MRNA encoding monoclonal antibody and application thereof

Abstract

The invention relates to the technical field of biology, and discloses mRNA (messenger Ribonucleic Acid) for coding a monoclonal antibody and application thereof. The mRNA for coding the antibody comprises mRNA for coding a light chain and mRNA for coding a heavy chain; wherein the sequences for coding the heavy chains CDR1, CDR2 and CDR3 are respectively the 201th to 215th sites, the 258th to 305th sites and the 402th to 4466th sites as shown in SEQ ID NO: 1, and the sequences for coding the light chains CDR1, CDR2 and CDR3 are respectively the 180th to 212th sites, the 258th to 278th sites and the 375th to 401th sites as shown in SEQ ID NO: 2. The mRNA of the coding antibody is delivered into the body of an animal, so that the animal can be effectively protected from infection of various yellow fever viruses.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an mRNA encoding an antibody and an mRNA formulation, and the use of the mRNA or mRNA formulation encoding an antibody in the preparation of a medicament for the prevention and / or treatment of yellow fever virus infection. Background Technology

[0002] Yellow fever virus belongs to the genus Flavivirus in the family Flaviviridae. It is one of the most important mosquito-borne flaviviruses in the world. Humans bitten by infected mosquitoes may experience mild symptoms such as fever, headache, and joint pain. Severe cases can lead to jaundice, bleeding, high fever, shock, organ failure, and even death. Globally, 80,000 to 200,000 people are infected with yellow fever virus annually, with 30,000 to 78,000 deaths, seriously threatening human health and social development. Currently, although a live attenuated vaccine for yellow fever virus is available clinically, there are still problems such as vaccine shortages and low vaccination rates. Furthermore, there are no approved specific treatments for yellow fever virus; treatment is mainly symptomatic and supportive, focusing on managing complications. Developing safe and effective specific drugs to effectively address the threat of yellow fever virus infection is of significant practical importance.

[0003] Yellow fever virus neutralizing antibodies can effectively inhibit viral invasion by suppressing viral adhesion to host cells or the fusion of the viral envelope with the cell membrane, demonstrating good protective effects against challenge in animal models of yellow fever virus infection. However, the preparation of traditional protein antibody drugs relies on cell or bacterial culture, which is time-consuming and costly, limiting their practical clinical accessibility. In contrast, introducing mRNA encoding yellow fever virus antibodies into the body via a delivery system, using the body's cells as a bioreactor to produce antibodies and exert antiviral functions, has unique technological advantages: mRNA antibody preparation is mainly achieved through in vitro synthesis, which facilitates large-scale production and cost control, with a short production cycle and rapid response. Therefore, developing yellow fever virus mRNA antibodies using mRNA technology can, to some extent, overcome the bottlenecks in the production and preparation of traditional protein antibody drugs.

[0004] While there are existing reports of delivering antibody-encoding mRNA into the body to allow the body's cells to express the corresponding antibodies and exert biological functions, researchers at the U.S. Army Medical Research Institute of Infectious Diseases found that although antibody production was detectable in rabbits after introducing mRNA encoding poxvirus neutralizing antibodies via a delivery system, the level of neutralizing antibodies was low, making it unlikely to provide protection against poxvirus infection and failing to achieve the expected technical effect. This result indicates that the development of mRNA antibodies based on antibody sequences using mRNA technology has unpredictable technical effects. Furthermore, there are currently no publicly available reports of mRNA encoding yellow fever virus antibodies that can generate protective antibodies in the body. Summary of the Invention

[0005] The purpose of this invention is to overcome the problems existing in the prior art and provide an mRNA encoding an antibody and an mRNA preparation, as well as the application of the mRNA encoding an antibody or the mRNA preparation in the preparation of a drug for the prevention and / or treatment of yellow fever virus infection. The mRNA encoding the antibody is delivered into the animal body to effectively protect the animal from yellow fever virus infection.

[0006] To achieve the above objectives, a first aspect of the present invention provides an mRNA encoding an antibody, wherein the mRNA encoding the antibody comprises: an mRNA encoding a light chain and an mRNA encoding a heavy chain; wherein,

[0007] The sequences encoding the heavy chains CDR1, CDR2, and CDR3 are positions 201-215, 258-305, and 402-446 as shown in SEQ ID NO: 1, or sequences having more than 90% homology with positions 201-215, 258-305, and 402-446 as shown in SEQ ID NO: 1; the sequences encoding the light chains CDR1, CDR2, and CDR3 are positions 180-212, 258-278, and 375-401 as shown in SEQ ID NO: 2, or sequences having more than 90% homology with positions 180-212, 258-278, and 375-401 as shown in SEQ ID NO: 2.

[0008] A second aspect of the present invention provides an mRNA formulation, wherein the mRNA formulation contains mRNA encoding an antibody provided by the present invention.

[0009] A third aspect of the present invention provides the use of the mRNA encoding an antibody provided by the present invention or the mRNA preparation provided by the present invention in the preparation of a medicament for the prevention and / or treatment of yellow fever virus infection.

[0010] The beneficial effects of the present invention through the above technical solution include at least the following:

[0011] The antibody-encoding mRNA provided by this invention can produce a protective effect against challenge in animal infection models. Introducing the messenger ribonucleic acid (mRNA) encoding the antibody provided by this invention into animals, and using animal cells as a bioreactor to express yellow fever virus neutralizing antibodies, can effectively protect animals against yellow fever virus infection. Production does not rely on cell culture, and the production process and procedures are easily standardized, which is beneficial for large-scale production and cost control. Expressing antibodies within body cells can produce naturally occurring antibody post-translational modifications and easily overcomes the limitation of traditional protein antibodies that can only neutralize extracellular free viruses.

[0012] In a preferred embodiment of the present invention, by appropriately combining the mRNA encoding the light chain with the mRNA encoding the heavy chain, the mRNA encoding the heavy chain including the sequence shown in SEQ ID NO: 1 and the mRNA encoding the light chain including the sequence shown in SEQ ID NO: 2 are combined and introduced into the animal body, and the animal body cells are used as a bioreactor to express the yellow fever virus neutralizing antibody, thereby further improving the animal's ability to resist yellow fever virus infection. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of the construction strategy for the mRNA encoding yellow fever virus antibody in Embodiment 1 of the present invention;

[0014] Figure 2 This is a schematic diagram of the in vitro expression activity detection results of mRNA encoding yellow fever virus antibody in Example 2 of the present invention;

[0015] Figure 3 This is a schematic diagram of the particle size detection results of the mRNA preparation mRNA-5A-LNP in Example 3 of the present invention;

[0016] Figure 4 This is a schematic diagram showing the results of neutralizing antibody titers in mouse serum injected with the mRNA preparation mRNA-5A-LNP in Example 4 of the present invention;

[0017] Figure 5 A is a schematic diagram of the results of the preventive administration test of the mRNA preparation mRNA-5A-LNP in a yellow fever virus mouse infection model in Example 5 of the present invention;

[0018] Figure 5 B is a schematic diagram of the therapeutic administration results of the mRNA preparation mRNA-5A-LNP in a yellow fever virus mouse infection model in Example 5 of this invention. Detailed Implementation

[0019] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0020] A first aspect of the present invention provides an mRNA encoding an antibody, wherein the mRNA encoding the antibody comprises: an mRNA encoding a light chain and an mRNA encoding a heavy chain; wherein,

[0021] The sequences encoding heavy chains CDR1, CDR2, and CDR3 are positions 201-215, 258-305, and 402-446 of SEQ ID NO: 1, respectively, or sequences that are homologous to positions 201-215, 258-305, and 402-446 of SEQ ID NO: 1 with a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any two of the above values); the sequences encoding light chains CDR1, CDR2, and CDR3 are positions 180-212, 258-278, and 375-401 of SEQ ID NO: 2, respectively, or sequences that are homologous to positions 201-215, 258-305, and 402-446 of SEQ ID NO: 1 with a homology of more than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any two of the above values) of SEQ ID NO: 1. The sequences shown in NO:2, with positions 180-212, 258-278, and 375-401 having a homology of 90% or more (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any two of the above values ​​and values ​​within that range), are homologous.

[0022] According to the present invention, preferably, the sequences of the heavy chains CDR1, CDR2, and CDR3 are positions 201-215, 258-305, and 402-446 as shown in SEQ ID NO: 1, and the sequences of the light chains CDR1, CDR2, and CDR3 are positions 180-212, 258-278, and 375-401 as shown in SEQ ID NO: 2.

[0023] According to the present invention, preferably, in the mRNA encoding the antibody, the mass ratio of the mRNA encoding the light chain to the mRNA encoding the heavy chain is 1:(1-3).

[0024] In this invention, CDR analysis can be performed using the website http: / / www.abysis.org / abysis / sequence_input / key_annotation / key_annotation.cgi. CDR can be determined using methods such as Kabat, Chothia, and IMGT.

[0025] In a preferred embodiment of the present invention, the coding region sequence of the mRNA encoding the heavy chain is positions 54-1472 as shown in SEQ ID NO: 1, or a sequence having more than 90% homology with positions 54-1472 as shown in SEQ ID NO: 1 (for example, it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%).

[0026] And / or, the coding region sequence of the mRNA encoding the light chain is positions 54-755 as shown in SEQ ID NO: 2, or a sequence having more than 90% homology with positions 54-755 as shown in SEQ ID NO: 2 (for example, it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%).

[0027] In a preferred embodiment of the present invention, the signal peptide sequence in the coding region of the mRNA encoding the heavy chain is position 54-110 as shown in SEQ ID NO: 1, or a sequence having more than 90% homology with position 54-110 as shown in SEQ ID NO: 1 (for example, it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%).

[0028] And / or, the signal peptide sequence in the coding region of the mRNA encoding the light chain is position 54-110 of SEQ ID NO: 2, or a sequence having more than 90% homology with position 54-110 of SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%).

[0029] According to the present invention, preferably, the mRNA encoding the light chain and the mRNA encoding the heavy chain each independently contain a tandemly linked 5' uncoding region sequence, a coding region sequence, and a 3' uncoding region sequence.

[0030] In this invention, tandem linkage refers to connecting polynucleotide elements in a functional manner, and the linked polynucleotide sequences are continuous.

[0031] According to the present invention, preferably, the 5' untranslated region sequence of the mRNA encoding the heavy chain is the first to fourth positions shown in SEQ ID NO: 1, or a sequence having more than 90% homology with the first to fourth positions shown in SEQ ID NO: 1 (for example, it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%).

[0032] And / or, the 3' untranslated region sequence of the mRNA encoding the heavy chain is positions 1482-1595 as shown in SEQ ID NO: 1, or a sequence having more than 90% homology with positions 1482-1595 as shown in SEQ ID NO: 1 (e.g., it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%);

[0033] According to the present invention, preferably, the 5' untranslated region sequence of the mRNA encoding the light chain is the first to fourth positions shown in SEQ ID NO: 2, or a sequence having more than 90% homology with the first to fourth positions shown in SEQ ID NO: 2 (for example, it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%).

[0034] And / or, the 3' untranslated region sequence of the mRNA encoding the light chain is position 765-878 as shown in SEQ ID NO: 2, or a sequence having more than 90% homology with position 765-878 as shown in SEQ ID NO: 2 (e.g., it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%).

[0035] In a preferred embodiment of the present invention, the sequence of the mRNA encoding the heavy chain includes the sequence shown in SEQ ID NO: 1, or a sequence having more than 90% homology with the sequence shown in SEQ ID NO: 1 (for example, it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or any two of the above values ​​and values ​​within the range, preferably 100%).

[0036] And / or, the sequence of the mRNA encoding the light chain includes the sequence shown in SEQ ID NO: 2, or a sequence having more than 90% homology with the sequence shown in SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any two of the above values ​​and values ​​within that range, preferably 100%).

[0037] In a most preferred embodiment of the present invention, the sequence of the mRNA encoding the heavy chain includes the sequence shown in SEQ ID NO: 1, and the sequence of the mRNA encoding the light chain includes the sequence shown in SEQ ID NO: 2.

[0038] According to the present invention, preferably, the downstream of the 3' untranslated region sequence of the mRNA encoding the heavy chain and the downstream of the 3' untranslated region sequence of the mRNA encoding the light chain each further include a polyadenylated acid (poly A) sequence, wherein the degree of polymerization of the polyadenylated acid is 50-250. The downstream end is located closer to the 3' end in the 5'→3' direction.

[0039] In this invention, cap structures can be flexibly added to the 5' end of the mRNA encoding the light chain and the 5' end of the mRNA encoding the heavy chain, depending on the requirements of different mRNAs. In a preferred embodiment, the cap structures at the 5' ends of the mRNA encoding the light chain and the mRNA encoding the heavy chain are respectively m7G(5')ppp(5')G(2'OMe)pG, m7G(5')vppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pG, or m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

[0040] In some preferred embodiments of the present invention, the 5' cap structure of the mRNA encoding the light chain is m7G(5')ppp(5')G(2'OMe)pG, and the 5' cap structure of the mRNA encoding the heavy chain is m7G(5')ppp(5')G(2'OMe)pG.

[0041] A second aspect of the present invention provides an mRNA formulation, wherein the mRNA formulation contains mRNA encoding an antibody provided by the present invention.

[0042] According to the present invention, preferably, the mRNA formulation further comprises a delivery carrier, wherein the delivery carrier is a liposome nanoparticle (LNP).

[0043] In a specific embodiment of the present invention, the mRNA formulation is prepared by the following method: the mRNA stock solution is encapsulated in nanolipospheres, then dialyzed in phosphate buffer solution, followed by concentration and filtration; wherein the mRNA stock solution is the antibody-encoding mRNA provided by the present invention. In the mRNA stock solution, the mass ratio of mRNA encoding the light chain to mRNA encoding the heavy chain is 1:(1-3).

[0044] In a specific embodiment of the present invention, NanoAssemblr Ignite is used. + The LNP lipid nanoparticle drug manufacturing system rapidly mixes the mRNA stock solution with a lipid excipient combination (e.g., purchased from Suzhou Abogen Pharmaceutical Group Co., Ltd.) to encapsulate the antibody-encoding mRNA in nanoliposomes, obtaining the mRNA-LNP formulation. The mRNA-LNP formulation is then dialyzed in phosphate-buffered saline (PBS solution, e.g., purchased from VIVICUM) at 4°C for 16-24 hours, followed by ultrafiltration concentration using a 100 kDa ultrafiltration tube (e.g., purchased from Merck Millipore), and then filtered through a PES filter (e.g., purchased from Jiangsu Green Alliance Scientific Instruments Co., Ltd.) to obtain the mRNA formulation mRNA-5A-LNP.

[0045] In preferred cases, the average particle size of the mRNA formulation mRNA-5A-LNP is 50-120 nm. The average particle size of mRNA-5A-LNP can be detected using an Unchained Labs Stunner high-throughput particle size analyzer.

[0046] A third aspect of the present invention provides the use of the mRNA encoding an antibody provided by the present invention or the mRNA preparation provided by the present invention in the preparation of a medicament for the prevention and / or treatment of yellow fever virus infection, wherein the yellow fever virus can be a different yellow fever virus strain.

[0047] The antibody-encoding mRNA provided by this invention can encode a fully human monoclonal antibody 5A targeting the yellow fever virus E protein.

[0048] According to the present invention, the mRNA preparation can be delivered into an animal via injection, such as intravenous or intramuscular injection. The animal can be any living animal, preferably a mammal, such as a mouse, rat, hamster, rabbit, non-human primate, or human. The injection dosage is adjusted according to the tolerance of different organisms; for example, for 6-8 week old female BABL / c mice, the amount of mRNA preparation injected per kg of body weight is 0.04-5 mg.

[0049] The present invention will be described in detail below through examples and comparative examples. Unless otherwise specified, the following examples and comparative examples are all conventional methods; the reagents and materials used are commercially available unless otherwise specified.

[0050] Example 1

[0051] This embodiment illustrates the design and synthesis method of mRNA encoding yellow fever virus antibodies.

[0052] (1) mRNA design methods

[0053] Based on the amino acid sequences of the heavy and light chains of the fully human monoclonal antibody 5A targeting the yellow fever virus E protein, mRNAs encoding the heavy and light chains of the yellow fever virus neutralizing antibody 5A were further designed. Following the sense strand (5'→3' direction), the mRNAs sequentially include the following elements: a 5' untranslated region (5'UTR), a signal peptide, antibody heavy / light chain coding regions (excluding the signal peptide), a 3' untranslated region (3'UTR), and a poly A tail. A schematic diagram of the mRNAs encoding the antibody light and heavy chains is shown below. Figure 1The specific sequences encoding the antibody heavy chain mRNA constructs are shown in SEQ ID NO: 1, with a poly A tail downstream (SEQ ID NO: 1 + poly A tail), and the sequences encoding the antibody light chain mRNA constructs are shown in SEQ ID NO: 2, with a poly A tail downstream (SEQ ID NO: 2 + poly A tail), both given as the positive strand (5'-3'). The signal peptide sequences encoding the antibody heavy and light chains are positions 54-110 in SEQ ID NO: 1 and 54-110 in SEQ ID NO: 2, respectively. The CDR1, CDR2, and CDR3 sequences encoding the antibody heavy chain mRNA are positions 201-215, 258-305, and 402-446 in SEQ ID NO: 1, respectively. The CDR1, CDR2, and CDR3 sequences of the constructed mRNA encoding the antibody light chain are positions 180-212, 258-278, and 375-401, respectively, as shown in SEQ ID NO: 2. The CDR analysis of this invention was performed using the website http: / / www.abysis.org / abysis / sequence_input / key_annotation / key_annotation.cgi.

[0054] The 5'UTR RNA sequence and 3'UTR RNA sequence in the above mRNA constructs are shown in Table 1.

[0055] Table 1

[0056]

[0057] (2) Methods of mRNA synthesis

[0058] Based on the optimized antibody heavy and light chain nucleotide sequences and expression vector ABOP-028 (Zhang NN, et al. A Thermostable mRNA Vaccine against COVID-19. doi:10.1016 / j.cell.2020.07.024), the corresponding antibody heavy chain transcription template plasmid pAB028-5A-HC and antibody light chain DNA transcription template plasmid pAB028-5A-LC were further constructed. The constructed antibody heavy and light chain transcription template plasmids were linearized using the restriction endonuclease Bsa I (purchased from NEB). Using linearized plasmids of the antibody heavy chain and the antibody light chain as templates, in vitro transcription (IVT) was performed using the T7 High Yield RNA Transcription Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). DNase I was added to the reaction system to digest the transcribed DNA template. The transcribed mRNA was purified using lithium chloride (purchased from Invitrogen). A one-step capping reaction was performed on the obtained mRNA using a vaccinia virus capping system (purchased from Nanjing Novizan Biotechnology Co., Ltd.) and mRNA cap structure 2'-O-methyltransferase (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The capped mRNA was purified by adding 7.5M lithium chloride solution (purchased from Invitrogen), finally obtaining mRNA encoding the antibody heavy chain (mRNA-5A-HC) and mRNA encoding the antibody light chain (mRNA-5A-LC).

[0059] Example 2

[0060] This example illustrates the identification of in vitro expression of mRNA encoding antibodies.

[0061] One day before transfection, BHK-21 cells (ATCC, #CCL-10) were prepared at a rate of 1×10⁻⁶. 6Cells were transferred to 6-well plates at a density of cells / mL. When the cell confluence reached 70-90%, BHK-21 cells were transfected using the Lipofectamine Messenger MAX liposome transfection kit (Thermo Fisher Scientific). mRNA-5A-LC and mRNA-5A-HC were co-transfected into BHK-21 cells at mass ratios of 1:1, 1:2, and 1:3 (mRNA-5A-LC:mRNA-5A-HC), respectively. After 6 hours, the cell supernatant was discarded and replaced with Opti-MEM medium (Thermo Fisher Scientific). The control group followed the same procedures as the experimental group, except that mRNA-5A-HC and mRNA-5A-LC were not added. Twenty-four hours after transfection, cell supernatants from the experimental and control groups were collected. The human immunoglobulin G (IgG) ELISA kit (purchased from Sangon Biotech Shanghai Co., Ltd.) was used to detect the human IgG antibody content in the cell transfection supernatant. The method was as follows: A 100 ng / mL standard working solution was prepared and serially diluted to 100 ng / mL, 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.13 ng / mL, 1.56 ng / mL, and 0 ng / mL. 100 μL of standard working solution or test sample was added to each well, and the plate was sealed and incubated at 37°C for 90 min. The liquid was discarded, and 100 μL of biotin-labeled immunoglobulin G antibody working solution was added to each well. The plate was sealed and incubated at 37°C for 60 min. The liquid was discarded, and the plate was washed 5 times with washing buffer. 100 μL of the solution was added to each well. HRP-labeled streptavidin working solution was used to seal the plate and incubate it at 37°C for 30 min. The liquid was discarded, and the plate was washed 5 times with washing buffer. 90 μL of chromogenic reagent was added to each well, and the plate was sealed and incubated at 37°C in the dark for 15 min. 50 μL of stop solution was added to each well. The plate was placed in a microplate reader, set to dual wavelengths (450 nm main wavelength and 630 nm reference wavelength) to detect OD values. A standard curve was plotted with standard concentration on the x-axis and OD values ​​on the y-axis. The human IgG antibody content (ng / mL) in the sample was further calculated. The detection results are as follows: Figure 2 As shown, by Figure 2 It can be seen that co-transfection of mammalian cells with mRNA-5A-LC and mRNA-5A-HC can successfully express human IgG antibodies. The expression efficiency is best when mRNA-5A-LC and mRNA-5A-HC are co-transfected at a mass ratio of 1:2 (mRNA-5A-LC:mRNA-5A-HC), and the corresponding cell transfection supernatant has the highest IgG content. Therefore, a mass ratio of 1:2 was chosen for subsequent experiments.

[0062] Example 3

[0063] This example illustrates the LNP encapsulation of mRNA encoding yellow fever virus antibodies.

[0064] The mRNA-5A-HC and mRNA-5A-LC obtained in Example 1 were mixed at a mass ratio of 1:2 to obtain the mRNA stock solution encoding the 5A antibody. NanoAssemblr Ignite was used to... + The LNP lipid nanoparticle drug manufacturing system performs counter-mixing of antibody mRNA stock solution and lipid excipients (purchased from Suzhou Abogen Pharmaceutical Co., Ltd.), encapsulating the mRNA encoding the heavy and light chains of the antibody in liposphere nanoparticles to obtain the mRNA-LNP formulation. The mRNA-LNP formulation is then dialyzed overnight at 4°C in PBS solution (purchased from VIVICUM), followed by ultrafiltration concentration using a 100 kDa ultrafiltration tube (purchased from Merck Millipore) and filtration through a PES filter (purchased from Jiangsu Green Alliance Scientific Instruments Co., Ltd.) to obtain the mRNA formulation, named mRNA-5A-LNP. The particle size of mRNA-5A-LNP is detected using an UnchainedLabs Stunner high-throughput particle size analyzer. The detection results are as follows: Figure 3 As shown, by Figure 3 It can be seen that the obtained mRNA-5A-LNP particle size is approximately 79.07 nm, which is consistent with the expected particle size range (50-120 nm).

[0065] Example 4

[0066] This example illustrates the identification of in vivo expression of mRNA encoding yellow fever virus antibodies.

[0067] The mRNA-5A-LNP prepared in Example 3 was injected intravenously into 6-8 week old female BABL / c mice at doses of 1 mg / kg and 0.3 mg / kg, respectively. Blood was collected from the mice 24 hours after injection, and serum was separated. The serum was inactivated at 56°C for 30 min and then used for the Plaque Reduction Neutralization Test (PRNT). The method was as follows: the serum sample to be tested was serially diluted 3 times by volume with 2% FBSDMEM medium maintenance medium, mixed with an equal volume of YFV-17D virus solution, and incubated at 37°C for 1 h. The virus-sample mixture (300 μL / well) was added to a 12-well culture plate containing a monolayer of dense BHK-21 cells and cultured at 37°C for 1 h, gently shaking several times during the process. Discard the virus-sample mixture. Add an appropriate volume of preheated low-melting-point agarose solution to each well and incubate at 37°C with 5% CO2. On day 4 post-infection, add 4% (w / v) formaldehyde fixative and fix at room temperature for 1 hour. Discard the fixative and agarose cap, rinse once with water, add 0.5% (w / v) crystal violet solution, stain at room temperature for 30 minutes, discard the crystal violet solution, rinse once with water, observe the morphology of the empty spots and count the number of empty spots per well. Calculate the 50% neutralizing antibody titer (PRNT) according to the Karber method. 50 The test results are as follows: Figure 4 As shown, by Figure 4 It can be seen that delivering mRNA encoding yellow fever virus antibody 5A into BABL / c mice can rapidly produce antibodies with neutralizing activity.

[0068] Example 5

[0069] This embodiment is used to illustrate the evaluation of the protective effect of mRNA encoding yellow fever virus antibodies against infection.

[0070] Female BALB / c mice aged 5-6 weeks were randomly divided into three groups: a prophylactic administration group, a treatment administration group, and a control group. The mRNA-5A-LNP prepared in Example 3 was administered to the prophylactic administration group mice via tail vein injection at a dose of 1 mg / kg 24 hours before infection. The mRNA-5A-LNP prepared in Example 3 was administered to the treatment administration group mice via tail vein injection at a dose of 1 mg / kg 24 hours after infection. Yellow fever virus YFV-17D strain (preserved in our laboratory) (1×10⁻⁶) 3 PFU was administered to mice in each group via intracranial injection. The survival status of mice in each group was monitored daily for 21 days post-infection. The survival rate results of mice in the prophylactic administration experiment are shown below. Figure 5 A, Survival rates of mice in the treatment administration experiment are shown in [see details]. Figure 5 B. For example Figure 5As shown in Figure A, all mice in the control group died, while all mice in the mRNA-5A-LNP prophylactic administration group survived, with a survival rate of 100%. Figure 5 As shown in Figure B, all mice in the mRNA-5A-LNP therapeutic group survived, with a survival rate of 100%. These experimental results indicate that mRNA-5A-LNP, as a drug for the prevention and treatment of yellow fever virus infection, can effectively protect BALB / c mice against yellow fever virus infection.

[0071] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

[0072] SEQ ID NO: 1

[0073] CUUGUUCUUUUUGCAGAAGCUCAGAAUAAACGCUCAACUUUGGCGCCGCCACCAUGGGCUG

[0074] GUCAUGCAUCAUCCUGUUCUUGGUGGCCACCGCGACUGGCGUCCACAGUGAGGUGCAGCUG

[0075] GUGGAGAGCGGGCCCAGGCUGGUGAAGCCCAGCGAGACACUGAGCCUGACCUGCACCGUGA

[0076] GCGGCGGCAGCACAUACAACCACCACUGGAGCUGGAUUCGGCAGCCCCCCGGCAGGGGGCUC

[0077] GAGUGGAUUGGGUACAUCAGCUACAGCGGCAAGAGUAACUACAACCCCUCCCUGAAGAGCC

[0078] GGGUCACAAUUAGCCUGGAGCCAUCCACAACCCAGUUUUCCCUCAAGCUGAACAGCCUGACA

[0079] GCCGCCGAUACCGCCGUGUACUACUGCGCCAGGGAGUACCGGGAUGAUACAAACUACUACUA

[0080] CUACAGCCUGGACGUCUGGGGGCCCGGCCAAUGGUGACAGUGAGCAGCGCCUCCACUAAGG

[0081] GGCCCUCCGUGUUCCCCCUCGCCCCCCAGCAGCAAGAGCACAUCCGGGGGCACCGCCGCCCUC

[0082] GGGUGCCUCGUGAAGGACUACUUCCCCGAGCCCGUGACCAGUCUCCUGGAACAGCGGCCCCU

[0083] GACCAGCGGGGUGCACACCUUCCCCGCCGUGCUGCAGAGCUCCGGGCUGUACUCCCCUGAGCA

[0084] GCGUGGUGACAGUGCCCUCCUCCAGCCUGGGGACCCAGACCUACAUCUGCAACGUGAACCAC

[0085] AAGCCCUCCAACACUAAGGUGGAUAAGAAGGUGGAGCCCAAGAGCGUGCGACAAGACCCACA

[0086] CCUGCCCCCCCCGCCCGCCCCUGAGCUGCUGGGGGGGCCAGCGUGUUCCUCUUCCCCCCUA

[0087] AGCCCAAGGACACACAUGAUCAGCAGGACACCCGAGGUGACCUGCGUCGUGGGUGGAGU

[0088] GAGCCACGAGGACCCCGAGGGUGAAGUUUAACUGGUACGUGGACGGCGUGGAGGUGCAAC

[0089] GCCAAGACCAAGCCUCGGGAGGAGCAGUACAACAGCACCUACCGGGUGGUGAGCGUGCUGGA

[0090] CAGUGCUGCACCAGGACUGGCUGAACGGGAAGGAGUACAAGUGCAAGGUGAGCAACAAGGC

[0091] CCUCCCAGCCCCUAUCGAGAAAACCAUUUCCAAGGCCAAGGGCCAGCCUAGGGAGCCCCAGG

[0092] UGUACACACUGCCCCCCAGCAGGGACGAGCUGACCAAGAACCAGGUGUCCCUCACCUGCCUG

[0093] GUGAAGGGGUUCUACCCCUCCGAUAUCGCCGUGGAGUGGGAGUCCAACGGCCAGCCCGAGA

[0094] ACAACUACAAGACAACACCCCCCGUCCUGGACAGCGAUGGCUCCUUCUUUCUGUACUCCAAG

[0095] CUGACCGUGGAUAAGAGCCGGUGGCAGCAGGGGAACGUGUUUAGCUGCUCCGUGAUGCACG

[0096] AGGCCCUGCACAACCACUACACACAGAAGUCCCUGAGCCUGAGCCCCGGCAAGUGAUAAGAA

[0097] UUCUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCU

[0098] CCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCACUAGUSEQ IDNO:2

[0099] CUUGUUCUUUUUGCAGAAGCUCAGAAUAAACGCUCAACUUUGGCGCCGCCACCAUGGGCUG

[0100] GUCAUGCAUCAUCCUGUUCUUGGUGGCCACCGCGACUGGCGUCCACAGUCAAAUCGUGAUG

[0101] ACACAGAGCCCCAGCACACUGAGCGCCAGCGUGGGCGAUAGGGUGACAAUCACAUGCCGGGC

[0102] CAGCCAGUCGAUCGGCUCUUGGCUGGCCUGGUACCAGCAGAAGCCCGGCAAGGCCCCCAACC

[0103] UGCUGAUCUACAAGGCCAGCAGCCUGGAGAGCGGGGUGCCCAGCCGGUUCAGCGGGAGCGG

[0104] GUCCGGCACAGAGUUCACCCUGACCAUCACAAGCCUGCAGCCCGAGGAUUUCGCCACAUACU

[0105] ACUGCCAGCAGUACAACAACUACAGCUACACAUUCGGCCCAGGCACAAAGCUGGAGAUCAAG

[0106] CGGACAGUGGCCGCCCCCAGCGUGUUCAUCUUCCCCCCCUCCGAUGAGCAGCUGAAGAGCGG

[0107] GACAGCCAGCGUGGUGUGCCUGCUGAACAACUUCUACCCCAGAGAGGCCAAGGUGCAGUGG

[0108] AAGGUGGAUAACGCCCUGCAGAGCGGCAACAGCCAGGAGAGCGUGACCGAGCAGGAUAGCA

[0109] AGGAUAGCACAUACAGCCUGAGCUCCACACUGACCCUGAGCAAGGCCGACUACGAGAAGCAC

[0110] AAGGUGUACGCCUGCGAGGUGACCCACCAGGGCCUGAGCAGCCCCGUGACCAAGAGCUUCAA

[0111] CCGGGGGGAGUGCUGAUAAGAAUUCUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCU

[0112] UGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAA

[0113] GUCUGAGUGGGCGGCACUAGU。

Claims

1. An mRNA encoding an antibody, characterized in that, The mRNA encoding the antibody includes: mRNA encoding the light chain and mRNA encoding the heavy chain; wherein, The sequences encoding the heavy chains CDR1, CDR2, and CDR3 are positions 201-215, 258-305, and 402-446 as shown in SEQ ID NO: 1, or sequences having more than 90% homology with positions 201-215, 258-305, and 402-446 as shown in SEQ ID NO: 1; the sequences encoding the light chains CDR1, CDR2, and CDR3 are positions 180-212, 258-278, and 375-401 as shown in SEQ ID NO: 2, or sequences having more than 90% homology with positions 180-212, 258-278, and 375-401 as shown in SEQ ID NO:

2.

2. The mRNA encoding the antibody according to claim 1, characterized in that, The sequences encoding the heavy chains CDR1, CDR2, and CDR3 are positions 201-215, 258-305, and 402-446 as shown in SEQ ID NO: 1, respectively; the sequences encoding the light chains CDR1, CDR2, and CDR3 are positions 180-212, 258-278, and 375-401 as shown in SEQ ID NO: 2, respectively. Preferably, in the mRNA encoding the antibody, the mass ratio of the mRNA encoding the light chain to the mRNA encoding the heavy chain is 1:(1-3).

3. The mRNA encoding an antibody according to claim 1 or 2, characterized in that, The coding region sequence of the mRNA encoding the heavy chain is positions 54-1472 as shown in SEQ ID NO: 1, or a sequence having more than 90% homology with positions 54-1472 as shown in SEQ ID NO: 1; And / or, the coding region sequence of the mRNA encoding the light chain is positions 54-755 as shown in SEQ ID NO: 2, or a sequence having more than 90% homology with positions 54-755 as shown in SEQ ID NO:

2.

4. The mRNA encoding an antibody according to claim 3, characterized in that, The signal peptide sequence in the coding region of the mRNA encoding the heavy chain is position 54-110 as shown in SEQ ID NO: 1, or a sequence that has more than 90% homology with position 54-110 as shown in SEQ ID NO: 1; And / or, the signal peptide sequence in the coding region of the mRNA encoding the light chain is position 54-110 as shown in SEQ ID NO: 2, or a sequence having more than 90% homology with position 54-110 as shown in SEQ ID NO:

2.

5. The mRNA encoding an antibody according to any one of claims 1-4, characterized in that, The mRNA encoding the light chain and the mRNA encoding the heavy chain each independently contain a tandemly linked 5' untranslated region sequence, a coding region sequence, and a 3' untranslated region sequence; Preferably, the 5' untranslated region sequence of the mRNA encoding the heavy chain is positions 1-44 as shown in SEQ ID NO: 1, or a sequence having more than 90% homology with positions 1-44 as shown in SEQ ID NO: 1; And / or, the 3' untranslated region sequence of the mRNA encoding the heavy chain is positions 1482-1595 as shown in SEQ ID NO: 1, or a sequence having more than 90% homology with positions 1482-1595 as shown in SEQ ID NO: 1; Preferably, the 5' untranslated region sequence of the mRNA encoding the light chain is positions 1-44 as shown in SEQ ID NO: 2, or a sequence having more than 90% homology with positions 1-44 as shown in SEQ ID NO: 2; And / or, the 3' untranslated region sequence of the mRNA encoding the light chain is positions 765-878 as shown in SEQ ID NO: 2, or a sequence having more than 90% homology with positions 765-878 as shown in SEQ ID NO:

2.

6. The mRNA encoding an antibody according to any one of claims 1-5, characterized in that, The sequence of the mRNA encoding the heavy chain includes the sequence shown in SEQ ID NO: 1, or a sequence that has more than 90% homology with the sequence shown in SEQ ID NO: 1; And / or, the sequence of the mRNA encoding the light chain includes the sequence shown in SEQ ID NO: 2, or a sequence having more than 90% homology with the sequence shown in SEQ ID NO:

2.

7. The mRNA encoding an antibody according to claim 5 or 6, characterized in that, Downstream of the 3' untranslated region of the mRNA encoding the heavy chain and downstream of the 3' untranslated region of the mRNA encoding the light chain each include a polyadenylated nucleotide sequence, wherein the degree of polymerization of the polyadenylated nucleotide is 50-250.

8. The mRNA encoding an antibody according to any one of claims 1-7, characterized in that, The 5' end of the mRNA encoding the light chain and the 5' end of the mRNA encoding the heavy chain each have a cap structure. Preferably, the cap structures at the 5' end of the mRNA encoding the light chain and the 5' end of the mRNA encoding the heavy chain are respectively m7G(5')ppp(5')G(2'OMe)pG, m7G(5')vppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pG or m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.

9. An mRNA formulation, characterized in that, The mRNA formulation contains the mRNA encoding an antibody as described in any one of claims 1-8; Preferably, the mRNA formulation further comprises a delivery carrier, wherein the delivery carrier is a nanoliposphere.

10. The use of an mRNA encoding an antibody as described in any one of claims 1-8 or an mRNA formulation as described in claim 9 in the preparation of a medicament for the prevention and / or treatment of yellow fever virus infection.

Images