Multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) primer and kit for simultaneously detecting PPV, JEV and GETV

Abstract

The invention provides multiple fluorescent quantitative PCR primers for simultaneously detecting PPV, JEV and GETV and a kit thereof, and belongs to the technical field of virus detection. The primer combination comprises specific primers and fluorescent probes aiming at a PPV NS1 gene (SEQ ID NO.10), a JEV E gene (SEQ ID NO.11) and a GETV E2 gene (SEQ ID NO.12), and labeling is performed through different fluorophores (FAM, VIC and CY5), so that fluorescence interference is avoided. The kit disclosed by the invention is combined with an optimized reaction system and conditions, so that efficient, rapid, high-sensitivity and high-specificity detection on the three viruses is realized. Therefore, the invention provides a reliable and economical tool for diagnosing multiple pathogens of the porcine reproductive disorder diseases, and provides powerful technical support for prevention and control of epidemic diseases of swinery.

Description

Technical Field

[0001] This invention belongs to the field of virus detection technology, and in particular relates to a multiplex fluorescent PCR primer and kit for simultaneously detecting PPV, JEV and GETV. Background Technology

[0002] Porcine parvovirus (PPV) belongs to the genus Parvovirus in the family Parvoviridae. It is a non-enveloped, single-stranded linear DNA virus with a genome length of approximately 5 kb. PPV was first discovered in 1968, and seven subtypes (PPV1–PPV7) have been identified to date. Its genome contains two major open reading frames (ORFs): the upstream ORF encodes the non-structural proteins NS1, NS2, and NS3, and the downstream ORF encodes the structural proteins VP1, VP2, and VP3. This virus exhibits strong environmental stability and infectivity, and is widely distributed globally. PPV primarily infects swine herds, especially pregnant sows, causing embryonic death, fetal mummification, and sow reproductive disorders syndrome; it can also affect boar semen quality. Furthermore, PPV often forms mixed infections with other viruses or bacteria, resulting in complex and diverse clinical symptoms, which poses significant challenges to diagnosis.

[0003] Japanese encephalitis virus (JEV), also known as Japanese encephalitis virus, is an important member of the genus Flavivirus in the family Flaviviridae. JEV is a spherical viral particle with a diameter of approximately 40 nm. Its genome is a single-stranded positive-sense RNA of about 11 kb, with a core structure composed of nucleocapsid protein and RNA. The virus spreads in a mosquito-swine-mosquito cycle, with Culex tritaeniorhynchus as the primary vector, and pigs as important intermediate and spreading hosts. JEV infection can cause abortion, stillbirth, or mummified fetuses in sows, while boars may develop orchitis or infertility. Due to its mosquito-borne transmission and high infectivity, it poses a serious threat to the pig industry.

[0004] Getah virus (GETV) belongs to the genus Alphavirus of the family Togaviridae. It is an enveloped, spherical viral particle approximately 70 nm in diameter. Its genome is a single-stranded positive-sense RNA of about 11 kb, containing two ORFs encoding four non-structural proteins (NSP1–NSP4) and five structural proteins. GETV is a zoonotic pathogen transmitted by mosquitoes such as Aedes gnatula, infecting various animals including pigs and horses, and can also infect humans. In pig herds, GETV can infect pigs of all ages, but is most damaging to sows and suckling piglets, manifesting as reproductive disorders, diarrhea, and respiratory distress. In severe cases, it can lead to mass mortality of newborn piglets, and has become one of the important pathogens in my country's pig industry.

[0005] The three viruses mentioned above—PPV, JEV, and GETV—can all cause reproductive disorders in pigs, exhibiting highly similar clinical manifestations. Furthermore, coexistence and mixed infections of multiple pathogens are common in actual poultry farming. While single-virus quantitative PCR detection methods exist for these three viruses, traditional single-detection methods are insufficient to address the complex clinical situations presented by multiple infections. Therefore, there is an urgent need to develop a novel diagnostic technology that is highly efficient, sensitive, specific, and suitable for the simultaneous detection of multiple pathogens. This would enable rapid differential diagnosis of PPV, JEV, and GETV, providing strong technical support for the prevention and control of porcine reproductive disorders. Summary of the Invention

[0006] The purpose of this invention is to provide primers and a kit for multiplex fluorescent PCR that can simultaneously detect PPV, JEV and GETV, thereby enabling rapid differential diagnosis of PPV, JEV and GETV and providing strong technical support for the prevention and control of porcine reproductive disorders.

[0007] To achieve the above objectives, the present invention provides the following technical solution: First, this invention provides a multiplex TaqMan quantitative PCR primer and probe combination for the simultaneous detection of porcine parvovirus (PPV), Japanese encephalitis virus (JEV), and gehtavirus (GETV). The multiplex TaqMan quantitative PCR primer and probe combination includes: PPV primers and PPV probes, JEV primers and JEV probes, and GETV primers and GETV probes; The upstream primer sequence of the PPV primer is shown in SEQ ID NO.1, and the downstream primer sequence of the PPV primer is shown in SEQ ID NO.2; The sequence of the PPV probe is shown in SEQ ID NO.3, and the 5' end of the PPV probe is labeled with a FAM fluorescent group and the 3' end is labeled with a BHQ1 quenching group. The upstream primer sequence of the JEV primer is shown in SEQ ID NO.4, and the downstream primer sequence of the JEV primer is shown in SEQ ID NO.5; The sequence of the JEV probe is shown in SEQ ID NO.6, and the 5' end of the JEV probe is labeled with a VIC fluorescent group and the 3' end is labeled with a BHQ1 quenching group. The upstream primer sequence of the GETV primer is shown in SEQ ID NO.7, and the downstream primer sequence of the GETV primer is shown in SEQ ID NO.8; The sequence of the GETV probe is shown in SEQ ID NO.9, and the 5' end of the GETV probe is labeled with the CY5 fluorescent group, and the 3' end is labeled with the BHQ2 quencher group.

[0008] Preferably, the PPV target sequence targeted by the PPV primers and PPV probes is shown in SEQ ID NO.10; The JEV target sequence targeted by the JEV primers and JEV probes is shown in SEQ ID NO.11; The GETV target sequence targeted by the GETV primers and GETV probes is shown in SEQ ID NO.12.

[0009] Secondly, the present invention provides a multiplex TaqMan real-time PCR kit for the simultaneous detection of porcine parvovirus (PPV), Japanese encephalitis virus (JEV), and gehtavirus (GETV), wherein the multiplex TaqMan real-time PCR kit comprises the multiplex TaqMan real-time PCR primer and probe combination as described in claim 1.

[0010] Preferably, the multiplex TaqMan real-time PCR kit further includes 2×One Step Q Probe Mix, One Step Q Probe Enzyme Mix, nuclease-free water, and positive and / or negative controls.

[0011] Preferably, the positive controls are standard plasmids pUC57-PPV, pUC57-JEV, and pUC57-GETV.

[0012] Preferably, the negative control is nuclease-free water.

[0013] Preferably, the composition of each 20 μL PCR reaction system of the multiplex TaqMan real-time PCR kit is as follows: 2×One Step Q Probe Mix: 10 μL; One Step Q Probe Enzyme Mix: 1 μL; PPV upstream primer: 0.4 μL; PPV downstream primer: 0.4 μL; PPV probe: 0.2 μL; JEV upstream primer: 0.4 μL; JEV downstream primer: 0.4 μL; JEV probe: 0.2 μL; GETV upstream primer: 0.4 μL; GETV downstream primer: 0.4 μL; GETV probe: 0.2 μL; template DNA or cDNA: 4 μL; nuclease-free water: bring to 20 μL.

[0014] Preferably, the PCR reaction conditions of the multiplex TaqMan real-time PCR kit are as follows: reverse transcription at 55℃ for 5 min; pre-denaturation at 95℃ for 30 s; denaturation at 95℃ for 10 s; annealing / extension at 60℃ for 30 s, for a total of 40 cycles; and fluorescence values ​​of the three channels FAM, VIC and Cy5 are collected simultaneously.

[0015] Preferably, the limit of detection for PPV, JEV, and GETV in the multiplex TaqMan quantitative PCR kit is 1.0 × 10⁻⁶. 2 copies / mL.

[0016] Furthermore, this invention provides the application of multiplex TaqMan quantitative PCR primer-probe combinations in the preparation of diagnostic reagents for porcine reproductive disorders.

[0017] The beneficial effects of this invention are as follows: 1. This invention employs multiplex quantitative PCR technology to simultaneously detect three viruses—PPV, JEV, and GETV—within the same reaction system. This significantly shortens the detection cycle and, compared to traditional single-detection methods, avoids the tediousness of multiple experiments, thereby improving diagnostic efficiency. It is particularly suitable for the rapid differential diagnosis of multiple infections in porcine reproductive disorders.

[0018] 2. The primers and probes designed in this invention have been optimized to achieve extremely high detection sensitivity, with the lowest detection limits for PPV, JEV, and GETV all reaching 1.0 × 10⁻⁶. 2 This allows the invention to effectively detect samples with low viral loads. Simultaneously, the primer-probe combination exhibits high specificity and shows no cross-reactivity with various common porcine pathogens, effectively avoiding false positive results.

[0019] 3. Through repeatability testing, the multiplex quantitative PCR method of this invention demonstrated excellent intra- and inter-group repeatability with a low coefficient of variation. This indicates that the detection results are consistent, stable, and reliable, suitable for routine testing of large-scale clinical samples, and provides a solid technical foundation for disease surveillance. Attached Figure Description

[0020] Figure 1 The standard curves are for primers and probes targeting PPV. Figure 2 The standard curves are for the primers and probes targeting JEV. Figure 3 The standard curves are for primers and probes targeting GETV. Figure 4 The standard curve for multiplex TaqMan quantitative PCR; Figure 5 Specificity analysis curves for multiplex TaqMan quantitative PCR; In the figure, the S-shaped curves from top to bottom correspond to GETV, JEV and PPV respectively; Figure 6 The sensitivity curve for multiplex TaqMan quantitative PCR against PPV virus is shown. From left to right, they are 1.0 × 10 11 copies / mL, 1.0×10 10 copies / mL, 1.0×10 9 copies / mL, 1.0×10 8 copies / mL, 1.0×10 7 copies / mL, 1.0×10 6 copies / mL, 1.0×10 5 copies / mL, 1.0×10 4 copies / mL, 1.0×10 3 copies / mL, 1.0×10 2 The curve corresponding to copies / mL of the PPV gene; Figure 7 The sensitivity curves for multiplex TaqMan quantitative PCR against JEV virus are shown. From left to right, they are 1.0 × 10 11 copies / mL, 1.0×10 10 copies / mL, 1.0×10 9 copies / mL, 1.0×10 8 copies / mL, 1.0×107 copies / mL, 1.0×10 6 copies / mL, 1.0×10 5 copies / mL, 1.0×10 4 copies / mL, 1.0×10 3 copies / mL, 1.0×10 2 The curve corresponding to copies / mL of the JEV gene; Figure 8 The sensitivity curve for GETV virus analysis using multiplex TaqMan quantitative PCR; From left to right, they are 1.0 × 10 11 copies / mL, 1.0×10 10 copies / mL, 1.0×10 9 copies / mL, 1.0×10 8 copies / mL, 1.0×10 7 copies / mL, 1.0×10 6 copies / mL, 1.0×10 5 copies / mL, 1.0×10 4 copies / mL, 1.0×10 3 copies / mL, 1.0×10 2 The curve corresponding to copies / mL GETV gene; Figure 9 Sensitivity analysis curves for simultaneous detection of PPV virus, JEV virus and GETV virus using multiplex TaqMan real-time PCR. Detailed Implementation

[0021] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0022] Example 1: Design of primers for simultaneous detection of PPV, JEV and GETV in multiplex real-time PCR Primers and probes were designed based on the sequences of the PPV-NS1, JEV-E, and GETV-E2 genes in GenBank. The PPV probe was labeled with a FAM fluorescent group at the 5' end and a BHQ1 group at the 3' end; the JEV probe was labeled with a VIC fluorescent group at the 5' end and a BHQ1 group at the 3' end; and the GETV probe was labeled with a CY5 fluorescent group at the 5' end and a BHQ2 group at the 3' end, to avoid fluorescence interference and improve detection accuracy. Information on each primer and probe is shown in Table 1 below.

[0023] Table 1 Primer and probe sequences for PPV / JEV / GETV

[0024] Note: In the table, F represents the upstream primer, R represents the downstream primer, and P represents the probe sequence.

[0025] Example 2: Preparation of recombinant plasmid standards for PPV, JEV and GETV Synthesize the target gene sequences of PPV, JEV and GETV. The PPV target gene sequences are as follows: gaagactggatgatgacagatccagacagttatatagaaatgatggctcaaaccggaggagaaaatttaatcaaaaatacactagaaataacaactcttactctagcaagaacaaaaacagca, SEQ ID NO. 10; The JEV target gene sequences are as follows: tgctatcacgcttcagtcactgacatttcaacggtggctcgatgccccacgactggagaagcccacaacgaaaaacgtgctgacagcagctacgtgtgtgcaaacaaggctttactgaccgcggatggggaaatggatgcggacttttcgggaaaggaagcattgacacatg, SEQ ID NO. 11; The target gene sequences of GETV are as follows: caaagtgcagtacaaacacgctccggccccagtaggcagagaaaaattcaccgtcaggccccacttcggtatcgaagtgccatgcacaacgtaccagctgactaccgcaccgacggaggaagagatcgacatgcatac, SEQID NO.12; Standard plasmids pUC57-PPV, pUC57-JEV, and pUC57-GETV were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and preserved in the laboratory. The concentration of the standard plasmids was determined using a NanoDrop 2000C (Thermo Fisher Scientific). The gene copy number was calculated using the following formula: Y (copies / μL) = [plasmid DNA concentration (ng / mL) × 10⁻⁶] -6 [(plasmid DNA length in bp × 660)] × 6.02 × 10 23 The gene copy numbers of the standard plasmids were determined to be: pUC57-PPV (3.95 × 10⁻⁶). 12 copies / mL), pUC57-JEV (3.95×10 12 copies / mL), pUC57-GETV (4.57×10 12 (copies / mL).

[0026] Example 3: Reaction conditions and reaction system for a multiplex real-time PCR kit for simultaneous detection of PPV, JEV, and GETV. The 20 μL multiplex TaqMan real-time PCR reaction system established in this invention comprises: 2×One Step Q Probe Mix: 10 μL, One Step Q Probe Enzyme Mix: 1 μL, forward and reverse primers: 0.4 μL each (final concentration 0.2 μM), probe: 0.2 μL (final concentration 0.1 μM), template DNA or cDNA: 4 μL, nuclease-free water to bring the total to 20 μL.

[0027] The reaction conditions for quantitative real-time PCR are as follows: 55℃ for 5 min; 95℃ for 30 s; 95℃ for 10 s; 60℃ for 30 s, 40 cycles, simultaneously acquiring fluorescence values ​​from three channels: FAM, VIC, and Cy5.

[0028] Example 4: Standards of known concentrations were diluted 3.95 times or 4.57 times, and then subjected to corresponding serial dilutions to obtain the following concentrations: 1.0×10 11 -1.0×10 2 PPV positive plasmid copies / mL, 1.0×10 11 -1.0×10 2 JEV positive plasmids of 1.0 × 10 copies / mL 11 -1.0×10 2 GETV positive plasmid copies / mL.

[0029] Perform quantitative real-time PCR detection under the above reaction conditions and establish a standard curve.

[0030] The standard curve for the primers and probes targeting PPV is Y = -3.495x + 36.593, R0 2 =0.999, amplification efficiency of 93.3% ( Figure 1 ); The standard curve for the primers and probes targeting JEV is Y = -3.425x + 36.383, R0 2 =1.000, amplification efficiency of 95.9% ( Figure 2 ); The standard curve for the primers and probes targeting GETV is Y = -3.395x + 35.470, R0 2 =0.999, amplification efficiency of 97.0% ( Figure 3 ).

[0031] Standard curves for simultaneous detection of PPV, JEV, and GETV are as follows: Figure 4 As shown.

[0032] As can be seen, the standard curves of the three viruses all have high linear correlation (R² ≥ 0.999) and ideal amplification efficiency (93.3%~97.0%), which meets the needs of accurate detection of low-copy viruses in clinical samples.

[0033] Example 5: Specificity test of multiplex quantitative PCR To verify the specificity of the multiplex quantitative PCR detection method established in this invention, common porcine reproductive and respiratory syndrome virus (PRRSV), porcine epidemic diarrhea virus (PEDV), classical classical swine fever virus (CSFV), pseudorabies virus (PRV), transmissible gastroenteritis virus (TGEV), porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), African swine fever virus (ASFV), porcine swine fever virus (PTV), Streptococcus suis (SS), and Haemophilus parasuis (HPS) were selected as detection templates. Simultaneously, pUC57-PPV, pUC57-JEV, and pUC57-GETV standard plasmids were used as positive controls, and nuclease-free water was used as a negative control, and amplification and detection were performed under the same reaction conditions. The specific recognition ability of this method for PPV, JEV, and GETV was evaluated by analyzing whether non-target pathogens produced amplification signals.

[0034] Experimental results are as follows Figure 5As shown in the figure, in the TaqMan real-time PCR specificity verification experiment for PPV, JEV and GETV, only the positive control group using pUC57-PPV, pUC57-JEV and pUC57-GETV standard plasmids as templates showed typical S-shaped amplification curves with reasonable Ct value distribution. In contrast, the negative control group using 11 common porcine pathogens such as PRRSV, PEDV, CSFV, PRV, TGEV, PCV2, PCV3, ASFV, PTV, SS, HPS and nuclease-free water as templates did not show any amplification signals.

[0035] The above results demonstrate that the primer-probe combination designed in this invention can specifically recognize the target viral gene and does not cross-react with non-target pathogens, effectively avoiding the risk of false positives caused by primer dimers or non-specific amplification. Therefore, this detection method has high specificity and is suitable for the accurate differential diagnosis of PPV, JEV, and GETV in clinical samples.

[0036] Example 6: Sensitivity testing of multiplex quantitative PCR Take a known concentration of pUC57-PPV (3.95 × 10⁻⁶). 12 copies / mL), pUC57-JEV (3.95×10 12 (copies / mL) and pUC57-GETV (4.57×10) 12 The standard plasmid (copies / mL) was initially diluted 3.95-fold or 4.57-fold, and then further serially diluted 10-fold to obtain a final coverage of 1.0 × 10⁻⁶ copies / mL. 11 Up to 1.0×10 2 copies / mL (PPV), 1.0×10 11 Up to 1.0×10 2 copies / mL (JEV) and 1.0 × 10 11 Up to 1.0×10 2 Ten concentration gradient template solutions of copies / mL (GETV).

[0037] Each dilution group was used as a template in the multiplex real-time PCR reaction system, and the optimized primer-probe combination and amplification program of this invention were used for detection.

[0038] Experimental results show that ( Figure 6-9 The detection of all three viruses showed a good concentration gradient response relationship. PPV detection sensitivity: at 1.0 × 10 11 Up to 1.0×10 2Within the range of copies / mL, the amplification curve exhibits a typical S-shape, with a minimum detectable concentration of 1.0 × 10⁻⁶. 2 copies / mL.

[0039] JEV detection sensitivity: at 1.0 × 10 11 Up to 1.0×10 2 Within the range of copies / mL, the amplification curve exhibits a typical S-shape, with a minimum detectable concentration of 1.0 × 10⁻⁶. 2 copies / mL.

[0040] GETV detection sensitivity: at 1.0 × 10⁻⁶ 11 Up to 1.0×10 2 Within the range of copies / mL, the amplification curve exhibits a typical S-shape, with a minimum detectable concentration of 1.0 × 10⁻⁶. 2 copies / mL.

[0041] The above results indicate that this method has excellent sensitivity for the detection of all three viruses. Therefore, the primers and kits provided by this invention have a strong detection capability for samples with low viral load (such as animals in the early infection or recovery period).

[0042] Example 7: Repeatability test of multiplex quantitative PCR Five consecutive dilutions of standard plasmids were selected, and three batches of tests were performed using the established multiplex quantitative PCR method. Three replicates were set for each dilution within each batch. The obtained Ct values ​​were statistically analyzed, and the coefficients of variation within and between groups were calculated.

[0043] The test results are shown in Tables 2-4.

[0044] Table 2. Repeatability test results for PPV virus

[0045] Table 3. Repeatability test results for JEV virus

[0046] Table 4. Repeatability test results of GETV virus

[0047] As can be seen from the results in Tables 2-4, PCR performed using the primers and system of this invention has good intra-group repeatability and inter-group stability.

[0048] Specifically, the coefficient of variation (CV%) within the group ranged from 0.04% to 0.81%, indicating that the amplification results among the replicate wells within the same experimental batch were highly consistent, with very small data dispersion, reflecting the high homogeneity of the reaction system and the consistency of the operation.

[0049] Meanwhile, the coefficient of variation (CV%) between groups ranged from 0.11% to 0.95%, indicating that the test results maintained good stability and repeatability between different experimental batches, and no significant deviations were caused by differences between reagent batches, instrument fluctuations or changes in operators.

[0050] In summary, multiplex quantitative PCR not only possesses high sensitivity and good specificity, but also demonstrates outstanding performance in reproducibility and stability, making it suitable for rapid and accurate detection of large-scale clinical samples and showing promising prospects for widespread application.

Claims

1. A multiplex TaqMan real-time PCR primer and probe combination for simultaneous detection of porcine parvovirus (PPV), Japanese encephalitis virus (JEV), and gehtavirus (GETV), characterized in that, The multiplex TaqMan real-time PCR primer and probe combination includes: PPV primers and PPV probes, JEV primers and JEV probes, and GETV primers and GETV probes; The upstream primer sequence of the PPV primer is shown in SEQ ID NO.1, and the downstream primer sequence of the PPV primer is shown in SEQ ID NO.2; The sequence of the PPV probe is shown in SEQ ID NO.3, and the 5' end of the PPV probe is labeled with a FAM fluorescent group and the 3' end is labeled with a BHQ1 quenching group. The upstream primer sequence of the JEV primer is shown in SEQ ID NO.4, and the downstream primer sequence of the JEV primer is shown in SEQ ID NO.5; The sequence of the JEV probe is shown in SEQ ID NO.6, and the 5' end of the JEV probe is labeled with a VIC fluorescent group and the 3' end is labeled with a BHQ1 quenching group. The upstream primer sequence of the GETV primer is shown in SEQ ID NO.7, and the downstream primer sequence of the GETV primer is shown in SEQ ID NO.8; The sequence of the GETV probe is shown in SEQ ID NO.9, and the 5' end of the GETV probe is labeled with the CY5 fluorescent group, and the 3' end is labeled with the BHQ2 quencher group.

2. The multiplex TaqMan real-time PCR primer-probe combination according to claim 1, characterized in that, The PPV target sequence targeted by the PPV primers and PPV probes is shown in SEQ ID NO.10; The JEV target sequence targeted by the JEV primers and JEV probes is shown in SEQ ID NO.11; The GETV target sequence targeted by the GETV primers and GETV probes is shown in SEQ ID NO.

12.

3. A multiplex TaqMan real-time PCR kit for simultaneous detection of porcine parvovirus (PPV), Japanese encephalitis virus (JEV), and gehtavirus (GETV), characterized in that, The multiplex TaqMan quantitative PCR kit includes the multiplex TaqMan quantitative PCR primer and probe combination as described in claim 1.

4. The multiplex TaqMan real-time PCR kit according to claim 3, characterized in that, The TaqMan multiplex PCR kit also includes 2×One Step Q Probe Mix, One Step Q Probe EnzymeMix, nuclease-free water, and positive and negative controls.

5. The multiplex TaqMan real-time PCR kit according to claim 4, characterized in that, The composition of each 20 μL PCR reaction system of the TaqMan multiplex PCR kit is as follows: 2×One Step Q Probe Mix: 10 μL; One Step Q Probe Enzyme Mix: 1 μL; PPV upstream primer: 0.4 μL; PPV downstream primer: 0.4 μL; PPV probe: 0.2 μL; JEV upstream primer: 0.4 μL; JEV downstream primer: 0.4 μL; JEV probe: 0.2 μL; GETV upstream primer: 0.4 μL; GETV downstream primer: 0.4 μL; GETV probe: 0.2 μL; template DNA or cDNA: 4 μL; nuclease-free water: bring to 20 μL.

6. The multiplex TaqMan real-time PCR kit according to claim 5, characterized in that, The PCR reaction conditions for the TaqMan multiplex real-time PCR kit are as follows: reverse transcription at 55℃ for 5 min; denaturation at 95℃ for 30 s; pre-denaturation at 95℃ for 10 s; annealing / extension at 60℃ for 30 s, for a total of 40 cycles; fluorescence values ​​of the FAM, VIC and Cy5 channels are collected simultaneously.

7. The multiplex TaqMan real-time PCR kit according to claim 6, characterized in that, The limits of detection for PPV, JEV, and GETV in the aforementioned multiplex TaqMan quantitative PCR kit are all 1.0 × 10⁻⁶. 2 copies / mL.

8. The application of the multiplex TaqMan real-time PCR primer-probe combination as described in claim 1 in the preparation of diagnostic reagents for porcine reproductive disorders.

Images