Bacillus amyloliquefaciens genetically engineered bacterium with high antibiotic resistance as well as construction method and application of bacillus amyloliquefaciens genetically engineered bacterium

Abstract

The invention discloses a bacillus amyloliquefaciens genetically engineered bacterium with high antibiotic resistance as well as a construction method and application thereof, the construction of the engineered bacterium comprises the following steps: bacillus amyloliquefaciens is taken as a starting strain, an RNA (Ribonucleic Acid) molecular chaperonin hfq coding gene is knocked out, and the nucleotide sequence of the RNA molecular chaperonin hfq is shown as SEQ ID NO.1. The RNA molecular chaperonin hfq is obtained through cloning, the tolerance of engineering bacteria to erythromycin and ampicillin is increased by 2.44 times and 3.79 times by knocking out the gene or reducing the expression of the gene, and the enhancement of the antibiotic resistance of bacillus is crucial to the threat of drug-resistant bacteria, the improvement of environmental adaptability and the development of biotechnology application. By strengthening the resistance gene, drug-resistant pathogens can be efficiently inhibited, the antibacterial curative effect can be improved, the metabolic activity can be maintained in a complex antibiotic environment, and the pollution repair and industrial fermentation efficiency can be guaranteed.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a high-antibiotic-resistance Bacillus amyloliquefaciens genetically engineered bacterium and a construction method and application thereof. BACKGROUND

[0002] Bacillus amyloliquefaciens is a spore-forming, facultative anaerobic, gram-positive bacterium, and the cells are mostly rod-shaped, widely distributed in food, water, plant surfaces, animal intestines, and soil environments, and other ecosystems. So far, Bacillus amyloliquefaciens is composed of four species: B. amyloliquefaciens, B. siamensis, B. velezensis, and B. nakamurai. Although the strains of Bacillus amyloliquefaciens are different, the properties and uses are also different, but it is considered to be a safe and non-toxic production microorganism in safe and toxic production. The bacterium can produce various secondary metabolites such as lipopeptides in the metabolic process, and can inhibit bacteria, fungi, viruses, etc., and the produced antibacterial preparation or antibacterial lipopeptide is non-toxic, harmless, and has a long bacteriostatic time, and has a good biological control effect.

[0003] RNA chaperones are a class of functional proteins that regulate the folding path and stability of RNA molecules by dynamically binding to them, and are widely involved in key biological processes such as post-transcriptional modification, RNA structure remodeling, and gene expression regulation. The typical RNA chaperone, represented by the Hfq protein of Escherichia coli, usually exists in a hexameric ring structure, binds to RNA non-specifically through surface charge distribution, and promotes the base pairing of non-coding RNA and target mRNA. This class of proteins can maintain a stable monomeric conformation in solution, and can also spontaneously assemble into higher-order complexes under conditions of changes in ion concentration or temperature, and their conformational conversion mechanism is significantly different from that of traditional molecular chaperones that rely on ATP energy supply. Notably, although previous studies have revealed the global regulatory role of RNA chaperones in bacterial stress response, the precise RNA recognition site, dynamic binding mode, and synergistic mechanism with ribonucleases / polymerases of RNA chaperones remain controversial. Currently, there is no reported integrative research on RNA chaperones participating in the regulation of RNA metabolic networks and the synthesis pathway of extracellular polysaccharides, and the potential multifunctional characteristics and cross-pathway regulatory ability still need to be systematically analyzed.

[0004] Antibiotic abuse leads to the spread of drug-resistant pathogens, and traditional antibacterial therapy is at risk of failure. By enhancing the antibiotic resistance of Bacillus, it can survive stably in an environment containing antibiotics and secrete antibacterial substances, providing a biological tool for the development of new antibacterial strategies. Enhancing the antibiotic resistance of Bacillus has important scientific value and application potential for solving the global threat of multi-drug resistant pathogens, strengthening microbial environmental adaptability and breaking through the bottleneck of biological technology application. By targeted regulation of the expression network of drug resistance related genes, Bacillus not only can target inhibit the formation of drug-resistant bacterial biofilm and the secretion of pathogenic factors, significantly enhance the precision and persistence of antibacterial therapy, but also can maintain the steady operation of key metabolic pathways in antibiotic stress microenvironment, thereby ensuring its functional stability in industrial fermentation system and organic pollutant biodegradation scenarios. Notably, the engineered Bacillus strain with enhanced resistance can also serve as a repository of drug resistance gene elements, providing an ideal research platform for systematic analysis of drug resistance molecular mechanisms and the development of precision antibacterial technologies based on gene editing technology, and showing multidimensional application prospects in the fields of clinical infection prevention and control, agricultural disease biological control and environmental pollution bioremediation. SUMMARY

[0005] The present application provides a high antibiotic-resistant Bacillus amyloliquefaciens genetic engineering bacteria, which has high erythromycin resistance and high ampicillin resistance, and has good application prospects in food, medical, agricultural and other fields.

[0006] The present application also provides a construction method and application of the genetic engineering bacteria.

[0007] Technical scheme: In order to achieve the above-mentioned purpose, the high antibiotic-resistant Bacillus amyloliquefaciens genetic engineering bacteria provided by the present application is obtained by knocking out the RNA chaperone protein hfq coding gene of Bacillus amyloliquefaciens as a starting strain, and the nucleotide sequence of the RNA chaperone protein hfq is shown in SEQ ID NO. 1.

[0008] The Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LPB-18F, and the Bacillus amyloliquefaciens LPB-18F is an engineering strain LPB-18N△fen36 obtained by knocking out sRNA Fen36 from Bacillus amyloliquefaciens LPB-18N.

[0009] The construction method of the high antibiotic-resistant Bacillus amyloliquefaciens genetic engineering bacteria provided by the present application comprises the following steps:

[0010] (1) Design primers to amplify the upstream and downstream sequences of the RNA chaperone protein hfq, and fuse the RNA chaperone protein hfq to an expression vector to obtain a recombinant vector;

[0011] (2) transforming the recombination vector to the B. amyloliquefaciens to obtain the genetically engineered bacteria.

[0012] wherein, the amplification primer of hfq in step (1) is as follows:

[0013] L-hfq-F: GTACCCGGGAGCTCGAATTCCAATGTCAGAGCATCTTAAAACC CAAAAAAC

[0014] L-hfq-R: CAATATACAGATGCGCGCGTCATATCTGTCCATGAAACGGG

[0015] R-hfq-F: TGGACAGATATGACGCGCGCATCTGTATATTGCAGGC

[0016] R-hfq-R: CGTCGGGCGATATCGGATCCTGGTTGATTATCACCTTGTGTTT CAATCGT.

[0017] wherein, the amplification primer of colony verification PCR is as follows:

[0018] pCBS-PC-F: CCGACTGCGCAAAAGACATAATCGATAA

[0019] pCBS-PC-R: GCCAGCGCTTCGTTAATACAGATGT

[0020] The genetically engineered bacteria of B. amyloliquefaciens with high antibiotic resistance provided by the application is applied to enhancing the antibiotic resistance of B. amyloliquefaciens.

[0021] wherein, the antibiotic includes ampicillin and erythromycin.

[0022] The RNA chaperone hfq coding gene or its expression protein provided by the application is applied to regulating the antibiotic resistance of B. amyloliquefaciens.

[0023] wherein, the application of knocking out the RNA chaperone hfq coding gene or reducing the expression amount thereof is applied to enhancing the antibiotic resistance of B. amyloliquefaciens.

[0024] wherein, the B. amyloliquefaciens is B. amyloliquefaciens LPB-18F, and the B. amyloliquefaciens LPB-18F is an engineering strain LPB-18N△fen36 obtained by knocking out sRNA Fen36 from B. amyloliquefaciens LPB-18N.

[0025] The antibiotics include ampicillin and erythromycin.

[0026] As preferred, the constructing method of the genetically engineered B. amyloliquefaciens strain comprises the following steps:

[0027] (1) The upstream and downstream sequences of the RNA chaperone protein are amplified by PCR technology;

[0028] (2) After the upstream and downstream amplification products are recovered by gel recovery, the upstream and downstream fragments are fused by overlap extension PCR technology;

[0029] (3) After the E. coli containing the knockout vector pCBS is cultured overnight, the plasmid is extracted by using a plasmid DNA extraction kit;

[0030] (4) The plasmid is linearized by using SwiftCut BamHI and SwiftCut EcoRI;

[0031] (5) The fusion fragment is connected with the knockout vector by the seamless cloning technology, and the recombined vector is transformed into the E. coli DH5a chemically competent cell by the heat shock transformation method;

[0032] (6) A single colony is picked, and colony PCR verification is performed by using pCBS-PC-F / R, and the sequencing product is sent to Shanghai Shenguo Biological Analysis;

[0033] (7) The recombined vector is transformed into the B. amyloliquefaciens LPB-18F by the electroporation technology, and colony PCR verification is performed by using primers L-hfq-F and R-hfq-R.

[0034] The genetically engineered B. amyloliquefaciens strain with high erythromycin resistance provided by the application is applied to promoting erythromycin of the B. amyloliquefaciens.

[0035] The genetically engineered B. amyloliquefaciens strain with high ampicillin resistance provided by the application is applied to promoting ampicillin of the B. amyloliquefaciens.

[0036] The RNA chaperone protein hfq provided by the application is applied to improving erythromycin and ampicillin in the B. amyloliquefaciens.

[0037] The application firstly proposes a new function of the hfq gene, especially a new function of the gene in regulating antibiotic resistance in the B. amyloliquefaciens.

[0038] Advantages: Compared with the prior art, the application has the following advantages:

[0039] The application constructs a Bacillus amyloliquefaciens LPB-18F△tasA genetic engineering bacterium by knocking out the RNA chaperone protein hfq in the genome of the Bacillus amyloliquefaciens LPB-18F, which improves the erythromycin resistance and also improves the ampicillin resistance.

[0040] The application clones an RNA chaperone protein hfq, and by knocking out the RNA chaperone protein hfq coding gene or reducing the expression of the gene, the tolerance of the engineering bacterium to erythromycin and ampicillin is increased by 2.44 times and 3.79 times, which is important for enhancing the antibiotic resistance of Bacillus to cope with drug-resistant bacteria, improving the environmental adaptability and expanding the application of biotechnology. By strengthening the resistance gene, the drug-resistant pathogens can be efficiently inhibited, the antibacterial efficacy is improved, and the metabolic activity can be maintained in a complex antibiotic environment, thereby ensuring the pollution repair and industrial fermentation efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 Electrophoretogram of hfq gene upstream and downstream amplification;

[0042] Figure 2 Electrophoretogram of hfq gene upstream and downstream ligation;

[0043] Figure 3 Thermal shock transformed E.coli colony map;

[0044] Figure 4 Electrophoretogram of E.coli colony PCR amplification product;

[0045] Figure 5 Electrophoretogram of enzyme digestion verification;

[0046] Figure 6 Electrotransformation plate map;

[0047] Figure 7 Electrophoretogram of Bacillus amyloliquefaciens colony PCR amplification product;

[0048] Figure 8 Erythromycin resistance plate map;

[0049] Figure 9 Ampicillin resistance plate map. DETAILED DESCRIPTION

[0050] The application will be further described below in combination with the drawings and examples.

[0051] The materials, reagents and the like used in the embodiments of the application can be obtained from commercial channels unless otherwise specified. The experimental methods not specified in the examples are usually performed according to conventional conditions or according to the conditions recommended by the manufacturers.

[0052] The reagents used in the application are configured as shown below:

[0053] Electrotransformation solution: mannitol 15g, sorbitol 18g, trehalose 18g, glycerol 10%, water to make 200mL, sterilized at 115℃ for 20min.

[0054] Resuspension solution: mannitol 15g, sorbitol 18g, trehalose 18g, glycerol 10%, PEF6000 polyethylene glycol 14%, water to make 200mL, sterilized at 115℃ for 20min. LB medium: tryptone 10g, sodium chloride 10g, yeast extract powder 10g, adjust pH to 7.0, sterilized at 115℃ for 20min.

[0055] Erythromycin solution: accurately weigh erythromycin powder 0.05g, take 1mL ethanol to dissolve it thoroughly.

[0056] Ampicillin solution: accurately weigh ampicillin powder 0.05g, take 1mL chloroform to shake it thoroughly to dissolve it.

[0057] The starting strain used herein, Bacillus amyloliquefaciens LPB-18F, is an engineering strain LPB-18N△fen36 constructed in Example 3 of the applicant's previous application CN 117126795A.

[0058] The knockout vector pCBS used herein is a commonly known Escherichia coli-Bacillus subtilis shuttle plasmid pCBS, provided by the College of Life Sciences and Food Engineering, Huaiyin Institute of Technology.

[0059] Preparation of Bacillus amyloliquefaciens LPB-18F competence:

[0060] The activated Bacillus amyloliquefaciens LPB-18F was inoculated into LBS medium (50mL shake flask, liquid volume 20mL), and cultured overnight on a shaker (37℃, 180r / min). The bacteria were cultured to the logarithmic growth phase. The overnight LBS medium was transferred to fresh LBS medium (150mL shake flask, liquid volume 50mL) at a ratio of 1:25 (v / v) and cultured for 3h on a constant temperature shaker (37℃, 180r / min). During the culture, the OD 600 value reached 0.5, 10mg / mL of glycine was added to the shake flask, and the shaker continued to culture. When the OD 600 value reached 0.9, the shake flask was placed on ice for 30min. After standing, the supernatant was removed by centrifugation with a pre-cooled low-temperature centrifuge (4℃, 8000r / min, 5min), the bacteria were collected, and the pre-cooled electrotransformation solution was used to wash the bacteria 3 times. Finally, the competent cells were resuspended with a pre-cooled resuspension solution (1:100 (v / v)), and were aliquoted (100μL per tube) and stored at -80℃ for later use.

[0061] Example 1

[0062] Amplification of the upstream and downstream homologous arms of the hfq gene

[0063] The genomic DNA of strain LPB-18F was extracted, and the upstream and downstream sequences of hfq were amplified using the genome of strain LPB-18F as a template. First, L-hfq-R / F and R-hfq-R / F primers were designed, and the upstream sequence of hfq was amplified using L-hfq-F and L-hfq-R primers and the downstream sequence of hfq was amplified using R-hfq-F and R-hfq-R primers. The amplification products are shown in the following table. Figure 1 Lanes 1-3 are the upstream fragment amplification bands, with a length of about 331 bp, and lanes 6-8 are the downstream amplification bands, with a length of about 477 bp. The amplification bands are single and clear. The primers used are as follows:

[0064] L-hfq-F: GTACCCGGGAGCTCGAATTCCAATGTCAGAGCATCTTAAAACC CAAAAAC

[0065] L-hfq-R: CAATATACAGATGCGCGCGTCATATCTGTCCATGAAACGGG

[0066] R-hfq-F: TGGACAGATATGACGCGCGCATCTGTATATTGCAGGC

[0067] R-hfq-R: CGTCGGGCGATATCGGATCCTGGTTGATTATCACCTTGTGTTT CAATCGT

[0068] The primers described above were used, and a 50 μL PCR reaction system was configured: 2×Phanta Master Mix 25 μL, upstream and downstream primers (10 μM) 2 μL, DNA template 1 μL, ddH2O 20 μL. The L-hfq-F / R primers were used to amplify the upstream sequence of the fragment to be knocked out, and the R-hfq-F / R primers were used to amplify the downstream sequence of the fragment to be knocked out. The specific PCR reaction program is shown in Table 1 below.

[0069] Table 1 PCR reaction program

[0070]

[0071] Example 2

[0072] Overlap extension of chaperone hfq

[0073] The upstream and downstream amplification products obtained in the above step were used as templates, and the primers L-hfq-F and R-hfq-R were used to fuse the upstream and downstream homologous arms. A 25 μL overlap extension PCR reaction system was configured: 2x Phanta Master Mix 12.5 μL, L-hfq-F and R-hfq-R (10 μM) 1 μL each, upstream and downstream templates 1 μL each, ddH2O 8.5 μL. The specific overlap extension PCR reaction program is shown in Table 2 below, and the obtained fusion fragment electrophoresis band is shown in Figure 2 The sequence of the sequencing fusion fragment hfq is shown in SEQ ID NO. 1.

[0074] Table 2 PCR reaction program

[0075]

[0076] Example 3

[0077] pCBS plasmid extraction and ligation

[0078] (1) The E. coli containing the pCBS plasmid was inoculated into fresh ampicillin-resistant liquid LB medium, cultured overnight at 37°C and 160 rpm, and the pCBS plasmid was extracted according to the operation instruction of the plasmid extraction kit. After detecting the quality by 1% agarose gel electrophoresis, the plasmid was linearized using SwiftCut BamHI and SwiftCut EcoRI. The enzyme digestion system was configured as shown in Table 3, and then the reaction system was heated at 37°C for 30 min and quickly transferred to ice for cooling for 10 min to terminate the reaction. The linearized plasmid was detected by 1% agarose gel electrophoresis, and the linearized plasmid was recovered.

[0079] Table 3 Vector linearization system

[0080]

[0081]

[0082] (2) According to the operation instruction of the ready-to-use seamless cloning kit, the fusion fragment of Example 2 was connected with the linearized vector to obtain the recombinant vector pCBS-tasA. The reaction system (20 μL) is shown in the table below. Then the homologous recombination system was mixed uniformly, and then placed in a PCR instrument at 50°C for 20 min. After the reaction was completed, it was immediately placed on ice for 5 min to terminate the reaction. The connection system is shown in Table 4.

[0083] Table 4 Recombinant vector reaction system

[0084]

[0085] (3) Take out the E. coli DH5a chemically competent cells from the -70°C refrigerator and melt on ice, take 10 μL of the recombinant vector and add to the centrifuge tube containing 100 μL of the competent cells, mix gently, then heat shock at 45°C for 1 min, then quickly transfer the centrifuge tube to ice and cool for 3 min, then add 900 μL of sterile LB medium (without antibiotics) to the centrifuge tube, mix, then place in a 37°C shaker at 160 rpm and culture for 1 h.

[0086] (4) According to the transformation instructions for E. coli DH5a chemically competent cells, transform the recombinant product obtained in the previous step into E. coli DH5a chemically competent cells, and evenly spread the transformed E. coli on LB solid medium plates containing ampicillin antibiotic resistance, and incubate at 37°C for 10 min, then invert and incubate overnight. The transformed plate is shown in Figure 3 . Pick positive clones for colony PCR verification. The colony PCR reaction system is: 2x PhantaMaster Mix 25 μL, pCBS-PC-F / R 2 μL each, DNA template 1 μL, ddH2O 20 μL. Verify whether the target fragment is inserted into the pCBS vector. The specific PCR reaction program is shown in Table 5 below. The colony PCR product electrophoresis band is shown in Figure 4 . Then, the correct E. coli verified is expanded in liquid shake flask, and the recombinant plasmid is extracted and subjected to enzyme digestion verification using SwiftCut BamHI and SwiftCut EcoRI for pCBS, and the electrophoresis result is shown in Figure 5 .

[0087] Colony PCR primer sequence information:

[0088] pCBS-PC-F: CCGACTGCGCAAAAGACATAATCGATAA

[0089] pCBS-PC-R: GCCAGCGCTTCGTTAATACAGATGT

[0090] Table 5 Colony PCR reaction program

[0091]

[0092]

[0093] Example 4

[0094] Construction of knockout strain LPB-18F△hfq

[0095] The construction process of the high antibiotic resistance ability strain LPB-18F△hfq is as follows: the plasmid extracted from the positive clone after the transformation in Example 3 is electrotransformed into the prepared competent B. amyloliquefaciens LPB-18F, the electrotransformation occurs in a pre-cooled electrotransformation cup (2 mm), 2500 v, 4.5 ms electric shock, and then 1 mL of LBS culture is immediately added into the electrotransformation cup, and then it is gently mixed, slowly sucked into a 2 mL centrifuge tube, and placed in a shaker (30℃, 120 r / min) for mild shaking culture for 3 h, centrifuged at 2500 g for 3 min at room temperature, and then 900 μL of supernatant is discarded, the bacterial body in the centrifuge tube is resuspended with the remaining culture medium, and then it is uniformly coated on an LB solid plate containing erythromycin resistance. The LB solid plate is placed vertically in a 30℃ incubator for 10 min, and then the plate is inverted after the bacterial liquid on the plate is completely absorbed, and then it is cultured overnight. If Figure 6 and Figure 7 The colony PCR amplification and electrophoresis detection are verified, the colony PCR primers are L-hfq-F and R-hfq-R, the successful knockout of the hfq coding gene is proved, and the high antibiotic tolerance strain LPB-18F△hfq is obtained.

[0096] Example 5

[0097] Erythromycin and ampicillin resistance detection

[0098] The B. amyloliquefaciens LPB-18F and LPB-18FΔhfq are inoculated into fresh LB liquid medium (100 mL of liquid in a 250 mL container) in advance and cultured overnight, the OD 600 = 1.0 is adjusted, and then it is coated on an LB solid plate, a 5 mm diameter filter paper is placed, 2.5 μL of erythromycin (macrolide) and ampicillin (ampicillin) with a concentration of 50 mg / mL is added dropwise, and then it is vertically cultured for 30 min until it is completely dried, and then it is inverted and cultured for 12 h, and then the transparent circle diameter is recorded. As shown in Figure 8 and 9 the ampicillin resistance is reduced from 32.39 mm to 8.55 mm, and the erythromycin resistance is reduced from 33.61 mm to 13.75 mm, which proves that the genetically engineered bacteria constructed by the application can significantly enhance the antibiotic resistance of B. amyloliquefaciens.

Claims

1. A genetically engineered Bacillus amyloliquefaciens strain with high antibiotic resistance, characterized in that, The genetically engineered bacteria were obtained by knocking out the gene encoding the RNA chaperone protein hfq or reducing the expression level of the gene, with the nucleotide sequence of the RNA chaperone protein hfq shown in SEQ ID NO.

1.

2. The genetically engineered Bacillus amyloliquefaciens with high antibiotic resistance according to claim 1, characterized in that, The Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LPB-18F, which is an engineered strain LPB-18N△fen36 obtained by knocking out the sRNA Fen36 of Bacillus amyloliquefaciens LPB-18N.

3. A method for constructing a genetically engineered Bacillus amyloliquefaciens with high antibiotic resistance as described in claim 1, characterized in that, Includes the following steps: (1) Design primers to amplify the upstream and downstream sequences of the RNA chaperone protein hfq, and fuse the RNA chaperone protein hfq into the knockout vector to obtain the recombinant vector. (2) The recombinant vector was transformed into competent Bacillus amyloliquefaciens cells to obtain genetically engineered bacteria.

4. The method for constructing a genetically engineered Bacillus amyloliquefaciens with high antibiotic resistance according to claim 3, characterized in that, The preferred primers for HFQ amplification in step (1) are as follows: L-hfq-F: GTACCCCGGGAGCTCGAATTCCAATGTCAGAGCATCTTAAAAC CCAAAAAC L-hfq-R: CAATATACAGATGCGCGCGTCATATCTGTCCATGAAACGGG R-hfq-F: TGGACAGATATGACGCGCGCATCTGTATATTGCAGGC R-hfq-R: CGTCGGGCGATATCGGATCCTGGTTGATTATCACCTTGTGTTT CAATCGT.

5. The application of the highly antibiotic-resistant Bacillus amyloliquefaciens genetically engineered strain as described in claim 1 in enhancing the antibiotic resistance of Bacillus amyloliquefaciens.

6. The application according to claim 5, characterized in that, The antibiotics include ampicillin and erythromycin.

7. The application of the RNA molecular chaperone protein hfq encoding gene or its expressed protein in regulating antibiotic resistance in Bacillus amyloliquefaciens.

8. The application according to claim 7, characterized in that, Application of knocking out the gene encoding the RNA molecular chaperone protein hfq or reducing its expression level in enhancing the antibiotic resistance of Bacillus amyloliquefaciens.

9. The application according to claim 8, characterized in that, The Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LPB-18F, which is an engineered strain LPB-18N△fen36 obtained by knocking out the sRNA Fen36 of Bacillus amyloliquefaciens LPB-18N.

10. The application according to claim 8, characterized in that, The antibiotics include ampicillin and erythromycin.

Images