Bemisia tabaci nymph development gene BtPri39 and application thereof
By identifying and interfering with the BtPri39 gene of the whitefly nymph, and combining it with nanocarrier materials, the problems of chemical pesticide resistance and ecological impact in the control of whiteflies were solved. This achieved highly efficient RNAi control of nymphs, and was safe for the natural enemy Encarsia formosa, resulting in an environmentally friendly biological control effect.
Patent Information
- Application Number
- CN202511146753.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-11-18
AI Technical Summary
Current technologies for controlling whiteflies mainly rely on chemical pesticides, which can lead to increased resistance and environmental impacts. Furthermore, whiteflies have high reproductive capacity, and there is insufficient research on RNAi control during the nymphal stage, as well as inadequate screening of RNAi targets with safe natural enemies.
Bioinformatics analysis identified the BtPri39 gene, which is highly expressed in the nymphal stage of the whitefly. This gene has no homology in Encarsia formosa. dsRNA was designed to interfere with the BtPri39 gene in whitefly nymphs. Combined with a nanocarrier composite material, this significantly reduced the nymphal survival rate without significantly affecting Encarsia formosa.
It significantly reduces the survival rate of whitefly nymphs, is easy to operate, highly effective and specific, safe for Encarsia formosa, environmentally friendly, and has good application prospects.
Smart Images

Figure HDA0005551223550000011 
Figure HDA0005551223550000012 
Figure HDA0005551223550000021
Abstract
Description
BACKGROUND
[0001] The present application relates to the technical field of biological control, in particular to a gene BtPri39 of Bemisia tabaci and application thereof. TECHNICAL FIELD
[0002] Bemisia tabaci is a globally distributed agricultural pest with wide distribution, which causes serious economic losses to vegetables, cotton, tobacco and other crops. At present, the control of Bemisia tabaci still mainly relies on chemical pesticides such as organophosphorus and carbamate. However, with the increasing resistance of Bemisia tabaci to various pesticides, and the adverse effects of chemical control on the ecological environment and non-target organisms, it is an urgent need to develop new control methods that are efficient, safe and environmentally friendly.
[0003] Compared with traditional chemical pesticides, RNA interference (RNAi) technology has the advantages of high target specificity and little effect on non-target organisms. Biological pesticides based on RNAi can precisely interfere with the expression of specific genes of pests, have good specificity and ecological safety, and can be used with other biological control strategies. In addition, RNAi can effectively reduce the risk of resistance caused by target gene mutation by designing interference fragments targeting different genes or different regions of the same gene. At present, RNAi research on Bemisia tabaci mainly focuses on the adult stage. However, Bemisia tabaci has a strong reproductive capacity, and the adults can start laying eggs within 2 days after eclosion, and the population expands rapidly. Therefore, an effective control strategy should focus on the nymph stage as the key intervention period, but the research on RNAi control of Bemisia tabaci nymphs is still relatively limited.
[0004] Encarsia formosa is an important natural enemy of Bemisia tabaci, which can significantly inhibit the number of nymphs through parasitism and feeding, and is one of the most widely used and successful biological control insects for whitefly in the world. To ensure the ecological safety of RNAi technology in pest control, it is crucial to develop RNAi targets that are harmless to natural enemies. However, the current research on the screening of RNAi targets that are safe to natural enemies of Bemisia tabaci is still insufficient, and further exploration is needed. SUMMARY
[0005] The present application identifies a gene BtPri39 of Bemisia tabaci through bioinformatics analysis technology, and there is no homologous gene of the gene in Encarsia formosa. After RNAi of the gene in Bemisia tabaci nymphs, the survival rate of Bemisia tabaci nymphs is significantly reduced, and the survival rate of Encarsia formosa is not significantly affected, which provides a theoretical basis for the development and production of green biological pesticides for controlling Bemisia tabaci.
[0006] The Bemisia tabaci gene BtPri39 has a nucleotide sequence as shown in SEQ ID NO. 3.
[0007] The dsRNA for biological control of Bemisia tabaci is synthesized by using the primer designed for the BtPri39 gene of Bemisia tabaci.
[0008] The dsRNA synthesis method specifically comprises the following steps: using the cDNA reverse transcribed from the total RNA of Bemisia tabaci as a template, performing PCR amplification by using the primer designed for the BtPri39 gene of Bemisia tabaci, recovering and purifying the PCR amplification product and taking the PCR amplification product as a template for in vitro transcription of dsRNA, and synthesizing dsRNA by in vitro transcription.
[0009] The primer for synthesizing the dsRNA is shown in SEQ ID NO. 4 and SEQ ID NO. 5.
[0010] A biological preparation for controlling Bemisia tabaci contains the dsRNA for biological control of Bemisia tabaci.
[0011] The biological preparation further comprises a nano-carrier composite material, and the nano-carrier composite material is SPc.
[0012] The BtPri39 gene of Bemisia tabaci and the dsRNA for biological control of Bemisia tabaci are applied to control Bemisia tabaci.
[0013] The application is to spray the biological preparation containing the dsRNA for biological control of Bemisia tabaci on the body surface of Bemisia tabaci, so as to reduce the survival rate of Bemisia tabaci.
[0014] The concentration of the dsRNA in the biological preparation is greater than or equal to 500 ng / μL.
[0015] The Bemisia tabaci is MEA1 cryptic species (Middle East-Asia Minor 1), that is, B-type Bemisia tabaci.
[0016] The technical scheme of the present application is as follows:
[0017] Through transcriptome analysis, a nymph stage high-expression gene with a TPM>1000 in the nymph stage of Bemisia tabaci is screened.
[0018] On the basis of the above scheme, the nymph stage high-expression gene is subjected to local BLAST in the genome of Encarsia formosa, and a gene without homology in Encarsia formosa, that is, BtPri39, is screened, and the nucleotide sequence is shown in SEQ ID NO. 3.
[0019] On the basis of the above scheme, the expression of the BtPri39 gene in the nymphs of Bemisia tabaci is inhibited by gene silencing, and the survival rate of the nymphs of Bemisia tabaci is reduced.
[0020] On the basis of the above scheme, the gene silencing method is RNA interference.
[0021] A dsRNA for biological control of Bemisia tabaci, a primer is designed for Bemisia tabaci BtPri39 gene, and a dsRNA for Bemisia tabaci BtPri39 gene is synthesized; the nucleic acid sequence of the Bemisia tabaci BtPri39 gene is shown as SEQ ID NO. 3.
[0022] The application method is to form a reagent for controlling Bemisia tabaci by combining the above-mentioned dsRNA with nanomaterials, and dropping on the body surface of Bemisia tabaci nymphs.
[0023] On the basis of the above scheme, the concentration of dsRNA in the reagent for controlling Bemisia tabaci is ≥500 ng / μL.
[0024] On the basis of the above scheme, the dsRNA of the BtPri39 gene is prepared by the following method:
[0025] The cDNA reverse transcribed from the total RNA of Bemisia tabaci is used as a template, and a primer for synthesizing dsRNA is used for PCR amplification, and the PCR amplification product is recovered and purified and used as a template for in vitro transcription of dsRNA.
[0026] On the basis of the above scheme, the primer for synthesizing dsRNA is shown as SEQ ID NO. 4 and SEQ ID NO. 5.
[0027] On the basis of the above scheme, the Bemisia tabaci is MEA1 cryptospecies (Middle East-Asia Minor 1, i.e. B-type Bemisia tabaci).
[0028] The present application has the following beneficial effects:
[0029] The present application provides BtPri39 gene of Bemisia tabaci and its application in Bemisia tabaci control, and develops efficient silencing dsRNA and technology for efficiently controlling Bemisia tabaci, i.e. by dropping BtPri39 dsRNA fragments into Bemisia tabaci body to significantly reduce the survival rate of Bemisia tabaci nymphs, while the survival rate of Encarsia formosa has no significant effect, so as to achieve the control purpose. The method is convenient to operate, effective and specific, has obvious lethality effect, is safe to the natural enemy Encarsia formosa of Bemisia tabaci, and has many advantages such as environmental friendliness, and has good application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 BtPri39 expression level in Bemisia tabaci body after 48h of RNAi;
[0031] Figure 2Survival rate of B. tabaci nymphs after BtPri39 knockdown by RNAi;
[0032] Figure 3 B. tabaci nymphs death phenotype;
[0033] Figure 4 Survival rate of P. xylosta after the same dsRNA treatment. DETAILED DESCRIPTION
[0034] The following will be described in conjunction with specific examples:
[0035] Source of experimental materials:
[0036] The B. tabaci MEAM1 population involved in the examples is a long-term laboratory rearing population.
[0037] Source of experimental materials:
[0038] Total RNA Kit kit: purchased from Omega Biotechnology Company;
[0039] TransScript All-in-One reverse transcription reagent: purchased from Genstar Biotechnology Company;
[0040] DNA Polymerase: purchased from TransGen Biotech Company;
[0041] TaKaRa MiniBEST DNA Fragment Purification Kit: purchased from Takara Biotechnology Co., Ltd.;
[0042] -Blunt Cloning Kit Blunt gene cloning kit: purchased from TransGen Biotech Company;
[0043] Plasmid Mini Kit: purchased from Omega Biotechnology Company;
[0044] 2x RealStar Fast SYBR qPCR Mix: purchased from Genstar Biotechnology Company;
[0045] HighYield T7 RNA Transcription Kit: purchased from Shanghai Polony Biotechnology Co., Ltd.;
[0046] Nanocarrier composite material: Star polycation (SPc); commercially available, in this study, the nanocarrier SPc was introduced as an efficient carrier tool to enhance the stability of dsRNA, protect it from enzymatic degradation, and effectively promote its delivery efficiency in entomopathogenic fungi and plant cells.
[0047] The primers involved in the examples were all entrusted to Shengong Biological Company for synthesis.
[0048] Example 1: Screening of target genes
[0049] The applicant obtained 18 transcriptome RNA-seq data sets covering various developmental stages such as eggs, 1-2 instar nymphs, 3 instar nymphs, 4 instar nymphs, male adults, and female adults from the NCBI SRA database (https: / / www.ncbi.nlm.nih.gov / sra). The data analysis process is as follows: First, use fastp to perform quality control and filtering on the original sequencing data to obtain clean reads; then use Hisat2 (version 2.1.0) to align the clean reads to the Bemisia tabaci MEAM1 reference genome (version v1.2, from Whitefly Genome Database: http: / / www.whiteflygenomics.org / cgi-bin / bta / index.cgi); then use featureCounts (version 1.6.4) to count the original expression of each gene (count value), and convert the count value to TPM (Transcripts Per Million) by TBtools. With TPM value > 1000 as the screening threshold, further screen the genes with TPM exceeding 1000 in 1-2 instar, 3 instar and 4 instar nymphs, as candidate genes for subsequent analysis.
[0050] In order to evaluate the conservation and potential ecological safety of these genes highly expressed in nymph stage in natural enemies of insects, Blastp function in BioEdit (version 7.0.9) was used for local alignment in the genomes of Encarsia formosa, Harmonia axyridis, and Eretmocerus hayati. Set the E-value threshold to 1, and count the number of Blastp alignment results corresponding to each candidate gene of Bemisia tabaci in the natural enemies. It was found that the BtPri39 gene highly expressed in Bemisia tabaci nymphs had no homologous genes in the three natural enemies.
[0051] Example 2: Knockdown of BtPri39 expression level
[0052] I. Synthesis of dsRNA
[0053] (1) About 200 whiteflies of different ages were collected, and total RNA was extracted using a total RNA extraction kit provided by Omega. According to the kit instructions, 1 μg of total RNA was used to synthesize first-strand cDNA using TransScript All-in-One reverse transcription reagent produced by Genstar.
[0054] (2) The above cDNA was used as a template for PCR amplification using high-fidelity DNA polymerase provided by TransGen Biotech. The amplification product was verified by 1% agarose gel electrophoresis, as shown in Figure 1 . Purification was performed using a Takara PCR recovery kit. The primers used for amplifying BtPri39 are shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0055] FPri39: 5'-ATGTTCAAGTTGTTGGTCGTCG-3' (SEQ ID NO. 1);
[0056] RPri39: 5'-CTATTTCTTGATGTATCCGCCAAT-3' (SEQ ID NO. 2);
[0057] (3) The purified PCR product was ligated to the pEASY-T1 vector (TransGen) and transformed into LB medium containing 100 μg / mL kanamycin, and incubated at 37°C overnight. Finally, five independent clones were randomly selected from the transformed colonies for sequencing verification to ensure the accuracy and integrity of the clones. The BtPri39 full-length plasmid was obtained, and the sequence is shown in SEQ ID NO. 3, with a length of 258 bp.
[0058] SEQ ID NO. 3 (5'→3'):
[0059] ATGTTCAAGTTGTTGGTCGTCGCTTTCGCTCTCATCGCCGCCGCTGCCGCCACTCACTTGGCTTACAGTAGCTACATGCCCTACTCTGGTGCTTACTCTGGCTACGCCGCGCCATACTCCGCCGCCGGCTGGTCTGGCTACTCTGGTGCTTACCCTGGATACGCCGGCGCTTACCCTGGATACGCCGGCGCTTACCCTGGATATGGATACTCTGCACACCTCGGATACTCCGGCATTGGCGGATACATCAAGAAATAG
[0060] (4) Bacterial solution The plasmid was extracted by using a plasmid extraction kit (Omega), and the interference fragment was obtained by PCR. The primers used for the interference fragment are shown in SEQ ID NO. 4 and SEQ ID NO. 5. The sequence of the interference fragment is shown in SEQ ID NO. 8, and the length is 150 bp.
[0061] iPri39F: 5'-taatacgactcactatagggACATGCCCTACTCTGGTGCT-3' (SEQ ID NO. 4);
[0062] iPri39R: 5'-taatacgactcactatagggCGAGGTGTGCAGAGTATCCA-3' (SEQ ID NO. 5);
[0063] SEQ ID NO. 8 (5'→ 3'):
[0064] ACATGCCCTACTCTGGTGCTTACTCTGGCTACGCCGCGCCATACTCCGCCGCCGGCTGGTCTGGCTAC
[0065] TCTGGTGCTTACCCTGGATACGCCGGCGCTTACCCTGGATACGCCGGCGCTTACCCTGGATATGGATACTCTGC
[0066] ACACCTCG
[0067] (5) Double-stranded RNA (dsRNA) was synthesized according to the manufacturer's instructions, followed by purification of the dsRNA product using phenol:chloroform extraction combined with ethanol precipitation. The purified dsRNA was tested for integrity by 1% agarose gel electrophoresis, and the concentration was determined using a Nanodrop spectrophotometer. All dsRNA samples were stored at -80°C until used in subsequent experiments. The sequence of the sense strand of the double-stranded RNA (dsRNA) is shown in SEQ ID NO. 9, and the sequence of the antisense strand is shown in SEQ ID NO. 10.
[0068] SEQ ID NO. 9 (5'→ 3'):
[0069] ACAUGCCCUACUCUGGUGCUUACUCUGGCUACGCCGCGCCAUACUCCGCCGCCGGCUGGUCUGGCUAC
[0070] UCUGGUGCUUACCCUGGAUACGCCGGCGCUUACCCUGGAUACGCCGGCGCUUACCCUGGAUAUGGAUACUCUGC
[0071] ACACCUCG
[0072] SEQ ID NO. 10 (5'→ 3'):
[0073] CGAGGUGUGCAGAGUAUCCAUAUCCAGGGUAAGCGCCGGCGUAUCCAGGGUAAGCGCCGGCGUAUCCA
[0074] GGGUAAGCACCAGAGUAGCCAGACCAGCCGGCGGCGGAGUAUGGCGCGGCGUAGCCAGAGUAAGCACCAGAGUA
[0075] GGGCAUGU
[0076] (6) At the same time, dsRNA (dsGFP) of green fluorescent protein (GFP) was synthesized as a control group for subsequent RNA interference (RNAi) experiments.
[0077] II. RNAi
[0078] The bean plants with two true leaves were selected, and the leaf surface was confirmed to be free of B. tabaci eggs and nymphs under a microscope before B. tabaci infection. To obtain nymphs of the same age, about 400 B. tabaci MEAM1 adults were placed on bean leaves to lay eggs for 4 hours, and then the adults were removed, and the plants were placed in a climate chamber with a culture condition of 26±1°C, relative humidity of 60±10%, and a light cycle of 16 hours light: 8 hours darkness.
[0079] The 3rd instar nymphs were selected as the RNA interference experimental objects, and dsGFP and dd water were used as control groups. 10 μL of a droplet containing dsRNA was directly added to the surface of the nymphs using a pipette. The concentration of the dsRNA solution used was 0.5 μg / μL, which was obtained by mixing 1 μg / μL of dsRNA with an equal volume of nanocarrier SPc. SPc is a cationic dendrimer composed of four peripheral amino acid functional arms. The treated plants were placed back in the climate chamber together with the nymphs. After 48 hours of RNAi treatment, the expression level of the target gene was detected by RT-qPCR to evaluate the interference efficiency. The survival rate of the nymphs was recorded daily for 9 consecutive days, and 3 biological replicates were set for each treatment, each containing 20 nymphs.
[0080] III. RT-qPCR
[0081] The total RNA was extracted and reverse transcribed to synthesize the first strand cDNA according to the above method. The RT-qPCR reaction used 2×RealStar Fast SYBR qPCR Mix provided by GenStar (China), with a reaction volume of 20 μL, including 10 μL of 2×mix, 0.5 μL of forward and reverse primers (10 μM), 2 μL of cDNA (final concentration of about 17.5 ng / μL), and 7 μL of RNase-free water. The experiment was performed on a Bio-Rad CFX96 real-time fluorescent quantitative PCR instrument (USA), and the amplification program was as follows: pre-denaturation at 95°C for 2 minutes, followed by 40 cycles, each cycle including 94°C for 15 seconds, 60°C for 30 seconds, and 70°C for 30 seconds. Each sample had three technical repeats, and three biological repeats were independently tested. The reference genes EFl-a and ACTIN of B. tabaci were used as reference genes, and the 2 -ΔΔCt The relative expression of the target gene was calculated by the method, and the results were expressed as mean ± standard error. This analysis method effectively reflects the expression changes of the target gene at different developmental stages. The RT-qPCR primers used are shown in SEQ ID NO. 6 and SEQ ID NO. 7.
[0082] qPri39F: 5'-GTTGTTGGTCGTCGCTTTC-3' (SEQ ID NO. 6);
[0083] qPri39R: 5'-CCAGAGTAAGCACCAGAGTAG-3' (SEQ ID NO. 7);
[0084] The results of RT-qPCR detection are shown in Figure 2 The results show that the expression level of BtPri39 is significantly reduced to 0.48 times of the control group after 48 hours of treatment.
[0085] The results show that the expression level of BtPri39 in B. tabaci is successfully knocked down after 48 hours of RNAi treatment.
[0086] Example 3: Effect of BtPri39 knockdown on the survival of B. tabaci nymphs
[0087] After 48 hours of RNAi treatment, the expression level of the target gene was detected by RT-qPCR, and then the survival rate of nymphs was recorded daily for 9 consecutive days. Each treatment had 3 biological replicates, and each replicate contained 20 nymphs. The results are shown in Figure 3 The survival of nymphs was continuously monitored for 9 days after RNAi treatment. The results show that the survival rate of the dsRNA treatment group continuously decreased and significantly decreased to 8% on the 9th day, which was significantly lower than that of the dsGFP control group (78%) and the water control group (79%), indicating a strong lethal effect. From the phenotype, the control group of nymphs showed full body shape, oval shape, and full blood lymph, showing a healthy and active state; while the nymphs in the dsRNA treatment group were significantly atrophied, shriveled, and showed obvious dehydration, showing the characteristics of growth inhibition and serious physiological function disorder, as shown in Figure 4 These results show that BtPri39 is a potential and efficient RNAi lethal target.
[0088] Example 4: Effect of BtPri39 on the survival of C. halofasciatus
[0089] The C. halofasciatus adults were treated by local delivery of RNAi method. The C. halofasciatus adults were selected within 24 hours after emergence. They were placed in a low temperature environment at 4°C for a short time to temporarily lose their ability to move. Then, 0.5 μL of dsRNA / nanocarrier complex consistent with the RNAi experiment of B. tabaci was directly dropped on the body surface of C. halofasciatus using a microinjection system. dsGFP and sterile water were used as controls. After the C. halofasciatus recovered, they were moved into a finger tube for feeding. Individuals that still could not recover their activity within 30 minutes after treatment were determined to be dead due to low temperature or operation process, and were not included in the subsequent survival rate statistics.
[0090] To ensure the feeding conditions, the mouth of the pointed tube was closed with gauze dipped in honey water, and sucrose water was supplemented daily to provide sufficient nutrition. Each treatment had 3 biological replicates, and each replicate contained 20 C. coccophagus. The survival rate was recorded daily during the experiment to evaluate the toxic effects of dsRNA on C. coccophagus.
[0091] The results showed that the survival rate of the dsRNA treatment group was 88%, which was not significantly different from the dsGFP control group (89%) and the water control group (91%). This result further confirmed that the RNAi target BtPri39 against B. tabaci had good specificity and ecological safety without affecting the survival of natural enemy insects, providing a theoretical basis for its integration in field biological control systems.
Claims
1. The whitefly gene BtPri39, whose nucleotide sequence is shown in SEQ ID NO.
3.
2. A dsRNA for the biological control of whiteflies, designed and synthesized using the whitefly BtPri39 gene or a fragment thereof as described in claim 1 as a target.
3. The dsRNA according to claim 2, wherein the synthesis method specifically includes the following steps: using cDNA reverse transcribed from total RNA of whiteflies as a template, using primers designed for the synthesis of dsRNA targeting the BtPri39 gene fragment of whiteflies for PCR amplification, recovering and purifying the PCR amplification product and using it as a template for in vitro transcription of dsRNA, and synthesizing dsRNA by in vitro transcription.
4. The dsRNA according to claim 3, wherein the whitefly BtPri39 gene fragment is shown in SEQ ID NO.8, and the sense strand sequence of the dsRNA is shown in SEQ ID NO.9, and the antisense strand sequence is shown in SEQ ID NO.
10.
5. The dsRNA according to claim 4, wherein the primers for synthesizing the dsRNA are shown in SEQ ID NO.4 and SEQ ID NO.
5.
6. A biological agent for controlling whiteflies, comprising the dsRNA for the biological control of whiteflies as described in any one of claims 2-5.
7. The biological agent according to claim 6 further comprises a nanocarrier composite material, wherein the nanocarrier composite material is a star-shaped cationic polymer SPc.
8. The use of the whitefly gene BtPri39 as described in claim 1, or the dsRNA for the biological control of whiteflies as described in any one of claims 2-5, or the biological agent as described in any one of claims 6-7 in the control of whiteflies.
9. The application according to claim 8, wherein a biological agent containing dsRNA for the biocontrol of whiteflies is sprayed onto the body surface of whiteflies, thereby reducing the survival rate of whiteflies.
10. In the application according to claim 9, the concentration of dsRNA in the biological reagent is ≥500 ng / μL.