follows Figure 5As shown, the PCR amplification product gradually increases with the increasing content of 20 nm colloidal gold particle solution. When the content of colloidal gold particle solution is 0.5-2.0 μL, the difference in the amplification amount of PCR product is not obvious. Therefore, the optimal content of 20 nm colloidal gold particle solution is determined to be 0.5 μL. Figure 9 The results are positive control amplification results without the addition of colloidal gold particles, showing that colloidal gold particles can unexpectedly increase the amount of PCR amplification products.

[0041] (2) Determine the content of upstream and downstream primers The positive recombinant plasmid pMD-18T-VP3 (1.73×10⁻⁶) was used. 7 Using copies / μL as a template, the optimal reaction system for hepatitis A virus nano-PCR was determined. The reaction system was 20 μL, including 10.0 μL of 2×HiFi Taq enzyme, 0.5 μL of template, and 2.0 μL of colloidal gold particle solution. 0.1, 0.5, 1.0, 1.5, and 2.0 μL of HAV VP3 F / R (10 μmol / L) were added respectively, and the volume was brought up to 20 μL with RNase-free ddH2O. PCR amplification was then performed. The PCR reaction conditions were: 95 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 51 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 35 cycles; final extension at 72 ℃ for 10 min. RNase-free ddH2O was used as a negative control. The PCR products were observed by 1.2% agarose gel electrophoresis to determine the optimal primer content for detecting hepatitis A virus.

[0042] The results are as follows Figure 6 As shown, the PCR amplification product gradually increased with the gradual increase of primer HAV VP3 F / R (10 μmol / L). When the primer HAV VP3 F / R (10 μmol / L) content was 0.5-2.0 μL, the difference in PCR amplification product amplification amount was not significant. Therefore, the optimal content of primer HAV VP3 F / R (10 μmol / L) was determined to be 0.5 μL.

[0043] Example 5 Sensitivity Test Using RNase-free ddH2O as a template as a negative control, the hepatitis A virus nano-PCR kit of the present invention was compared with existing conventional PCR detection methods to analyze the sensitivity of the kit of the present invention.

[0044] The rapid detection method for hepatitis A virus using nano-PCR of the present invention is as follows: PCR amplification was performed according to the selected optimal reaction conditions. The reaction system was 20 μL, including 10.0 μL of 2×HiFi Taq enzyme, 0.5 μL of template, 0.5 μL of primer HAV VP3 F (10 μmol / L), 0.5 μL of primer HAV VP3 R (10 μmol / L), and 0.5 μL of 20 nm colloidal gold particle solution. The PCR reaction conditions were: 95 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 51 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for 35 cycles; and a final extension at 72 ℃ for 10 min. The template used was the positive recombinant plasmid pMD-18T-VP3 with a concentration of 1.73 × 10⁻⁶. 7 Copies / μL were serially diluted 10-fold.

[0045] The existing common PCR methods are as follows: The reaction system consisted of 20 μL of 2×HiFi Taq enzyme, 0.5 μL template, 0.5 μL primer HAV VP3F (10 μmol / L), and 0.5 μL primer HAV VP3R (10 μmol / L). The PCR reaction conditions were: 95 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 51 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for 35 cycles; and a final extension at 72 ℃ for 10 min. The template used was the positive recombinant plasmid pMD-18T-VP3 at a concentration of 1.73 × 10⁻⁶. 7 Copies / μL were serially diluted 10-fold.

[0046] The PCR amplification products were observed by 1.2% agarose gel electrophoresis. The results are as follows: Figure 7 As shown, the lowest detection limit of existing conventional PCR methods is 1.73 × 10⁻⁶. 4 The limit of detection for the kit of this invention is 1.73 × 10⁻⁶ copies / μL. 0 copies / μL. The sensitivity of the kit of this invention is 10 times that of conventional PCR methods. 4 times.

[0047] Example 6 Specificity Test To verify the specificity of the hepatitis A virus nano-PCR rapid detection kit for shellfish products constructed in this invention, nucleic acids from other foodborne viruses (norovirus, hepatitis E virus, rotavirus, and astrovirus) and Vibrio parahaemolyticus were extracted as templates, and RNase-free ddH2O was used as a negative control to analyze the specificity of the hepatitis A virus nano-PCR rapid detection kit.

[0048] RNA was extracted from viral samples using the TRIzol method, with the following steps: 200 μL of sample solution was placed in an RNase-free EP tube, 1 mL of TRIzol solution was added, and the mixture was vortexed for 30 s and incubated at room temperature for 5 min. 0.2 mL of chloroform was added, and the mixture was vortexed for 30 s and incubated at room temperature for 5 min. The mixture was then centrifuged at 12,000 rpm for 15 min. The supernatant was collected and placed in a new RNase-free EP tube, and an equal volume of isopropanol solution was added. The mixture was incubated at room temperature for 30 min and then centrifuged at 12,000 rpm for 15 min. The precipitate was washed with 1 mL of 75% ethanol and centrifuged at 8,000 rpm for 15 min. The supernatant was discarded, and the RNA in the precipitate was allowed to evaporate at room temperature. 20 μL of RNase-free ddH2O was added to dissolve the RNA precipitate, and the precipitate was immediately stored at -80°C for later use. Further reverse transcription was performed using a kit such as NovoScript. ® The cDNA was obtained using the 1st Strand cDNA Synthesis Kit. The following were added sequentially to a sterile PCR tube: 1 μL total RNA, 1 μL Random N6, and 5× NovoScript. ® RT Buffer 4 μL, RNaseInhibitor 1 μL, gDNA Purge 1 μL, dNTPs (10 mmol / L each) 2 μL, NovoScript ® Add 1 μL of IIReverse Transcriptase and bring the volume to 20 μL with RNase-Free Water. Incubate at 65 °C for 5 min, then cool on ice; subsequently incubate at 25 °C for 5 min, then at 50 °C for 15 min. Stop the reaction by heating at 70 °C for 5 min to obtain cDNA.

[0049] For Vibrio parahaemolyticus samples, the sample DNA was crudely extracted by thermal lysis. The specific steps are as follows: Take 50 μL of the activated bacterial solution and place it in a centrifuge tube. Heat at 100℃ for 10 min; centrifuge at 12,000 r / min for 15 min. The supernatant is the sample DNA to be tested. Store at -20℃ for later use.

[0050] The PCR amplification products were observed by 1.2% agarose gel electrophoresis. The specificity of the established nano-PCR rapid detection kit for hepatitis A virus in shellfish was evaluated using cDNA or DNA of norovirus, hepatitis E virus, rotavirus, astrovirus, Vibrio parahaemolyticus, and hepatitis A virus as templates. The results are as follows. Figure 8As shown, only the hepatitis A virus sample amplified the 412 bp target fragment, while the test results for the other pathogen samples were all negative. This demonstrates that the kit of the present invention, namely the nano-PCR method for hepatitis A virus in shellfish, does not have cross-reactivity with other common pathogens in shellfish, indicating that the kit of the present invention, namely the rapid detection kit for hepatitis A virus in shellfish, has good specificity.

[0051] Example 7: Determination of actual samples using the Hepatitis A Virus NanoPCR Rapid Detection Kit A total of 314 shellfish samples potentially containing hepatitis A virus were collected from the Bohai Bay region [Liaoning Province (Dandong, Dalian, Yingkou, and Jinzhou), Hebei Province (Qinhuangdao and Tangshan), Shandong Province (Dongying, Yantai, and Weihai), and Tianjin]. These samples included oysters, scallops, razor clams, clams, green clams, and four-cornered clams. Specific sample information is shown in Table 1. The digestive glands of each shellfish were aseptically isolated, homogenized with a certain amount of sterile PBS solution, and centrifuged at 12,000 r / min for 15 min. The supernatant was collected. RNA was extracted from the samples using the TRIzol method described in Example 6 and reverse transcribed. The obtained cDNA was used as a detection template for analysis.

[0052] Table 1. Actual sample information for the Hepatitis A Virus NanoPCR Rapid Detection Kit Sample Name Number of samples Collection time Oyster 58 November 2023 - April 2024 scallop 52 November 2023 - April 2024 razor clam 52 November 2023 - April 2024 clams 47 November 2023 - April 2024 Green Willow Clam 43 November 2023 - April 2024 Four-cornered clam sample 62 November 2023 - April 2024 Prepare 316 nano-PCR reaction solutions for hepatitis A virus detection according to the following composition (314 + 1 positive control + 1 negative control) (Table 2). Note that all components should be mixed and centrifuged before preparation, and the nano-PCR reaction solution should be mixed and centrifuged after preparation. Aliquot the reaction system into PCR reaction tubes at 19.5 μL / tube. Add 0.5 μL of negative control or 0.5 μL of positive control to the PCR reaction tube. Transfer the other reaction tubes containing PCR reaction solution to the sample processing area. Add 0.5 μL of sample template to the sample processing area and centrifuge briefly. Place the reaction tubes in the PCR instrument. The PCR reaction conditions are: 95 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 51 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 35 cycles; final extension at 72 ℃ for 10 min. Observe the results of PCR amplification products by 1.2% agarose gel electrophoresis.

[0053] Table 2. Reaction system of the nano-PCR rapid detection kit for hepatitis A virus in shellfish. reagent composition Reagent volume (μL) 2×HiFi Taq enzyme 10.0 HAV VP3 F primer (10 μmol / L) 0.5 HAV VP3 R primers (10 μmol / L) 0.5 20 nm colloidal gold particle solution 0.5 <![CDATA[RNase-free ddH2O]]> 8.0 Total 20 Of the 314 food samples tested, 63 were positive for hepatitis A virus, with a positive rate of 20.06%. Hepatitis A virus was distributed in various shellfish products (oysters, scallops, razor clams, clams, green clams, and four-cornered clams) in the Bohai Bay area. Among them, oysters had the highest positive rate for hepatitis A virus (5.1%). Specific information on positive samples is shown in Table 3.

[0054] Table 3. Information on positive samples of shellfish products detected by the nano-PCR kit for hepatitis A virus. Sample types quantity Positive rate Oyster 16 5.1% scallop 12 3.82% razor clam 9 2.87% clams 9 2.87% Green Willow Clam 6 1.91% Four-cornered clams 11 3.5% The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are all within the protection scope of the present invention.

Claims

1. A specific primer pair for detecting hepatitis A virus in shellfish aquatic products, characterized in that, The specific detection primer pair includes primer HAV VP3 F and primer HAV VP3 R. The nucleic acid sequence of primer HAV VP3 F is shown in SEQ ID NO. 1, and the nucleic acid sequence of primer HAV VP3 R is shown in SEQ ID NO.

2.

2. A nano-PCR rapid detection kit for hepatitis A virus in shellfish aquatic products, characterized in that, The nano-PCR rapid detection kit contains a premix containing the specific detection primer pair as described in claim 1.

3. The nano-PCR rapid detection kit according to claim 2, characterized in that, The premixed solution contains colloidal gold particles.

4. The nano-PCR rapid detection kit according to claim 2, characterized in that, The kit also includes positive and negative standards.

5. The nano-PCR rapid detection kit according to claim 4, characterized in that, The positive standard is a recombinant nucleic acid sequence of hepatitis A virus as shown in SEQ ID NO.

3.

6. The nano-PCR rapid detection kit according to claim 4, characterized in that, The negative standard is nuclease-free water.

7. The nano-PCR rapid detection kit according to claim 3, characterized in that, The colloidal gold particles have a diameter of 15–30 nm.

8. The nano-PCR rapid detection kit according to claim 7, characterized in that, The colloidal gold particles have a diameter of 20 nm.

9. The nano-PCR rapid detection kit according to claim 3, 7 or 8, characterized in that, The concentration of the colloidal gold particles is 0.05–0.2 mg / mL.

10. The nano-PCR rapid detection kit according to claim 2, characterized in that, The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 51℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 10 min. The amplification products were observed by 1.2% agarose gel electrophoresis.

Images