The invention relates to a method based on 3apos; gene expression enhancement method for UTR (Untranslated Region) functional element N50-high reprogramming

Abstract

The invention relates to the technical field of molecular biology and plant genetic engineering, and provides a gene expression enhancement method based on 3 'UTR functional element N50-high reprogramming, which comprises the following steps: S1, reconstructing a translation regulation element N50-high in a 3' UTR region of a target gene, and constructing a dual-luciferase reporter vector; and S2, transforming plant protoplast by adopting a PEG (Polyethylene Glycol) method by taking the dual-luciferase reporter vector plasmid as plasmid DNA (Deoxyribonucleic Acid), and then extracting target protein. According to the invention, the translation regulatory element N50-high is relocated to the 3 'UTR region of the target gene, the protein expression level of the exogenous gene in the plant is significantly improved, the effect is independent of transcriptional level regulation, an innovative path of 3' UTR element function reprogramming is disclosed, and a brand new scheme is provided for solving the translation efficiency bottleneck in the prior art.

Description

Technical Field

[0001] This invention is based on a divisional application of "Application date: 2025-05-23, application number: 202510675802.0, title: A gene expression enhancement technology based on 3'UTR functional element reprogramming".

[0002] This invention relates to the fields of molecular biology and plant genetic engineering, and in particular to a gene expression enhancement method based on the reprogramming of the 3'UTR functional element N50-high. Background Technology

[0003] In the field of plant genetic engineering, the expression efficiency of exogenous genes is a core factor determining the success of crop trait improvement and recombinant protein production. Current technological development mainly focuses on promoter optimization (such as strong constitutive or inducible promoters) and the optimized design of the 5'UTR (such as ribosome binding sites), while the regulatory potential of the 3'UTR has not been fully explored. Studies have shown that the 3'UTR has a crucial impact on gene expression at the posttranscriptional level by regulating mRNA stability (such as nuclease resistance mediated by polyA signal sequences), ribosome dissociation and recycling efficiency (affecting ribosome release after translation termination through structural motifs), and interaction networks with RNA-binding proteins (RBPs) (such as microRNA target sites regulating translational repression). For example, polyA signal sequences enhance expression persistence by prolonging mRNA half-life, while AU-rich elements may accelerate mRNA metabolic clearance by recruiting degradation complexes.

[0004] Although existing patented technologies (such as CN117230062A) have disclosed various translation-enhancing functions of 5'UTR sequences, significant technological gaps remain in engineered regulatory strategies targeting the 3'UTR. The N50-high sequence, as a translation-enhancing element, has previously been limited to applications in the 5'UTR region. However, the functional mechanism of the N50-high sequence in the 3'UTR and its regulatory potential on gene expression have never been systematically studied. Summary of the Invention

[0005] In view of this, the present invention proposes a gene expression enhancement method based on the reprogramming of the 3'UTR functional element N50-high. By reconstructing the translation regulatory element N50-high in the 3'UTR region of the target gene, the expression level of exogenous genes in plants can be efficiently enhanced.

[0006] The technical solution of this invention is implemented as follows: This invention provides a gene expression enhancement method based on 3'UTR functional element N50-high reprogramming, comprising the following steps:

[0007] S1, the translation regulatory element N50-high was reconstructed in the 3'UTR region of the target gene to construct a dual-luciferase reporter vector;

[0008] S2 uses a dual-luciferase reporter vector plasmid as plasmid DNA, transforms plant protoplasts using the PEG method, and then extracts the target protein.

[0009] Based on the above technical solutions, preferably, the nucleotide sequence of N50-high is shown in SEQ ID NO.1.

[0010] Based on the above technical solutions, preferably, in step S1, the target gene is an exogenous transgenic gene or an endogenous gene, and its expression product is a protein or non-coding RNA.

[0011] Based on the above technical solutions, preferably, in step S2, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0012] The gene expression enhancement method based on 3'UTR functional element N50-high reprogramming of the present invention has the following advantages over the prior art:

[0013] (1) This invention demonstrates through groundbreaking experiments that repositioning the translation regulatory element N50-high to the 3'UTR region of the target gene significantly improves the protein expression level of exogenous genes in plants, and this effect is independent of transcriptional regulation. This reveals an innovative path for the functional reprogramming of 3'UTR elements and provides a new solution to the translation efficiency bottleneck in the existing technology.

[0014] (2) The target gene containing the N50-high sequence in the 3'UTR of this invention has a higher expression level than the target gene whose 3'UTR does not contain the N50-high sequence.

[0015] (3) The operation of the present invention is simple and does not require complex promoter and 5'UTR sequence modification. It only requires inserting the N50-high sequence into the 3'UTR region of the target gene.

[0016] (4) The mechanism of action of this invention is that the N50-high sequence reduces the degradation effect of nucleases and prolongs the half-life of mRNA by forming a specific secondary structure, thereby enhancing the stability of mRNA to encode more proteins. Since the N50-high translation regulatory element located in the 5'UTR enhances the expression of target genes in different plant species, this invention also tested the regulatory effect of the N50-high sequence located in the 3'UTR in different plants (such as Arabidopsis thaliana, tobacco, and rice). The results showed that the N50-high sequence located in the 3'UTR exhibited a stable regulatory effect in Arabidopsis thaliana, tobacco, and rice species, indicating its wide applicability. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The diagram shows the structure of a dual-luciferase vector containing the regulatory element N50-high inserted into the 3'UTR.

[0019] Figure 2 A diagram illustrating the expression of the target gene in Arabidopsis protoplasts by using a 3'UTR containing the N50-high sequence;

[0020] Figure 3 Map showing the expression of the target gene in tobacco protoplasts by enhancing the 3'UTR containing the N50-high sequence;

[0021] Figure 4 A diagram showing how the expression of the target gene in rice protoplasts is enhanced by the 3'UTR containing the N50-high sequence. Detailed Implementation

[0022] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0023] The following are specific embodiments of the present invention, including experimental design, materials, and methods.

[0024] Example 1: Carrier Construction and Functional Verification

[0025] I. Carrier Design

[0026] like Figure 1 As shown, a dual-luciferase reporter vector was constructed and named pSYB-Dual-LUC01-TBF1, containing FLUC (Firefly luciferase) driven by the Ubiquitin promoter and RLUC (Renilla luciferase) driven by the 35S promoter.

[0027] Construction of experimental vector: The N50-high sequence was inserted into the 3'UTR region of the FLUC gene in the pSYB-Dual-LUC01-TBF1 vector, and the constructed vector was named pSYB25-N50-high(3'UTR) (e.g., Figure 1 (As shown).

[0028] The nucleotide sequence of N50-high is shown in SEQ ID NO.1.

[0029] SEQ ID NO. 1: CGGGCAGCCTAACTACGGGTACACCCGAAGCTCAAAC AATAGGCACACAT.

[0030] The nucleotide sequences of pSYB-Dual-LUC01-TBF1 and pSYB25-N50-high(3'UTR) are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0031] The specific steps for constructing the pSYB23-N50-high(3'UTR) vector are as follows:

[0032] (1) PCR amplification of N50-high sequence

[0033] PCR reaction system: Nuclease-free Water 20μL, Biorun Pfu PCR Mix 25μL, E22557_0S1(+)(10μM) 2μL, E22557_0S1(-)(10μM) 2μL, template 1μL, total volume 50μL.

[0034] Primers for amplifying the N50-high sequence:

[0035] E22559_0S1(+):TTCTAGAGCGGCCGCGGATCCGGGCAGCCTAACTACG GG;

[0036] E22559_0S1(-):GTGATTTCAGCGAATTCACTAGTATGTGGTGCCTATTGTT TGAGCTTC.

[0037] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 sec, 50℃ for 30 sec, 72℃ for 10 sec, 30 cycles; 72℃ for 5 min, 16℃ for 30 min.

[0038] Electrophoresis was performed on a 1.5% agarose gel at a 5 V / cm electric field for 20 minutes. After confirmation by UV imaging, the target band N50-high (50 bp) was excised for gel recovery and purification. DNA purification was performed using a column-based gel extraction kit, and the recovered product (labeled as rDNA03) was obtained by elution with 40 μL of sterile deionized water. After verifying fragment integrity and Nanodrop nucleic acid concentration by 1% agarose gel electrophoresis, the purified DNA fragment was ligated into a linearized vector treated with restriction endonucleases for in vitro recombination experiments.

[0039] (2) Enzyme digestion vector

[0040] Enzyme digestion system: Nuclease-free Water 12μL, 10*Buffer 2μL, BamHI 1μL, SpeI 1μL, pSYB-Dual-LUC01-TBF 14μL, Total 20μL.

[0041] Enzyme digestion conditions: 37℃ for 1 hour.

[0042] The vector digests were purified using a PCR purification kit (the purified product was labeled Vector(D)3) for use in the next recombinant reaction.

[0043] (3) Recombination reaction

[0044] Recombinant reaction system: Nuclease-free Water 10 μL, Biorun 2*EasyClone Mix 10 μL, rDNA 0 15 μL, Vector(D) 15 μL, Total 20 μL.

[0045] Recombination conditions: 37℃ for 30 min.

[0046] The ligation product was then transformed into competent cells, and the specific steps are as follows:

[0047] Under ice bath conditions, add 5 μL of ligation product to 50 μL of LDH5α competent cell suspension (pre-cooled), mix gently, and incubate on ice for 30 min. Heat shock at 42°C for 90 seconds, then immediately incubate on ice for 2 min to terminate the reaction. Add 500 μL of sterile LB broth (antibiotic-free), and incubate at 37°C with shaking for 1 h to restore the cells. Spread 100 μL of the bacterial culture evenly onto Kans resistant plates (50 μg / mL), and incubate upside down at 37°C for 12–16 h. Pick positive single clones for subsequent experiments.

[0048] II. Preparation of Arabidopsis protoplasts

[0049] 1. Tissue preparation: Select 3-4 week old Arabidopsis plants and use a sterile scalpel to longitudinally cut the leaves along the midrib into tissue strips 0.5-1 mm wide. At a ratio of 1.5 g fresh weight leaf / 10 mL enzymatic hydrolysate, quickly immerse the tissue strips in pre-cooled compound enzymatic hydrolysate (containing 1.5% cellulase R10 + 0.4% analyte R10).

[0050] Enzymatic hydrolysate components: Cellulase R10 1.5%, Macerozyme R10 0.4%, Mannitol 0.4M, KCl 20mM, MES (pH 5.7) 10mM.

[0051] Adjust the pH of the above enzymatic hydrolysate to 5.8, heat at 55°C for 10 min, invert and mix three times, cool to room temperature, and then add the following solutions: CaCl2 (final concentration 10 mM), BSA (Sigma A-6793) (final concentration 0.1%). Add ddH2O to 10 mL, filter and sterilize using a 0.22 μm filter membrane, and use immediately.

[0052] 2. Enzymatic hydrolysis

[0053] Vacuum permeation: Place the sample in a vacuum desiccator and apply a pressure of -0.08 MPa for 30 minutes to promote enzyme permeation.

[0054] Isothermal digestion: Transfer to a 26℃ isothermal shaker and digest at 60 rpm in the dark for 3-4 hours. The protoplast release rate was monitored using an inverted microscope and found to be over 80%.

[0055] III. Protoplast Purification

[0056] 1. Termination of reaction: Add an equal volume of W5 termination buffer to the enzyme digestion system and manually vortex horizontally (amplitude 5cm, frequency 2Hz) for 10s to terminate enzyme activity.

[0057] W5 solution composition: NaCl 154mM, CaCl2 125mM, KCl 2mM, MES 2mM.

[0058] Adjust the pH of the above W5 solution to 5.7-5.8, and finally add ddH2O to 100mL; sterilize by filtration through a 0.22μm filter membrane, and store at 4℃.

[0059] 2. Filtration and collection: Filter through a 75μm nylon sieve into a 50mL conical centrifuge tube, and add 10mL of W5 buffer to rinse away any remaining tissue.

[0060] 3. Gradient purification

[0061] Primary centrifugation: Centrifuge horizontally at 100×g for 3 min to collect protoplasts;

[0062] Cold shock treatment: Resuspend the precipitate in 5 mL of W5 buffer and incubate on ice for 30 min;

[0063] Second centrifugation: After centrifugation under the same conditions, the solution was replaced with MMG suspension (final volume ≈ 2 × 10⁻⁶). 5 (cells / mL)

[0064] MMG solution composition: Mannitol 0.4M, MgCl2·6H2O 15mM, MES 4mM.

[0065] Adjust the pH of the above MMG solution to 5.7-5.8, and finally add ddH2O to 10 mL; sterilize by filtration through a 0.22 μm filter membrane, and store at 4 °C.

[0066] IV. Transient transformation of Arabidopsis protoplasts

[0067] 1. Protoplast cell treatment

[0068] Discard the W5 solution after it has been left to stand on ice for 30 minutes (the cells have settled naturally and do not require centrifugation).

[0069] Add 100 μL MMG solution to each sample, and adjust the cell density under a microscope (add more MMG if the density is too high) to ensure the cells are rounded.

[0070] 2. PEG transfection

[0071] Pre-cooled (4℃) protoplast suspension was mixed with PEG4000 solution in the following ratio: 100 μL cells + 110 μL PEG4000. The PEG was slowly added to the inner wall of the tube cap, the tube was inverted to mix, and the mixture was incubated in a 23℃ water bath for 15 min.

[0072] PEG4000 (40% v / v): PEG4000 (40%) 2g, Mannitol (0.2M) 1.25mL, CaCl2 (100mM) 500μL, H2O to make up to 5mL.

[0073] 3. Termination and Washing

[0074] Add 1 mL of W5 solution and mix gently. Centrifuge at 300 rpm for 2 min at 4°C and discard the supernatant. Repeat the washing process 2-3 times.

[0075] 4. Protoplast Culture and Detection

[0076] The culture system was placed in a 23℃ constant temperature and light incubator (light intensity 80 μmol·m²). -2 ·s -1 The cells were cultured at 60% humidity for 16-18 hours. The cells were then lysed and total protein was extracted. The enzyme activities of FLUC and RLUC were measured using a microplate reader.

[0077] V. Results Analysis

[0078] like Figure 2 As shown, the FLUC / RLUC enzyme activity in the Arabidopsis protoplast expression group of pSYB25-N50-high(3'UTR) was significantly increased compared with the control group pSYB-Dual-LUC01-TBF1.

[0079] The results showed that the regulatory element N50-high located in the 3'UTR could significantly increase the expression level of the target protein.

[0080] Example 2: Verification of Multi-Plant Systems

[0081] Referring to Example 1, the above experiment was repeated in tobacco protoplasts and rice protoplasts. The results showed that the regulatory element N50-high located in the 3'UTR could increase the expression level of the target protein. Figure 3 and Figure 4 ).

[0082] The results confirmed that the regulatory element N50-high located in the 3'UTR enhances the expression of the target gene in a species-wide manner.

[0083] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A gene expression enhancement method based on 3'UTR functional element N50-high reprogramming, characterized in that: Including the following step: S1, the translation regulatory element N50-high was reconstructed in the 3'UTR region of the target gene to construct a dual-luciferase reporter vector; S2 uses a dual-luciferase reporter vector plasmid as plasmid DNA, transforms plant protoplasts using the PEG method, and then extracts the target protein.

2. The gene expression enhancement method based on 3'UTR functional element N50-high reprogramming as described in claim 1, characterized in that: The nucleotide sequence of the N50-high is shown in SEQ ID NO.

1.

3. The gene expression enhancement method based on 3'UTR functional element N50-high reprogramming as described in claim 1, characterized in that: In step S1, the target gene is an exogenous transgenic gene or an endogenous gene, and its expression product is a protein or non-coding RNA.

4. The gene expression enhancement method based on 3'UTR functional element N50-high reprogramming as described in claim 1, characterized in that: In step S2, the plant is a monocotyledonous plant or a dicotyledonous plant.

Images