Vibrio harveyi cytR gene and method for inhibiting gene horizontal transfer by knocking out vibrio harveyi cytR gene
By knocking out the cytR gene of Vibrio harveyi and constructing recombinant plasmids using homologous recombination, the conjugation transfer efficiency of Vibrio harveyi was reduced, solving the problem of high conjugation transfer efficiency between Vibrio harveyi plasmids and achieving effective control of drug resistance and pathogenicity.
Patent Information
- Application Number
- CN202510887823.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-11-18
AI Technical Summary
Vibrio harveyi has serious drug resistance problems. The high efficiency of plasmid conjugation and transfer leads to complex transmission of pathogenicity and drug resistance. Existing control methods are limited, and there is a need to effectively reduce plasmid conjugation and transfer efficiency in order to control the virulence and drug resistance of pathogenic microorganisms.
The cytR gene of Vibrio harveyi was knocked out. Gene knockout primers were designed, and recombinant plasmids were constructed using homologous recombination. These plasmids were transformed into donor and recipient strains, and conjugation transfer experiments were performed to screen for Vibrio harveyi strains lacking the cytR gene, thereby reducing their conjugation transfer efficiency.
This significantly reduces Vibrio harveyi's ability to acquire exogenous plasmids, inhibits horizontal gene transfer, and reduces the spread of drug resistance and pathogenicity, providing a new method to combat drug-resistant pathogens.
Smart Images

Figure CN120966848A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a cytR gene of Vibrio harveyi and a method for inhibiting horizontal transfer of the cytR gene of Vibrio harveyi. BACKGROUND
[0002] Vibrio harveyi is an important opportunistic pathogen of mariculture organisms, which has caused great harm to the mariculture industry. It is found that about 70% of the Vibrio disease of marine fish in the coastal waters of South China is caused by Vibrio harveyi. Due to the limitations of other control methods such as vaccines and immune enhancers, antibiotics are considered to be the most effective and flexible weapon against bacterial infectious diseases, and are widely used to prevent or treat bacterial diseases in aquaculture. At present, the drug resistance of Vibrio harveyi is serious, and the drug resistance index is as high as 0.60. The urgency of effective disease control and the drug resistance caused by antibiotic treatment both indicate the urgent need to explore new disease control strategies, and attenuation and resistance reduction is the fundamental requirement for disease control and the key to implementing green and healthy aquaculture.
[0003] The key to attenuation and resistance reduction lies in the control of virulence genes and drug resistance genes. The virulence genes and drug resistance genes of pathogenic microorganisms can be horizontally transferred between different species through conjugation transfer of mobile genetic elements such as plasmids, thereby enhancing the pathogenicity and drug resistance of pathogenic bacteria and increasing the complexity and variability of disease control. Therefore, reducing the conjugation transfer efficiency of plasmids between bacteria can effectively prevent the spread and diffusion of virulence and drug resistance genes, and is considered to be one of the effective strategies for preventing the spread of virulence and drug resistance of pathogenic microorganisms. SUMMARY
[0004] In view of the problems existing in the prior art, the purpose of the present application is to provide a cytR gene of Vibrio harveyi and a method for inhibiting horizontal transfer of the cytR gene of Vibrio harveyi. The conjugation transfer of the plasmid by the method can effectively reduce the conjugation transfer efficiency of the plasmid, and can effectively solve the problem of rapid spread of drug-resistant and pathogenic bacteria.
[0005] To solve the above problems, the present application is realized as follows:
[0006] The first object of the present application is to provide a cytR gene of Vibrio harveyi, the nucleotide sequence of which is shown in 1045bp-2052bp of SEQ ID NO. 1, which is a DNA binding transcription regulator cytR. The cytR gene is located at position 890996-892003 on chromosome 1 of the Vibrio harveyi genome, and its Id is CU052_04590, which is composed of 335 bases. The encoded protein CytR is a DNA binding transcription regulator, and its Id is NP_232305.1.
[0007] The second object of the present application is to provide an application of knocking out cytR gene of Vibrio harveyi in inhibiting horizontal transfer of foreign genes of Vibrio harveyi.
[0008] Preferably, the bacteria is Vibrio harveyi 345.
[0009] The third object of the present application is to provide a low conjugative transfer efficiency Vibrio harveyi, which is obtained by knocking out DNA binding transcriptional regulator cytR of Vibrio harveyi, wherein the DNA binding transcriptional regulator cytR is shown in 1045bp-2052bp of SEQ ID NO. 1.
[0010] The fourth object of the present application is to provide a construction method of low conjugative transfer efficiency Vibrio harveyi, which is obtained by knocking out DNA binding transcriptional regulator cytR of Vibrio harveyi, wherein the DNA binding transcriptional regulator cytR is shown in 1045bp-2052bp of SEQ ID NO. 1.
[0011] Preferably, the method comprises the following steps:
[0012] Step one, designing gene knockout primers for DNA binding transcriptional regulator cytR on Vibrio harveyi genome;
[0013] Step two, knocking out the DNA binding transcriptional regulator cytR with Vibrio harveyi as the starting strain, and obtaining the gene deletion strain V. harveyi 345-ΔcytR, which is the low conjugative transfer efficiency Vibrio harveyi.
[0014] Preferably, the gene knockout primers in step one are: upstream homologous arm amplification primers aagcttgatatcgaattcCCAGT ACAGCAATGAGATCCG and gtgacctttcAGTTTTTACCCTCTTAAAATATTCGC, and downstream homologous arm amplification primers ggtaaaaactGAAAGGTCACGACGTGCAC and ttggtaacgaatcagacGCAGGGTGTTTGGCA AGG.
[0015] Preferably, in step two, the knocking out of the DNA binding transcriptional regulator cytR comprises the following steps:
[0016] (1) PCR amplifying the upstream and downstream homologous arms of the cytR gene and linearizing the suicide plasmid;
[0017] (2) Recombinant plasmids were obtained by isothermal assembly of upstream and downstream homologous arms and linearized suicide plasmids. The recombinant plasmids were then transformed into intermediate host E. coli GEB802 and donor E. coli GEB883, and positive clones were obtained by PCR identification.
[0018] (3) The donor bacteria E. coli GEB883 was cultured to the early logarithmic phase, and the recipient bacteria Vibrio harveyi 345 was cultured to the early logarithmic phase;
[0019] (4) The early logarithmic recipient bacteria Vibrio harveyi 345 was heat-shocked at 40℃ for 30 min and then conjugated with the early logarithmic donor bacteria E. coli GEB883.
[0020] (5) Screening and identification of single-crossover clones and double-crossover clones yielded strains with the deletion of the cytR gene, which are Vibrio harveyi with low conjugation transfer efficiency.
[0021] In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single-exchange clones specifically refers to screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double-exchange clones specifically refers to screening on plates containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing primer pairs: GCTGGAATTTAGACATAGAACCACAG and TCAAGGATTCTGGCAAATATGT TAATC for PCR identification.
[0022] Furthermore, in some embodiments of the present invention, prior to the conjugation transfer step, the above method includes: a cytR gene knockout step; the cytR gene knockout step includes: constructing a recombinant suicide plasmid containing upstream and downstream homologous arm fragments of the targeting fragment (the cytR gene fragment to be knocked out); introducing the recombinant suicide plasmid into the conjugation transfer donor bacterial host Escherichia coli GEB883; and conjugating the donor bacterial containing the recombinant suicide plasmid with the recipient bacterial.
[0023] It should be noted that the gene knockout method described above uses homologous recombination to knock out the cytR gene. However, in other embodiments, other gene knockout methods may also be used to knock out the cytR gene. Regardless of the method used to knock out the cytR gene, such as complete knockout, partial knockout, or even inhibiting cytR gene expression through RNAi interference vectors to inactivate it, as long as the method prevents the recipient bacterium's cytR gene from functioning during plasmid conjugation and transfer, it falls within the scope of protection of this invention.
[0024] The fifth objective of this invention is to provide the above-mentioned Vibrio harveyi with low conjugation transfer efficiency as a genetically engineered bacterium for gene knockout, inhibition of horizontal gene transfer, or reduction of drug-resistant pathogens.
[0025] The sixth objective of this invention is to provide a method for knocking out the cytR gene of Vibrio harveyi to inhibit gene horizontal transfer, comprising the following steps: introducing a target exogenous plasmid into a conjugation transfer donor bacterium, and then conjugating it with the aforementioned Vibrio harveyi with low conjugation transfer efficiency.
[0026] Preferably, the exogenous plasmid is pMMB207, and the donor bacterium is Escherichia coli GEB883.
[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0028] This invention is the first to discover that, compared to wild-type strains, knocking out the cytR gene can suppress the efficiency of acquiring exogenous plasmids through conjugation transfer. Based on this finding, during conjugation transfer, mixing donor bacteria containing the target exogenous plasmid with recipient bacteria that have had the cytR gene knocked out and performing conjugation transfer can reduce the efficiency of conjugation transfer of the target exogenous plasmid from the donor bacteria to the recipient bacteria, inhibiting horizontal transfer of exogenous genes. This is of great significance in resisting the rapid spread of drug-resistant and pathogenic microorganisms.
[0029] This invention significantly reduces the ability of host cells to acquire exogenous plasmids through conjugation transfer. Compared with the originating bacteria, the conjugation transfer efficiency of V. harvestyi345-ΔcytR is significantly reduced. This method greatly reduces the ability of Vibrio harveyi to absorb exogenous plasmids, which is of great significance for resisting microbial pathogenicity and drug resistance.
[0030] The present invention provides a method for inhibiting horizontal gene transfer, comprising: mixing donor bacteria containing a target exogenous plasmid with recipient bacteria that have had their cytR gene knocked out; by knocking out the cytR gene in the recipient bacteria, conjugation transfer is reduced, thereby inhibiting horizontal gene transfer. This method has the characteristic of significantly reducing the efficiency of conjugation transfer; for example, compared with wild-type V. harvestyi 345, the efficiency of obtaining plasmid pMMB207 via conjugation transfer is reduced by 4.93 times for V. harvestyi 345-ΔcytR with the cytR gene knocked out. The method for inhibiting horizontal gene transfer provided by the present invention is of great significance in resisting the emergence of drug-resistant bacteria.
[0031] The starting strain *V. harvestyi* 345 described in this invention has been published in NCBI (CP025537, CP025538, CP025539, CP025540). The intermediate host *E. coli* GEB802, the donor strain *E. coli* GEB883, and the plasmid pSW7848 involved in this invention have been published in the following literature: Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA srvg23535 in *Vibrio alginolyticus* ZJ-T and its characterization with phenotype microarray technology [J]. *Frontiers in Microbiology*, 2018: 2394. The inventors also possess the aforementioned microorganisms and vectors and guarantee to make them available to the public within 20 years from the date of application. Attached Figure Description
[0032] Figure 1 Construction of a DNA-binding transcription factor cytR knockout strain;
[0033] Lane M1: DNA Marker DL5000; Lane 1: pSW7848 linearized fragment; Lane M2: DNA Marker DL2000; Lanes 2 / 3: cytR upstream / downstream fragments; Lane M3: DNA Marker DL5000; Lane 4: recombinant pSW7848-cytR detection fragment; Lane M4: DNA Marker DL2000; Lane 5: cytR gene knockout identification primer amplification results using wild-type Vibrio harveyi 345 genomic DNA as a template; Lane 6: cytR gene knockout identification primer amplification results using cytR candidate mutant genomic DNA as a template.
[0034] Figure 2 This is a comparison of the conjugation and transfer efficiencies of the starting strains V. harvestyi 345 and V. harvestyi 345-ΔcytR in chloramphenicol plates.
[0035] Figure 3 This is a comparison of the relative conjugation efficiencies of the starting strains V. harvestyi 345 and V. harvestyi 345-ΔcytR. Detailed Implementation
[0036] The technical solution of the present invention will be further described below with reference to the embodiments, but the scope of protection of the present invention is not limited thereto.
[0037] For the source of the suicide plasmid pSW7848, see the following reference: Val, ME., Skovgaard, O., Ducos-Galand, M., Bla nd, MJ, Mazel, D., 2012. Genome engineering in Vibrio cholerae: a feasible approach to a ddress biological issues. PLoS Genet. 8, e1002472.
[0038] For the source of E.coli GEB883, please refer to the literature: Nguyen, AN, Disconzi, E., Charrière, GM, Destoumi eux-Garzón, D., Bouloc, P., Le Roux, F., Jacq, A., 2018.csrB geneduplication drives the evolution of redundant regulatory pathways controlling expression of the major toxic secreted metalloproteases in Vibriotasmaniensis LGP32.mSphere.3,e00582-00518.
[0039] E. coli GEB802 is published in the literature Deng YQ, Su YL, Liu SL, et al. Identification of anovel small RNA srvg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology[J]. Frontiers in microbiology, 2018:2394. E. coli GEB802 is π3813 in the article.
[0040] Example 1:
[0041] I. Knockout of DNA-binding transcriptional regulator cytR (CU052_04590) in the V. harvestyi 345 genome
[0042] In the experiment, we designed corresponding gene knockout primers for the cytR gene (Table 1).
[0043] Table 1 Primers related to gene knockout and identification
[0044]
[0045] The cytR gene ORF and its upstream and downstream sequences (as shown in SEQ ID NO.1), with the italicized ATG and TAA being the start and stop codons of cytR, respectively, from 1045bp to 2052bp.
[0046] The genome of *V. harvestyi* 345 was extracted as a template. Using upstream homologous arm amplification primers: cytR-U_fwd: a agcttgatatcgaattcCCAGTACAGCAATGAGATCCG and cytR-U_rev: gtgacctttcAGTTTTTACCCTC TTAAAATATTCGC, and downstream homologous arm amplification primers: cytR-D_fwd: ggtaaaaactGAAAGGTCACGACGTG CAC and cytR-D_rev: ttggtaacgaatcagacGCAGGGTGTTTGGCAAGG, the upstream and downstream flanking sequences of the cytR gene were obtained by PCR amplification. Using the suicide plasmid pSW7848 as a template, the linearized plasmid pSW7848 was obtained by PCR amplification using primers pSW7848-F and pSW7848-R. Using the ClonExpress MultiS One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.), upstream and downstream flanking sequences were isothermally assembled with a linearized plasmid to obtain the recombinant plasmid pSW7848-cytR (its sequence is shown in SEQ ID NO. 2). This plasmid was subsequently transformed into the intermediate host E. coli GEB802 and the donor strain E. coli GEB883 (the preparation and transformation methods of E. coli GEB802 and E. coli GEB883 competent cells are described in Chinese patent CN 107904228 A). Positive clones were screened by PCR using primers pSW7848-check-F and pSW7848-check-R. The PCR amplification system and procedure described above are based on Chinese patent CN 107904228A.
[0047] Referring to the invention patent CN 107904228 A, a mutant strain V. harvestyi 345-ΔcytR was constructed. The recipient bacterium, Vibrio harveyi 345, was cultured to the early logarithmic growth phase (OD2). 600nm =0.3~0.7), and after heat shock treatment at 40℃ for 30 min, cultured to the early logarithmic growth stage (OD). 600nmConjugation transfer was performed on E. coli GEB883 containing the recombinant plasmid pSW7848-cytR (p=0.3–0.7). The recombinant plasmid pSW7848-cytR from E. coli GEB883 was transferred into Vibrio harveyi 345 via bacterial gene conjugation transfer. Since the pSW7848 plasmid cannot self-replicate in Vibrio harveyi 345, it can only replicate along with the genome after integrating into the Vibrio harveyi 345 genome through homologous recombination. Plasmid integration confers chloramphenicol resistance to *V. harvestyi* 345, while D-glucose inhibits the expression of the toxic gene ccdB from the suicide plasmid pSW7848. Single-crossover clones were obtained through screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose. Double-crossover clones were then screened on plates containing 0.2% L-arabinose (which induces ccdB expression). Further screening of candidate mutants involved simultaneously plating clones on plates containing 0.2% L-arabinose and plates containing 34 μg / mL chloramphenicol and 0.2% L-arabinose. Clones lacking chloramphenicol resistance were identified by PCR (del cytR-check-F and del cytR-check-R), yielding clones with successful gene knockout, known as the mutant *V. harvestyi* 345-ΔcytR. Following this procedure, cytR was knocked out, and the gene knockout identification results met expectations. Figure 1 ).
[0048] II. Implementation Results
[0049] The starting strain *Vibrio campbellii* V. harvestyi 345 and the obtained mutant strain *V. harvestyi 345-ΔcytR* were subjected to a logarithmic early stage heat shock at 40°C for 10 min, followed by an E. coli strain carrying the RP4 shuttle plasmid pMMB207 (which is chloramphenicol resistant and can self-replicate in *Vibrio campbellii* 345; construction method see Liu, JX, Zhao, Z., Deng, YQ, Shi, Y., Liu, YP, Wu, C., Luo, P., Hu, CQ, 2017. Complete genome sequence of Vibrio campbellii LMB29 isolated from red drum with four native megaplasmids. Front. Microbiol. 8, 2035. https: / / doi.org / 10.3389 / fmicb.2017.02035). GEB883 was used for conjugation. After overnight conjugation, the plaques were collected using 1 mL of fresh culture medium (LBS medium, containing 1% peptone, 0.5% yeast extract, and 3% sodium chloride by mass fraction). The plaques were serially diluted, and 100 μL of each dilution was spread onto LBS plates containing 34 μg / mL chloramphenicol (containing 1% peptone, 0.5% yeast extract, 3% sodium chloride, and 1.5% technical agar powder by mass fraction) for conjugation screening. The conjugation transfer efficiency was statistically analyzed. The results showed that ( Figures 2-3 (Table 2) Compared with the starting strain Vibrio harveyi 345, the conjugation transfer efficiency of V. harveyi 345-ΔcytR decreased significantly by 4.93 times.
[0050] Table 2. Binding transfer efficiency of V.harveyi 345 and V.harveyi 345-ΔcytR
[0051]
[0052] Compared to wild-type host cells, host cells with the cytR gene knockout exhibited a 4.93-fold lower efficiency in acquiring the pMMB207 plasmid from the donor bacterium *E. coli* via conjugative transfer. This method significantly reduces the host cell's ability to acquire exogenous plasmids, which is of great importance in combating microbial pathogenicity and drug resistance.
[0053] In summary, the results indicate that the deletion of the cytR gene significantly reduces the efficiency of Vibrio harveyi in acquiring exogenous plasmids through conjugation transfer, inhibits horizontal gene transfer, and thus prevents or reduces the ability of microorganisms to absorb drug-resistant or pathogenic DNA fragments from the external environment. The method provided by this invention offers a new approach and strategy for reducing or avoiding the emergence of drug-resistant bacteria.
[0054] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
[0055] SEQ ID NO.1
[0056] CCAGTACAGCAATGAGATCCGATGCCACCACTGTGGCTCTCAACAACCCGTGATTCATCAATGCCAAGGTTGTGGCTCCACTCAGCTAGTAACCGTTGGAGTTGGGACAGAGCAACTGGAGCTTCAACTTGCCAAGCTCTTTCCTGAATACAACGCGATTCGTATTGATAGAGACAGCACTCGCCGTAAAGGCAGCTTGGAAGATGCTCTCGAATCGATTCGTAAAGGCGAATATCAAATCCTGATTGGTACGCAAATGCTGGCGAAAGGTCACCACTTTCCGAACGTGACACTCGTGGCGCTGCTGGACGTGGACGGCTCTCTATATAGTAGTGACTTTCGTGCTTCGGAAAGGCTGGCGCAATTGTTCATTCAAGTTGCGGGGCGTGCTGGTCGTGCAAGCAAACCTGGCGAAGTGATTTTACAGACTCACCACCCTGAGCACAGCTTACTTCAGTCTCTATTACAGAAAGACTATCGTGACTTTGCCATGACAGCACTAGAGGAACGTAAGTTAGCTCAGCTTCCACCTTACAGCTTCTTAACCCTATTTAAAGCGGAAGCTAACCAAAGCGAGTTGGTCGAAGACTTTTTGCGTCAGGTTCGCTTCACTCTTGAGTCACACCCATTATTTGATGGTTCCTGCATGGTTTTGGGGCCGACGCCATCACCATTAGCTAAGCGTGCTGGGAAATATCGTTGGCAGTTGTTACTGCAAACTCAGCATCGCTCATTGATGCAAAAGTTATTAACCAGTGCAAAACCTGCTATTGAGTTGTTGCCAAATGCCAAGAAAGTTCGCTGGAATTTAGACATAGAACCACAGGATCTCAGCTAGCAAACGTTTAACTATGTAATGAATCACCTTCTAATGTGAGTCAAATCACATTAGGATTGCAATTTTTGTTAAACAGACCGTAACTTTCCCTTTAGAAATGAATAGACTATTCAAATTAGTAAAGTCTAAAGTGGATCAGTCACATAGGCTTCAATTAGAACAATGACTCACGTCATCTTGGCGAATATTTTAAGAGGGTAAAAACT ATGGCGACAATGAAGGATGTTGCCCAGCTTGCAGGGGTATCTACTGCTACGGTATCGCGAGCATTAATGAATCCAGAAAAAGTCTCTTCATCAACAAGAAAGAGAGTGGAAGATGCCGTACTTGAAGCTGGTTATTCACCGAATTCATTAGCTCGTAATTTACGTAGAAATGAATCAAAGACCATTGTCACTATCGTACCGGACATATGCGATCCGTATTTCTCTGAAATCATTCGCGGTATCGAAGATGCAGCAATGGAACACGGTTACCTAGTTCTTCTCGGCGATAGCGGTCAGCAGAAAAAGCGCGAAAGCTCATTCGTAAACTTAGTATTCACCAAGCAAGCTGATGGCATGTTACTACTGGGCACCGACTTACCATTCGATGTCAGCAAGCCAGAGCAGAAAAACCTACCACCAATGGTCATGGCGTGCGAATTCGCTCCTGAGCTGGAACTACCAACGGTGCATATCGATAACTTGACCTCTGCATTTGAAGCCGTGAACTACCTGACGCAACTTGGTCACAAGCGTATTGCTCAGATCTCTGGTCCAGATACTGCGGTGCTGTGCCAGTTCCGCCAACAAGGTTACCAACAAGCACTTCGCCGTGCTGGTATTAGTAAAGAAGAGCAATACAGCATTGTGGCTGACTTCTCTTTCGAAGGTGGCGTTCAAGCCGTACGCAAACTTCTCGAACTGCCTGAACCACCAACCGCTCTATTCTGTCACTGTGACACCATGGCGATTGGTGCTATTCAAGAGGCGAAACGTCTTGGTCTGCGTATTCCGCAGGATTTATCGGTTGTCGGCTTTGATGATATTCAATTCGCGCAATATTGCGATCCACCGTTAACCACCATCTCTCAACCACGTTATGAGATTGGTCGCCAAGCAATGCTAATGATGCTAGAGCTACT GAAAGGTCACGACGTGCACTCAGGCTCTCGCTTGCTTGAAACTAAATTAGTTGTGCGTGGTAGTGCAGCGCCACCACCTTTGCGCTAATCAGTAAGCGAATCCACAACATAAATAGAAACGAAAGCGACGCATCTAGCGTCGTTTTTTTACGCCTATCCTGTACGTAGCTAACAAGATTACGTGAATAGGGTGTTTTCTCGTCGCGTTCTGGATTAACATATTTGCCAGAATCCTTGATGACCAGAAGTAACCGTGGCAAATAGAGATTATGTAAGACGCGGACGCGGCGCTCCGAAGAAGTCGACAAAAAAACAACCTTCCAGAAAGAAACCTTGGCGTAGTGGTCTACTAGCAATTCTGCTTGTGGGCGGTTTTGGCTACGGCTTATATCTACTCAGCAATGATCCTGAACCGAAACAACCCGTTGCGAAACAGGAACCAGTGACCACCAGCAAACCAAAGCCGAAGAAAGAGTTACCGCCCCCACCAGAAGAAAAGTGGGAATACGTGGAATCTCTACCGAAGCGTGAAGTGGAAGTCGTTGCCAAAGAAGTTGAAGTATCAAAAGTCCCTTATGTGATGCAATGTGGCGCTTACAAAAAACAGAGCCAAGCTGAAGAACGTAAGCTAGCGATTGCTTTCCAAGGTATTACGAGCCGTGTCATTAAGAAAGACGGAAGCTCTTGGTACCGTGTTGTTCTTGGTCCATACAAGTTCAAACGAGACGCAGAGAAAGATCGCCACAAGTTGCAACGCGCGAAGATCGAGCCGTGTGCAATTTGGAAAGAGAATCTTTAATTCTTATTCGATACATTAATGCAGAGACCAACCGAGTGATCGGTTGGTCTTTTCTTTTATTGGAGAGTGCTGCTCATTCTCACGCTAGGGAATGACTCAAGATCATTCATCACCACGAATCCAGTTCAGTTTCACCATATAGGGTATATACCCAACTCGTTCGTATAAACCAGCGC CCTTGCCAAACACCCTGC
[0057] SEQ ID NO.2
[0058]
Claims
1. The Vibrio harveyi cytR gene, characterized in that, The nucleotide sequence is shown as 1045bp-2052bp of SEQ ID NO.
1.
2. The application of knocking out the Vibrio harveyi cytR gene as described in claim 1 in inhibiting horizontal transfer of exogenous genes in Vibrio harveyi.
3. The application according to claim 2, characterized in that, The Vibrio harveyi mentioned is Vibrio harveyi 345.
4. A type of Vibrio harveyi with low conjugation transfer efficiency, characterized in that, It involves knocking out the cytR gene of Vibrio harveyi as described in claim 1 in Vibrio harveyi.
5. A method for constructing Vibrio harveyi with low conjugation transfer efficiency, characterized in that, The method involves knocking out the cytR gene of Vibrio harveyi as described in claim 1 to obtain Vibrio harveyi with low conjugation transfer efficiency.
6. The method according to claim 5, characterized in that, Includes the following steps: Step 1: Design gene knockout primers for the cytR gene on the Vibrio harveyi genome; Step 2: Using Vibrio harveyi as the starting strain, knock out the cytR gene to obtain the gene-deleted strain V.harveyi345-ΔcytR, which is Vibrio harveyi with low conjugation transfer efficiency.
7. The construction method according to claim 6, characterized in that, The gene knockout primers mentioned in step one are: upstream homologous arm amplification primers: aagcttgatatcgaattcCCAGTACAGCAATGAGATCCG and gtgacctttcAGTTTTTACCCTCTTAAAATATTCGC, and downstream homologous arm amplification primers: ggtaaaaactGAAAGGTCACGACGTGCAC and ttggtaacgaatcagacGCAGGGTGTTTGGCAAGG.
8. The construction method according to claim 6, characterized in that, Step two, specifically the knockout of the DNA-binding transcriptional regulatory factor cytR, includes the following steps: (1) PCR amplification of the upstream and downstream homologous arms of the cytR gene and the linearized suicide plasmid; (2) Recombinant plasmids were obtained by isothermal assembly of upstream and downstream homologous arms and linearized suicide plasmids. The recombinant plasmids were then transformed into intermediate host E. coli GEB802 and donor E. coli GEB883, and positive clones were obtained by PCR identification. (3) The donor bacteria E. coli GEB883 was cultured to the early logarithmic phase, and the recipient bacteria Vibrio harveyi 345 was cultured to the early logarithmic phase; (4) The early logarithmic recipient bacteria Vibrio harveyi 345 was heat-shocked at 40℃ for 30 min and then conjugated with the early logarithmic donor bacteria E. coli GEB883. (5) Screening and identification of single-crossover clones and double-crossover clones, that is, strains with the deletion of the cytR gene, which are Vibrio harveyi with low conjugation transfer efficiency. In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single-exchange clones specifically refers to screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double-exchange clones specifically refers to screening on plates containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing primer pairs: GCTGGAATTTAGACATAGAACCACAG and TCAAGGATTCTGGCAAATATGT TAATC for PCR identification.
9. The application of Vibrio harveyi with low conjugation transfer efficiency as described in claim 4 as a genetically engineered bacterium in gene knockout, inhibition of horizontal gene transfer, or reduction of drug-resistant pathogens.
10. A method for knocking out the cytR gene in Vibrio harveyi to suppress gene horizontal transfer, characterized in that, The procedure includes the following steps: introducing the target exogenous plasmid into the conjugation transfer donor bacteria, and then conjugating it with the aforementioned Vibrio harveyi, which has low conjugation transfer efficiency. Preferably, the exogenous plasmid is pMMB207, and the donor bacteria is Escherichia coli GEB883.
Citation Information
Patent Citations
Thermal shock-based vibrio harveyi homologous recombinant gene knockout method
CN107904228A