Highly resistant and high-fragility yellow flammulina velutipes zjjzg002, in del marker and application thereof

Abstract

This application discloses a high-resistance, high-brittleness yellow enoki mushroom (ZJJZG002), InDel marker, and their application, relating to the field of edible fungi cultivation technology. The preservation number is CGMCC NO.41174, and the classification name is *Volvariella fuciformis* (also known as 'Silky Cap Winter Mushroom'). Flammulina filiformis The strain ZJJZG002 was obtained by using yellow enoki mushroom F24 and white enoki mushroom W1 as parents. After treating the parental materials with ultraviolet mutagenesis, single spore isolation, hybridization (hybrid combination XB51×YU19), and fruiting tests were carried out. The strain ZJJZG002 does not open its cap easily, has a strong mushroom aroma, a crisp taste, and uniform fruiting. It is suitable for various cultivation methods and can inject new seed sources into the domestic enoki mushroom market.

Description

Technical Field

[0001] This application relates to the field of edible fungi cultivation technology, and in particular to a high-resistance and high-brittleness yellow enoki mushroom ZJJZG002, the InDel marker, and its application. Background Technology

[0002] Enoki mushrooms Flammulina filiformis It belongs to the class Agaricaceae. Agaricomycetes Mushroom Order Agaricales family Puffylaceae Physalacriaceae genus *Lentinula* Flammulina Because it often produces mushrooms in winter under natural conditions, it is also known as winter mushroom. It is the earliest edible fungus variety in China to achieve factory production, and it is currently the variety with the largest daily and annual production, with an annual output of over 2 million tons.

[0003] Yellow enoki mushrooms have been cultivated in my country since 386 AD using paper mulberry trees. Yellow enoki mushrooms have the advantages of early fruiting, strong aroma, and crisp texture, but their yield is low, they are prone to opening of the cap, and they are susceptible to browning.

[0004] It is essential to breed a new enoki mushroom variety that combines the early fruiting, rich aroma, and crisp texture of yellow enoki mushrooms with the uniform fruiting and high yield of white enoki mushrooms.

[0005] InDel markers are molecular markers developed based on mutations caused by the insertion or deletion of nucleotide fragments of different sizes at the same locus in the genome of closely related species or different individuals of the same species. InDel markers are co-dominant markers, widely distributed, high-density, and highly stable in variation. Genotyping with InDel markers is simple and rapid, making them ideal for the development of high-density molecular markers; furthermore, genetic evidence shows that genomic InDels are a major source of gene defects and an important source of species evolution. Currently, InDel markers have been widely used in genetic mapping, gene localization and cloning, and association analysis. However, no relevant InDel sequences for the identification of *Flammulina velutipes* strains are publicly available in current technologies, representing a gap in this research area.

[0006] The information disclosed in the background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art. Summary of the Invention

[0007] This application addresses the aforementioned technical problems by providing a high-resistance, high-brittleness yellow enoki mushroom ZJJZG002, InDel marking, and its application.

[0008] This application provides a high-resistance, high-brittleness yellow enoki mushroom (ZJJZG002, preservation number CGMCCNO.41174, classified as *Vigna fuciformis*). Flammulina filiformis ).

[0009] Another aspect of this application provides an InDel marker for the highly resistant and brittle *Flammulina velutipes* ZJJZG002, as described above. The strain to be tested simultaneously meets the following requirements: the product fragment amplified by primer INDEL004 is 204 bp; the product fragment amplified by primer INDEL012 is 299 bp; the product fragment amplified by primer INDEL013 is 206 bp; the product fragment amplified by primer INDEL016 is 296 bp; the product fragments amplified by primer INDEL018 are 284 bp and 288 bp; the product fragments amplified by primer INDEL025 are 270 bp and 275 bp; and the product fragment amplified by primer INDEL026 is 252 bp. The product fragments amplified by primers INDEL027 and INDEL028 were 296bp and 299bp, respectively; the product fragment amplified by primers INDEL028 was 177bp; the product fragment amplified by primers INDEL029 was 228bp; the product fragment amplified by primers INDEL031 was 273bp; the product fragment amplified by primers INDEL034 was 152bp; the product fragments amplified by primers INDEL038 were 217bp and 227bp; the product fragment amplified by primers INDEL042 was 204bp; the product fragment amplified by primers INDEL043 was 242bp; and the product fragment amplified by primers INDEL050 was 295bp. The products amplified by primers INDEL051 and INDEL075 were 276bp and 279bp, respectively; the product amplified by primers INDEL075 was 248bp; the product amplified by primers INDEL078 was 250bp; the product amplified by primers INDEL082 was 293bp and 299bp; the product amplified by primers INDEL101 was 200bp; the product amplified by primers INDEL107 was 283bp and 290bp; the product amplified by primers INDEL118 was 280bp; the product amplified by primers INDEL125 was 224bp; and the product amplified by primers INDEL145 was 295bp and 295bp. When the product fragments were 296bp and 297bp; the product fragment amplified by primer INDEL147 was 152bp; the product fragment amplified by primer INDEL166 was 208bp; the product fragment amplified by primer INDEL169 was 294bp; the product fragment amplified by primer INDEL170 was 272bp; the product fragment amplified by primer INDEL174 was 274bp; the product fragment amplified by primer INDEL177 was 281bp; the product fragment amplified by primer INDEL188 was 253bp; and the product fragments amplified by primer INDEL191 were 258bp and 263bp, the strain to be tested was strain ZJJZG002.

[0010] The sequences of INDEL004-F are shown in SEQ ID:2; the sequence of INDEL004-R is shown in SEQ ID:35; the sequence of INDEL012-F is shown in SEQ ID:3; the sequence of INDEL012-R is shown in SEQ ID:36; the sequence of INDEL013-F is shown in SEQ ID:4; the sequence of INDEL013-R is shown in SEQ ID:37; the sequence of INDEL016-F is shown in SEQ ID:5; the sequence of INDEL013-R is shown in SEQ ID:38; the sequence of INDEL018-F is shown in SEQ ID:6; the sequence of INDEL018-R is shown in SEQ ID:39; the sequence of INDEL025-F is shown in SEQ ID:7; the sequence of INDEL025-R is shown in SEQ ID:40; the sequence of INDEL026-F is shown in SEQ ID:8; the sequence of INDEL026-R is shown in SEQ ID:35. The sequence of INDEL027-F is shown in SEQ ID:41; the sequence of INDEL027-F is shown in SEQ ID:9; the sequence of INDEL027-R is shown in SEQ ID:42; the sequence of INDEL028-F is shown in SEQ ID:10; the sequence of INDEL028-R is shown in SEQ ID:43; the sequence of INDEL029-F is shown in SEQ ID:11; the sequence of INDEL029-R is shown in SEQ ID:44; the sequence of INDEL031-F is shown in SEQ ID:12; the sequence of INDEL031-R is shown in SEQ ID:45; the sequence of INDEL034-F is shown in SEQ ID:13; the sequence of INDEL034-R is shown in SEQ ID:46; the sequence of INDEL038-F is shown in SEQ ID:14; the sequence of INDEL038-R is shown in SEQ ID:47; the sequence of INDEL042-F is shown in SEQ ID:15; the sequence of INDEL042-R is shown in SEQ ID:9. The sequence of INDEL043-F is shown in SEQ ID:48; the sequence of INDEL043-F is shown in SEQ ID:16; the sequence of INDEL043-R is shown in SEQ ID:49; the sequence of INDEL050-F is shown in SEQ ID:17; the sequence of INDEL050-R is shown in SEQ ID:50; the sequence of INDEL051-F is shown in SEQ ID:18; the sequence of INDEL051-R is shown in SEQ ID:51; the sequence of INDEL075-F is shown in SEQ ID:19; the sequence of INDEL075-R is shown in SEQ ID:52; the sequence of INDEL078-F is shown in SEQ ID:20; the sequence of INDEL078-R is shown in SEQ ID:53; and the sequence of INDEL082-F is shown in SEQ ID:21.The sequences of INDEL082-R are shown in SEQ ID: 54; the sequences of INDEL101-F are shown in SEQ ID: 22; the sequences of INDEL101-R are shown in SEQ ID: 55; the sequences of INDEL107-F are shown in SEQ ID: 23; the sequences of INDEL107-R are shown in SEQ ID: 23; the sequences of INDEL118-F are shown in SEQ ID: 24; the sequences of INDEL118-R are shown in SEQ ID: 57; the sequences of INDEL125-F are shown in SEQ ID: 25; the sequences of INDEL125-R are shown in SEQ ID: 58; the sequences of INDEL145-F are shown in SEQ ID: 26; the sequences of INDEL145-R are shown in SEQ ID: 59; the sequences of INDEL147-F are shown in SEQ ID: 27; and the sequences of INDEL147-R are shown in SEQ ID: 59. The sequence of INDEL166-F is shown in SEQ ID: 60; the sequence of INDEL166-F is shown in SEQ ID: 28; the sequence of INDEL166-R is shown in SEQ ID: 61; the sequence of INDEL169-F is shown in SEQ ID: 29; the sequence of INDEL169-R is shown in SEQ ID: 62; the sequence of INDEL174-F is shown in SEQ ID: 31; the sequence of INDEL174-R is shown in SEQ ID: 64; the sequence of INDEL177-F is shown in SEQ ID: 32; the sequence of INDEL177-R is shown in SEQ ID: 65; the sequence of INDEL188-F is shown in SEQ ID: 33; the sequence of INDEL188-R is shown in SEQ ID: 66; the sequence of INDEL191-F is shown in SEQ ID: 34; the sequence of INDEL191-R is shown in SEQ ID: 67.

[0011] Another aspect of this application provides a method for breeding the highly resistant and brittle yellow enoki mushroom ZJJZG002 as described above, comprising the following steps:

[0012] Using yellow enoki mushroom F24 and white enoki mushroom W1 as parental materials, spores of the parental materials were collected and mycelial blocks of single-spore strains of yellow enoki mushroom F24 and white enoki mushroom W1 were prepared respectively. The mycelial blocks of single-spore strains were inoculated on the same plate medium and cultured until the two colonies fused. Then, the mycelium of the fused area was taken and inoculated on another medium to obtain a fused strain with clamp connections.

[0013] After inoculation and cultivation of the fusion strains, strains with weak mycelia and poor growth were eliminated, and the yellow enoki mushroom strain ZJJZG002, with white fruiting bodies, spherical caps, high uniformity of color at the base of the stipe, high yield, and uniform budding, was selected.

[0014] Another aspect of this application provides the application of the highly resistant and brittle yellow enoki mushrooms ZJJZG002 and InDel, as described above, in artificial cultivation.

[0015] Preferably, the cultivation material used in artificial cultivation is made by mixing 35 parts by weight of corn cob, 36 parts by weight of rice bran, 8 parts by weight of wheat bran, 5 parts by weight of cottonseed hulls, 4 parts by weight of beet pulp, 4 parts by weight of soybean hulls, 4 parts by weight of brewer's residue, 1.3 parts by weight of calcium hydride, and 0.7 parts by weight of lime, and then adding water to make the moisture content 65-68%.

[0016] Preferably, the fermentation broth inoculated onto the cultivation medium in artificial cultivation is prepared by inoculating activated bacterial blocks of strain ZJJZG002 with a diameter of 5 mm into the culture medium at a quantity of 5 blocks / bottle, and then culturing at 20°C for 8 days.

[0017] Preferably, the culture medium consists of 5g soybean flour, 3g corn flour, 3g peptone, 18g glucose, 0.7g magnesium sulfate, 1g dipotassium hydrogen phosphate, and 1L water.

[0018] The beneficial effects that this application can produce include:

[0019] 1) The yellow enoki mushroom strain ZJJZG002 with high resistance and high crispness provided in this application was obtained by using yellow enoki mushroom F24 and white enoki mushroom W1 as parents. After treating the parent materials with ultraviolet mutagenesis, single spore isolation, hybridization (hybridization combination XB51×YU19) and fruiting test were carried out. The strain ZJJZG002 is not easy to open the cap, has a strong mushroom aroma, crisp taste, and uniform fruiting. It is suitable for production of various cultivation modes and can inject new seed sources into the domestic enoki mushroom market.

[0020] 2) The high-resistance, high-brittleness yellow enoki mushroom strain ZJJZG002 provided in this application exhibits a good antibacterial rate of 83-85% against Trichoderma and Pseudomonas, which is higher than that of the parent strain F24. This effectively resists infection by miscellaneous bacteria and increases yield. Strain ZJJZG002 has a higher proportion of sweet amino acids in its total amino acid profile, and the ratio of sweet to bitter taste is higher than that of the parent strain F24, indicating that this strain has a better sweet taste compared to F24 and can effectively improve the excessive bitterness of F24. The calcium, potassium, and vitamin B1 content of ZJJZG002 are all higher than that of F24, effectively improving the nutritional composition of the parent strain.

[0021] 3) The yellow enoki mushroom ZJJZG002 with high resistance and high brittleness provided in this application has a brittle outer shell structure in its stipe, and its brittleness value can be measured by a texture analyzer. At the same time, it has higher hardness and requires less energy to chew solid food, which makes the strain have a better taste experience with more brittleness and easier chewing. Moreover, this strain is particularly suitable for cultivation in artificial environment. After being cultivated at 5℃ and 35℃ for 7 days, it can still grow normally at 25℃, and its growth rate is faster than that of the parent F24.

[0022] 4) The InDel marker of the high-resistance and high-brittleness yellow enoki mushroom ZJJZG002 provided in this application can be used to identify yellow enoki mushroom ZJJZG002 and avoid confusion with other yellow enoki mushrooms.

[0023] The *Flammulina velutipes* strain ZJJZG002 was deposited on March 5, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China, with accession number CGMCCNO. 41174, and classified as *Flammulina velutipes*. Flammulina filiformis ). Attached Figure Description

[0024] Figure 1 The above are colony morphology photographs of strain ZJJZG002 obtained in Example 2 of this application;

[0025] Figure 2 This is the phylogenetic tree of strain ZJJZG002 obtained in Example 3 of this application;

[0026] Figure 3 This is a schematic diagram of the inner and outer diameters of the colony in Example 4 of this application;

[0027] Figure 4 These are photographs of the growth of strain ZJJZG002 at various temperatures on the 7th day after inoculation in Example 4 of this application;

[0028] Figure 5 This is a genotype peak diagram of marker JZGINDEL004 in Example 5 of this application;

[0029] Figure 6 This is a genotype peak diagram of the marker JZGINDEL012 in Example 5 of this application;

[0030] Figure 7 This is a genotype peak diagram of marker JZGINDEL013 in Example 5 of this application;

[0031] Figure 8 This is a genotype peak diagram of the marker JZGINDEL016 in Example 5 of this application;

[0032] Figure 9This is a genotype peak diagram of the marker JZGINDEL018 in Example 5 of this application;

[0033] Figure 10 This is a genotype peak diagram of the marker JZGINDEL025 in Example 5 of this application;

[0034] Figure 11 This is a genotype peak diagram of the marker JZGINDEL026 in Example 5 of this application;

[0035] Figure 12 This is a genotype peak diagram of the marker JZGINDEL027 in Example 5 of this application;

[0036] Figure 13 This is a genotype peak diagram of the marker JZGINDEL028 in Example 5 of this application;

[0037] Figure 14 This is a genotype peak diagram of the marker JZGINDEL029 in Example 5 of this application;

[0038] Figure 15 This is a genotype peak diagram of the marker JZGINDEL031 in Example 5 of this application;

[0039] Figure 16 This is a genotype peak diagram of the marker JZGINDEL034 in Example 5 of this application;

[0040] Figure 17 This is a genotype peak diagram of the marker JZGINDEL038 in Example 5 of this application;

[0041] Figure 18 This is a genotype peak diagram of marker JZGINDEL042 in Example 5 of this application;

[0042] Figure 19 This is a genotype peak diagram of marker JZGINDEL043 in Example 5 of this application;

[0043] Figure 20 This is a genotype peak diagram of the marker JZGINDEL050 in Example 5 of this application;

[0044] Figure 21 This is a genotype peak diagram of the marker JZGINDEL051 in Example 5 of this application;

[0045] Figure 22 This is a genotype peak diagram of marker JZGINDEL075 in Example 5 of this application;

[0046] Figure 23 This is a genotype peak diagram of marker JZGINDEL078 in Example 5 of this application;

[0047] Figure 24 This is a genotype peak diagram of marker JZGINDEL082 in Example 5 of this application;

[0048] Figure 25 This is a genotype peak diagram of the marker JZGINDEL101 in Example 5 of this application;

[0049] Figure 26 This is a genotype peak diagram of the marker JZGINDEL107 in Example 5 of this application;

[0050] Figure 27 This is a genotype peak diagram of the marker JZGINDEL118 in Example 5 of this application;

[0051] Figure 28 This is a genotype peak diagram of the marker JZGINDEL125 in Example 5 of this application;

[0052] Figure 29 This is a genotype peak diagram of the marker JZGINDEL145 in Example 5 of this application;

[0053] Figure 30 This is a genotype peak diagram of the marker JZGINDEL147 in Example 5 of this application;

[0054] Figure 31 This is a genotype peak diagram of the marker JZGINDEL166 in Example 5 of this application;

[0055] Figure 32 This is a genotype peak diagram of the marker JZGINDEL169 in Example 5 of this application;

[0056] Figure 33 This is a genotype peak diagram of the marker JZGINDEL170 in Example 5 of this application;

[0057] Figure 34 This is a genotype peak diagram of the marker JZGINDEL174 in Example 5 of this application;

[0058] Figure 35 This is a genotype peak diagram of the marker JZGINDEL177 in Example 5 of this application;

[0059] Figure 36 This is a genotype peak diagram of the marker JZGINDEL188 in Example 5 of this application;

[0060] Figure 37 This is a genotype peak diagram of the marker JZGINDEL191 in Example 5 of this application;

[0061] Figure 38UPGMA clustering tree of 48 commercially available enoki mushroom strains, strain ZJJZG002, parent F24, and parent W1 in Example 5 of this application;

[0062] Figure 39 These are photographs showing the high and low temperature resistance recovery results of strain ZJJZG002 and parent F24 in Example 6 of this application; a) shows the resistance test results of strain ZJJZG002 at 5℃; b) shows the resistance test results of strain ZJJZG002 at 35℃; c) shows the resistance test results of parent F24 at 5℃; d) shows the resistance test results of parent F24 at 35℃.

[0063] Figure 40 These are photographs showing the results of the confrontation experiments between strain ZJJZG002, parent F24, and other bacteria in Example 7 of this application; a) shows the results of the confrontation experiment with Trichoderma of parent F24; b) shows the results of the confrontation experiment with Trichoderma of strain ZJJZG002; c) shows the results of the confrontation experiment with Pseudomonas of parent F24; d) shows the results of the confrontation experiment with Pseudomonas of strain ZJJZG002.

[0064] Figure 41 The artificially cultivated fruiting body of strain ZJJZG002 in Example 9 of this application;

[0065] Figure 42 This is a diagram showing the banding results of the parental F24 obtained in Example 6 of this application, amplified with JZGINDEL016 label;

[0066] Figure 43 This is a diagram showing the banding results of the parent W1 obtained in Example 6 of this application, amplified using JZGINDEL016 labeling;

[0067] Figure 44 This is a diagram showing the banding results of strain ZJJZG002 obtained in Example 6 of this application, amplified using JZGINDEL016 labeling; Detailed Implementation

[0068] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0069] Unless otherwise specified, all materials and instruments used in the following embodiments were obtained through commercial channels; and all detection methods used are existing methods unless otherwise specified.

[0070] In the following embodiments:

[0071] 1. Culture medium: PDA culture medium used: 200g potato, 20g glucose, 20g agar, 1L water.

[0072] Liquid culture medium: 20g white sugar, 3.5g soybean protein powder, 0.66g magnesium sulfate, 0.66g potassium dihydrogen phosphate, 1L water.

[0073] 2. Cultivation medium: 38-40 parts by weight of corn cob, 32-35 parts by weight of rice bran, 5-8 parts by weight of cottonseed hulls, 8-10 parts by weight of wheat bran, 5-8 parts by weight of brewer's grains, 5-8 parts by weight of soybean hulls, 5-8 parts by weight of beet pulp, 1-2 parts by weight of gypsum, 1-1.5 parts by weight of fossilized shells. Add water to adjust the moisture content to 65%, and keep the pH value natural.

[0074] Example 1: Breeding process of strain ZJJZG002

[0075] 1. Parental materials: Yellow enoki mushroom F24 and white enoki mushroom W1 were purchased from the Shuimuhua Wild Mushroom Trading Market in May 2021 and used as parental materials.

[0076] 2. Breeding methods

[0077] (1) Spore collection

[0078] Mature, fresh, and disease-free fruiting bodies of yellow enoki mushroom F24 and white enoki mushroom W1 were taken separately. The stipes were cut off under sterile conditions, and the gill side was placed flat on a sterile petri dish. The dish was placed in a sterile room at 18-20°C with the ambient humidity maintained. The enoki mushroom spores were collected overnight. When white spore marks appeared at the bottom of the plate, the fruiting bodies were removed, and the plates were sealed for preservation of the spores of yellow enoki mushroom F24 and white enoki mushroom W1 for later use.

[0079] (2) Spore isolation and mutagenesis

[0080] Scrape an appropriate amount of the collected spores, dissolve them in 10 mL of sterile water, gently shake to mix, and then transfer the spore suspension into a test tube containing sterile water. Dilute the spore suspension to 10⁻⁶ using a serial dilution method. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 10 -9 Concentration gradient bacterial suspension, with a spore concentration of 10... -3 Gradient bacterial suspensions were used as materials for composite mutagenesis.

[0081] (3) Ultraviolet mutagenesis

[0082] After preheating the 30W UV lamp for 20 minutes, to ensure uniform irradiation of the cells, 5 mL of *Flammulina velutipes* F24 spore suspension was placed in a sterile petri dish (9 cm). The dish was placed horizontally on a magnetic stirrer 30 cm (vertically) away from the UV lamp. After irradiation for 1 minute, the dish lid was opened, and irradiation continued. The magnetic stirrer was turned on simultaneously with the start of the irradiation treatment, and the irradiation time was recorded as 3 minutes. After irradiation, the mutant bacterial solution was obtained. After storing the mutant bacterial solution in the dark for 1 hour, 50 µL of the mutant bacterial solution was inoculated into PDA medium plates. The plates were spread in parallel on 3 plates and allowed to stand until the bacterial solution penetrated the medium. The plates were then inverted and incubated at 24°C for 6 days. After that, a single colony was picked with an inoculation needle and transferred to a PDA plate, picking the sparsest part of the colony. The plates were then incubated under the same conditions. The purification operation was repeated 2-3 times to obtain 34 UV-induced mutant spores, which were numbered YU1-YU34.

[0083] (4) Single spore isolation

[0084] Scrape a single UV-mutated spore from the plate and dissolve it in 10 mL of sterile water. Dilute the spore suspension to 10 μL using a serial dilution method. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 10 -9 Concentration gradient, from 10 -2 Initially, 50 µL of spore solution was spread onto three parallel 90 mm PDA plates for each concentration gradient. After incubation at 24°C in the dark for 4 and 5 days (inverted), tiny colonies became visible to the naked eye on the plates. Single colonies were picked up using an inoculation needle and transferred to the PDA plates, selecting sparsely populated areas. This purification process was repeated 2-3 times, resulting in the collection of 81 yellow spores and 84 white spores. The yellow spores were numbered Y1-Y81, and the white spores were numbered XB1-XB84.

[0085] Purified white and yellow monokaryotic strains were inoculated onto PDA plates with sterile coverslips inserted at an angle. The plates were incubated in the dark at 24°C until the hyphae reached the coverslips. The presence or absence of clamp connections was observed under a standard optical microscope. Strains without clamp connections were the desired monokaryotic strains. After confirming the absence of clamp connections under microscopic examination, white and yellow monokaryotic strains with robust hyphae and good growth were selected and stored at 4°C for later use.

[0086] (5) Single-spore hybridization

[0087] Under aseptic conditions, 5mm diameter single-spore white and yellow monokaryotic strains were collected using a punch and inoculated onto PDA plates, with a 2cm gap between the two strains on each plate. The plates were incubated at 24℃ for 5 days. When a raised fusion line formed between the two fused single colonies, mycelia from the fusion site were aseptically transferred to another PDA medium. A sterile coverslip was then inserted obliquely into the edge of the colony medium and incubated at 24℃ for 5 days. After the mycelia climbed onto the coverslip, the coverslip was removed, and the fusion was tested using the monokaryotic mycelial test. Strains exhibiting clamp connections were considered successfully fused. The resulting successfully fused hybrid strains were preserved for later use. Due to the large number of inoculation combinations for white and yellow monokaryotic strains, and the fact that none of them yielded good traits, details are omitted here. The final hybrid combination of strain ZJJZG002 was XB51×YU19, experiment number: 175.

[0088] (6) Growth characteristics and fruiting test of hybrid strains

[0089] Each obtained hybrid dikaryotic strain was inoculated onto PDA plates and cultured at 24℃. The mycelial growth rate, thickness, and density of each strain were observed at one-week intervals. Strains with weak mycelia and slow growth were eliminated, and hybrid dikaryotic strains with good mycelial growth were selected. These strains with good mycelial growth underwent initial screening, secondary screening, small-scale trials, pilot-scale trials, and demonstration fruiting experiments. The yellow sap exudation of mycelia in the bags, fruiting body yield, color, and cap incursion were observed. From these, the yellow enoki mushroom hybrid strain ZJJZG002, characterized by yellow fruiting bodies, high yield, uniform budding, and excellent commercial qualities, was selected.

[0090] Example 2: Variety characteristics of strain ZJJZG002

[0091] Strain ZJJZG002 was inoculated onto PDA medium and cultured at 25°C for 5 days. The resulting colonies showed no pigment deposition on their surface. The caps were hemispherical in longitudinal section with a strongly rolled-in edge and a yellowish-white surface. The stipes were relatively long and of moderate color uniformity. A photograph of the plate culture is shown below. Figure 1 As shown.

[0092] When parental F24 was inoculated and cultured under the same conditions, the resulting colonies had light yellow pigment deposition on their surface; the cap surface was light yellow with a moderate degree of inward curling at the edge; and the stipe was of medium length with a moderate degree of color uniformity.

[0093] Example 3: Differential identification of strain ZJJZG002

[0094] Mycelia of strain ZJJZG002 were amplified using ITS4 and ITS5 (commonly used primer sequences) and sent to Hunan Qingke Biotechnology Co., Ltd. for sequencing. The amplified ITS fragments were compared in the NCBI database, and sequences with high similarity were downloaded. A Neighbor-Joining (NJ) phylogenetic tree was constructed using MEGA 5.1 software. Figure 2 ZJJZG002 was identified as enoki mushroom. F. filiformis ).

[0095] ZJJZG002 mycelial ITS sequence (SEQ ID: 1):

[0096] tgaggtcaat ggtcatagtt tgtccccaag gggacggtta gaagcggaat agcccgcgca 60 ctcgcgtcac aggtatctct cgtgagagag aaggcaaagg gaagcaccaa ctaaggcgaa 120 accacttcag agacgagacg agcgctacaa cacagtcagc ccagccatag ccgtagataa 180 ttatcacagc tgcagcgcgc caaaaggtaa cggtttctgc taatgcattt caggggagct 240 gaacccaaag ataaggtcca gcaagccccc acatccaatc cgccagctca caacaaagtg 300 agggaggttg agaagttatact gacactcaaa caggcatgcc cttcggagta ccaaagggcg 360 caaggtgcgt tcaaagactc gatgattcac tgaattctgc aattcacatt agttatcgca 420 tttcgctgcg ttcttcatcg atgcgagagc caagagatcc gttgttgaaa gttgtattta 480 gtttaaagga cagtgaagtc caataatcaa tgacattcgt tacatactat agtgtttgta 540 agacataggc ctggaaggca aagggagcgc aaaaagcgca cccttccaat ggggtatcca 600 gacctacaga gtgtgcacag gtggacgaag aaagctgcaa ccccagacgt gcacgtacga 660 agaacccgtg aaggtcctcg tcagcaacag cccaagagcc acaagcagtt caaagttcat 720 taatgatccttccgcaggttcacctacggaaacctt 756

[0097] Referring to the national industry standard "Distinctive Identification of Edible Fungi Strains - Antagonistic Reactions" (NY / T 1845—2010), antagonistic reaction experiments were conducted between strain ZJJZG002 and its parent strain F24, and between strain ZJJZG002 and its parent strain W1. The results showed that strain ZJJZG002 and its parent strain F24, and strain ZJJZG002 and its parent strain W1, do not have affinity and form an "isolated" antagonistic line with each other. This indicates that strain ZJJZG002 is a different strain (variety) of *Flammulina velutipes* from its parents F24 and W1.

[0098] Example 4: Mycelial growth rate test of strain ZJJZG002

[0099] A 5 mm diameter colony of strain ZJJZG002 was quantitatively collected using a punch and inoculated into the center of a 90 mm diameter petri dish. PDA medium was first added to the dish, and the dishes were incubated in the dark at 5°C, 10°C, 15°C, 20°C, 25°C, 30°C, and 35°C. Colony diameters were measured twice, on days 3 and 7 post-inoculation, with five replicates for each test. The average value of each data point was taken. Photos of the growth of strain ZJJZG002 at different temperatures on day 7 post-inoculation are shown below. Figure 4 As shown.

[0100] The mycelial growth rate is calculated using the following formula: S = (D2 - D1) / [(d2 - d1) × 2]

[0101] In the formula: S is the mycelial growth rate (mm / d); D1 is the inner diameter of the colony, the first measured colony diameter (mm); D2 is the outer diameter of the colony, the second measured colony diameter (mm); d1 is the number of days of mycelial growth in the first measurement (d); d2 is the number of days of mycelial growth in the second measurement (d). The inner and outer diameters of the colony are as follows: Figure 3 As shown.

[0102] Temperature gradient experiments showed that the mycelial growth rate of ZJJZG002 was 4.88 mm / d at 25℃ (fastest) and 3.31 mm / d at 20℃. The parent mycelium showed the fastest growth rate at 25℃ (4.13 mm / d), followed by 20℃ (2.38 mm / d). At the optimal growth temperatures, ZJJZG002 grew faster than its parent mycelium.

[0103] Example 5: InDel-labeled fingerprint of strain ZJJZG002

[0104] 1. Using the resequencing genomes of parental F24 and randomly purchased white enoki mushroom strains from the market as reference genomes, InDel primers were designed for sequence analysis, resulting in 192 primer pairs for experiments. Primers were synthesized using the adapter method, i.e., a 21bp adapter sequence (GAAGGTGACCAAGTTCATGCT) was added to the upstream primer during synthesis. When using the adapter method for PCR amplification, the first step involves the upstream and downstream primers containing the adapter binding to the template to obtain a PCR product containing the adapter sequence. The second step involves the adapter primers and downstream primers containing fluorescent groups binding to the PCR product from the first step to obtain a PCR product containing a fluorescent group and a 21bp adapter sequence. (All of the above steps are performed in a single PCR system and program. The PCR amplification program is set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, gradient annealing at 62~52℃ for 30 s, extension at 72℃ for 30 s, for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, extension at 72℃ for 30 s, for 25 cycles; 72℃ extension for 20 min, and final storage at 4℃. This was performed by Wuhan Tianyi Huayu Gene Technology Co., Ltd.)

[0105] 2. Fluorescent PCR amplification

[0106] (1) Eight enoki mushroom samples were randomly selected and 192 primer pairs were obtained.

[0107] Eight commercially available *Flammulina velutipes* strains were selected, and 192 primer pairs were used for amplification. The reactions were performed on a Veriti 384 PCR instrument. The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, annealing at a gradient of 52-62℃ for 30 s, extension at 72℃ for 30 s, for 10 cycles; 95℃ denaturation for 30 s, annealing at 52℃ for 30 s, extension at 72℃ for 30 s, for 25 cycles; 72℃ extension for 20 min, and final storage at 4℃. After the PCR reaction, the amplified products were detected by fluorescent capillary electrophoresis.

[0108] The results were analyzed using GeneMarker software, and 33 primer pairs with suitable polymorphism and stability were obtained.

[0109] (2) 33 pairs of primers were used to screen 8 samples.

[0110] The 33 primer pairs selected in the previous step were re-screened, and the reaction was performed on a Veriti 384 PCR instrument. The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, gradient annealing from 62 to 52℃ for 30 s, extension at 72℃ for 30 s, for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, extension at 72℃ for 30 s, for 25 cycles; 72℃ extension for 20 min, and final storage at 4℃. After the PCR reaction, the amplification products were detected by fluorescent capillary electrophoresis. The results were analyzed using GeneMarker software, yielding 33 polymorphic primer pairs.

[0111] (3) Strain identification:

[0112] The reaction was performed on a Veriti 384 PCR instrument. The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, gradient annealing from 62 to 52℃ for 30 s, extension at 72℃ for 30 s, for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, extension at 72℃ for 30 s, for 25 cycles; 72℃ extension for 20 min, and final storage at 4℃. After the PCR reaction, the amplified products were detected by fluorescent capillary electrophoresis. The results were analyzed using GeneMarker software to obtain the number of alleles, peak diagrams, and genotypes for each sample. The raw data in .fsa format was exported from the ABI 3730xl instrument, classified and archived according to the detection sites, and then imported into the GeneMarker analysis software. The genotype data was read, and Excel files of raw genotype data and PDF genotyping peak diagrams were exported according to the site names. In the fluorescence detection peak graph of capillary electrophoresis, the horizontal axis represents the fragment size, the vertical axis represents the fluorescence signal intensity, the peaks with numbers are amplification products, the numbers represent the band size, and the remaining peaks are internal standards.

[0113] Amplification results of strain ZJJZG002: The results of amplification of strain ZJJZG002 using 33 pairs of InDel primers (primer information is shown in Tables 1-2) are as follows: Figures 5-37 As shown in the figure, strain ZJJZG002 exhibited significant specific bands in the amplification results using 33 pairs of InDel primers.

[0114] Strain identification results: Using the JZGINDEL016 label, the amplification band of parental white *Flammulina velutipes* W1 was 300 bp. The amplification bands of parental yellow *Flammulina velutipes* F24 were 296 bp and 300 bp, respectively. The amplification band of strain ZJJZG002 was 296 bp. The characteristic bands differed. See the attached results. Figures 42-44This allows for the identification of strain ZJJZG002. Therefore, it can be seen that when the strain to be tested is amplified using any of the 33 primers listed in Tables 1-2, the resulting amplification peak diagram will be similar to... Figures 5-37 If the amplification peaks of the corresponding primers are inconsistent, the strain to be tested is not strain ZJJZG002. Based on this, strain ZJJZG002 can be reliably identified.

[0115] Table 1. Amplification information of 33 InDel molecular markers for identifying strain ZJJZG002 (Part 1)

[0116]

[0117] Table 2. Amplification information of 33 InDel molecular markers for identifying strain ZJJZG002 (Part 2)

[0118]

[0119] 4. Cluster analysis

[0120] Genetic diversity analysis was performed on 49 *Flammulina velutipes* strains (commercially available strains S1-S60 + strain ZJJZG002) based on 33 polymorphic fragments amplified from InDel. A UPGMA clustering tree of 51 *Flammulina velutipes* strains was constructed based on Nei genetic distance. Figure 38 ). 51 *Flammulina velutipes* strains were identified, including commercially available strains S1-48 and strain ZJJZG002, parent strain F24, and parent strain W1. From Figure 38 It can be seen that the 33 primer pairs provided by this invention clustered *Flammulina velutipes* and ZJJZG002 into different groups. Therefore, the 33 InDel primer combinations provided by this invention can be used to distinguish the aforementioned 49 different *Flammulina velutipes* strains.

[0121] Example 6: Testing the high and low temperature resistance of strain ZJJZG002

[0122] 1. High temperature and low temperature growth test

[0123] Using a punch, take 5mm diameter mycelial blocks from parental F24 and strain ZJJZG002 obtained in Example 2 from a culture plate. Place them in the center of a 90mm diameter petri dish containing PDA medium. Incubate at 5℃ and 35℃ in the dark for 7 days, respectively. Then, incubate the plates at 25℃ in the dark for 5 days. Observe the mycelial growth as follows:

[0124] As shown in a~d.

[0125] As shown in the figure, strain ZJJZG002 can germinate and grow normally at 25℃ after treatment at 5℃ and 35℃. After cultivation at 5℃, the mycelial growth rate of ZJJZG002 is faster than that of the parent strain F24. After cultivation at 35℃ for 7 days, the mycelial growth rate of ZJJZG002 is faster than that of the parent strain F24. This indicates that strain ZJJZG002 has better resistance to high temperature (35℃) and low temperature (5℃) than the parent strain F24. It is especially suitable for cultivation under artificial environment conditions and can ensure the normal growth of the strain and the yield of the strain even in the event of extreme weather.

[0126] Example 7: Determination of the resistance of strain ZJJZG002 to contamination by other microorganisms

[0127] In February 2022, Liu Chunli purchased Trichoderma and Pseudomonas from the China Center for Type Culture Collection, which are major pathogens in enoki mushroom cultivation. Using Trichoderma and Pseudomonas as indicators, she conducted confrontation cultures and determined the disease resistance of strain ZJJZG002 by observing colony growth and the width of the antagonistic band.

[0128] 1. Strain activation: Parental strain F24, strain ZJJZG002, Trichoderma, and Pseudomonas strains were separately placed in PDA medium and activated at 25°C. Once the mycelium had fully colonized the culture dish, it was ready for use. Before use, mycelial cakes were prepared using a 5mm diameter punch.

[0129] Methods for determining resistance to Trichoderma and Pseudomonas: First, the mycelia of ZJJZG002 and parental F24 grown on PDA plates were quantitatively inoculated into 90 mm diameter petri dishes 15 mm from the center using a puncher (5 mm). The dishes were then incubated at 25℃ for 3 days. Next, Trichoderma and Pseudomonas mycelia were inoculated 30 mm from the center of the ZJJZG002 and parental F24 mycelial blocks, respectively. After 3 days of confrontation incubation, the distance between the Trichoderma (or Pseudomonas) mycelial block and the *Flammulina velutipes* mycelial block was measured as the width of the resistance line (R1) and the colony growth width (RCK). The color and size changes of the inhibition zone were continuously observed. Each resistance experiment was performed in triplicate, and growth was observed after 5 days of incubation.

[0130] Table 3. Results of the confrontation experiment between strain ZJJZG002 and parental F24 and Trichoderma.

[0131]

[0132] Table 4. Results of confrontation experiments between strain ZJJZG002 and parental F24 and Pseudomonas aeruginosa.

[0133]

[0134] Result: From Figure 40As shown in a~d, in the antibacterial tests of ZJJZG002 against Trichoderma and Pseudomonas, the inhibition rate of ZJJZG002 was higher than that of the parent F24, indicating that ZJJZG002 has strong resistance to contamination. Furthermore, it showed few diseases in multiple batches of cultivation trials after selection. During the mycelial growth period, it consumes substrate quickly and is less susceptible to contamination by other fungi, demonstrating strong resistance to contamination and making it more suitable for cultivation under artificial conditions. This effectively reduces the proportion of contaminant infection and increases yield.

[0135] Example 8: Determination of nutrient composition of strain ZJJZG002 and parent F24

[0136] Using existing enoki mushroom cultivation methods and under the same cultivation conditions, the fruiting bodies of artificially cultivated strain ZJJZG002 and parent F24 were sent to a qualified testing company for nutritional component testing according to current national standards. The results are listed in the table below.

[0137] Table 5. Amino acid statistics of strain ZJJZG002 and parent F24 (unit: g / 100g)

[0138]

[0139] Table 6. Statistical analysis of flavor amino acids in strain ZJJZG002 and parent F24.

[0140]

[0141] As shown in the table above, the proportion of sweet amino acids in the total amino acid content of strain ZJJZG002 is relatively high, and the ratio of sweet to bitter taste is higher than that of parent strain F24. This indicates that strain ZJJZG002 has a better sweet taste than parent strain F24 and can effectively improve the problem of excessive bitterness in parent strain F24.

[0142] Table 7. Metal and Vitamin Contents of Strains ZJJZG002 and Parental F24

[0143]

[0144] As shown in the table above, ZJJZG002 has higher levels of calcium, potassium, and vitamin B1 than its parent F24. This effectively improves the nutritional composition of the parent.

[0145] Example 9: Analysis of the stipe texture of strain ZJJZG002, parent F24, and commercially available Platinum Needle F.

[0146] Since the stipes of enoki mushrooms gradually thicken from top to bottom, and due to the deformation caused by the mutual compression between the stipes, the degree of thickening varies slightly among different varieties. Therefore, when using a texture analyzer (model: TA.TX Express) and the measurement software: Exponent Lite Express, the error is smaller when measuring the stipe at 1 / 5 of the way down from the cap end, as there are fewer influencing factors. The texture of strain ZJJZG002, parent F24, and market-market enoki mushroom F were tested under the same test conditions, and the results are shown in the table below.

[0147] Table 8

[0148]

[0149] As shown in the table, several parameters related to the mushroom body are as follows: Hardness: ZJJZG002 > Parent F24 > Commercially available Platinum Needle Mushroom; Crispness: (This parameter is unique to samples with a crisp outer shell, and most samples cannot be measured. Generally, if this parameter cannot be measured, the software will automatically hide it.) Only strain ZJJZG002 has a measured result, while parent F24 and commercially available Platinum Needle Mushrooms did not have a crisp outer shell structure and therefore no crispness value was measured; Elasticity: Commercially available Platinum Needle Mushroom F has the highest elasticity; Chewability: The result of the energy required to chew solid food is: ZJJZG002 < Parent F24 < Commercially available Platinum Needle Mushroom F. The less energy required, the easier it is to chew, indicating that strain ZJJZG002 is the easiest to chew.

[0150] Texture analysis showed that strain ZJJZG002 was crisper than its parent strain F24 and commercially available Platinum Needle mushrooms, requiring less energy to chew and having a better taste.

[0151] Example 10 Artificially cultivated strain ZJJZG002

[0152] 1. Inoculation and cultivation procedures: First, prepare the culture medium with the following formula by weight percentage: 35 parts corn cob, 36 parts rice bran, 8 parts wheat bran, 5 parts cottonseed hulls, 4 parts beet pulp, 4 parts soybean hulls, 4 parts brewer's grains, 1.3 parts calcium hydrate, and 0.7 parts lime. Mix the ingredients together, add water and stir until the moisture content is 65-68%. Then, put the culture medium into plastic bags and steam sterilize it at 121°C for 2 hours. After cooling to 25°C, inoculate the fermentation broth of strain ZJJZG002 into the plastic bags at a rate of 28 ml / bag.

[0153] The fermentation broth of strain ZJJZG002 was prepared as follows: 5mm diameter blocks of activated strain were inoculated into a culture medium (5g soybean flour, 3g corn flour, 3g peptone, 18g glucose, 0.7g magnesium sulfate, 1g dipotassium hydrogen phosphate, 1L water), 5 blocks per bottle, and cultured at 20℃ for 8 days.

[0154] After inoculation, the mushrooms are cultured in the dark for 20-30 days at 18-20℃ and 50-60% humidity, followed by fruiting management to obtain the fruiting bodies of *Flammulina velutipes* ZJJZG002. The obtained fruiting bodies are shown below. Figure 41 As shown in the figure. The cultivation steps are not detailed, but are carried out according to existing artificial cultivation methods. As can be seen from the figure, the fruiting bodies of this strain grow vigorously and have a high yield. Each bag of dry substrate weighing 300 grams can produce 456.35 grams of fresh mushrooms, with a biological conversion rate of up to 152.12%, and there is basically no contamination by other microorganisms.

[0155] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An InDel-labeled primer combination for identifying the highly resistant and brittle yellow enoki mushroom ZJJZG002, characterized in that, The yellow enoki mushroom ZJJZG002 has the preservation number CGMCC NO.41174 and is classified as *Vigna rotundifolia*. Flammulina filiformis ); The sequences of the InDel-labeled primer combinations are shown below: the sequence of INDEL004-F is shown in SEQ ID:2; the sequence of INDEL004-R is shown in SEQ ID:35; the sequence of INDEL012-F is shown in SEQ ID:3; the sequence of INDEL012-R is shown in SEQ ID:36; the sequence of INDEL013-F is shown in SEQ ID:4; the sequence of INDEL013-R is shown in SEQ ID:37; the sequence of INDEL016-F is shown in SEQ ID:5; the sequence of INDEL016-R is shown in SEQ ID:38; the sequence of INDEL018-F is shown in SEQ ID:6; the sequence of INDEL018-R is shown in SEQ ID:39; the sequence of INDEL025-F is shown in SEQ ID:7; the sequence of INDEL025-R is shown in SEQ ID:40; the sequence of INDEL026-F is shown in SEQ ID:8; the sequence of INDEL026-R is shown in SEQ ID:

40. The sequence of INDEL027-F is shown in SEQ ID:41; the sequence of INDEL027-F is shown in SEQ ID:9; the sequence of INDEL027-R is shown in SEQ ID:42; the sequence of INDEL028-F is shown in SEQ ID:10; the sequence of INDEL028-R is shown in SEQ ID:43; the sequence of INDEL029-F is shown in SEQ ID:11; the sequence of INDEL029-R is shown in SEQ ID:44; the sequence of INDEL031-F is shown in SEQ ID:12; the sequence of INDEL031-R is shown in SEQ ID:45; the sequence of INDEL034-F is shown in SEQ ID:13; the sequence of INDEL034-R is shown in SEQ ID:46; the sequence of INDEL038-F is shown in SEQ ID:14; the sequence of INDEL038-R is shown in SEQ ID:47; the sequence of INDEL042-F is shown in SEQ ID:15; the sequence of INDEL042 ... The sequence of INDEL043-F is shown in SEQ ID:48; the sequence of INDEL043-F is shown in SEQ ID:16; the sequence of INDEL043-R is shown in SEQ ID:49; the sequence of INDEL050-F is shown in SEQ ID:17; the sequence of INDEL050-R is shown in SEQ ID:50; the sequence of INDEL051-F is shown in SEQ ID:18; the sequence of INDEL051-R is shown in SEQ ID:51; the sequence of INDEL075-F is shown in SEQ ID:19; the sequence of INDEL075-R is shown in SEQ ID:52; the sequence of INDEL078-F is shown in SEQ ID:20; and the sequence of INDEL078-R is shown in SEQ ID:53.The sequences of INDEL082-F are shown in SEQ ID: 21; the sequence of INDEL082-R is shown in SEQ ID: 54; the sequence of INDEL101-F is shown in SEQ ID: 22; the sequence of INDEL101-R is shown in SEQ ID: 55; the sequence of INDEL107-F is shown in SEQ ID: 23; the sequence of INDEL107-R is shown in SEQ ID: 56; the sequence of INDEL118-F is shown in SEQ ID: 24; the sequence of INDEL118-R is shown in SEQ ID: 57; the sequence of INDEL125-F is shown in SEQ ID: 25; the sequence of INDEL125-R is shown in SEQ ID: 58; the sequence of INDEL145-F is shown in SEQ ID: 26; the sequence of INDEL145-R is shown in SEQ ID: 59; the sequence of INDEL147-F is shown in SEQ ID: 27; the sequence of INDEL147-R is shown in SEQ ID:

59. The sequence of INDEL166-F is shown in SEQ ID: 60; the sequence of INDEL166-F is shown in SEQ ID: 28; the sequence of INDEL166-R is shown in SEQ ID: 61; the sequence of INDEL169-F is shown in SEQ ID: 29; the sequence of INDEL169-R is shown in SEQ ID: 62; the sequence of INDEL170-F is shown in SEQ ID: 30; the sequence of INDEL170-R is shown in SEQ ID: 63; the sequence of INDEL174-F is shown in SEQ ID: 31; the sequence of INDEL174-R is shown in SEQ ID: 64; the sequence of INDEL177-F is shown in SEQ ID: 32; the sequence of INDEL177-R is shown in SEQ ID: 65; the sequence of INDEL188-F is shown in SEQ ID: 33; the sequence of INDEL188-R is shown in SEQ ID: 66; the sequence of INDEL191-F is shown in SEQ ID: 34; and the sequence of INDEL191-R is shown in SEQ ID:

67. ;

Images