Application of rice root development regulation gene
By applying the DMT1 gene and using RNAi technology to silence rice root development, the complexity of rice root development regulation was solved, achieving effective regulation of rice root development and improving rice's nutrient and water absorption capacity and biomass accumulation.
Patent Information
- Application Number
- CN202511374019.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2025-11-18
AI Technical Summary
In the current technology, the research on genes regulating rice root development has not been fully explored, resulting in the incomplete understanding of the complexity of root development regulation, which affects the nutrient and water absorption capacity and biomass accumulation of rice.
By using the DMT1 gene as a regulator of rice root development, its expression was silenced through RNAi technology, thereby reducing the root length, root volume, and root projection area of rice.
Effective regulation of rice root development significantly reduces root length, root volume, and root projection area, enhancing the theoretical basis and agricultural application potential of rice root development regulation.
Smart Images

Figure CN120966892A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present disclosure relates to the field of biotechnology, in particular to an application of a rice root system development regulation gene. BACKGROUND
[0002] Rice is one of the most important staple foods for most of the world's population, and is also the largest grain crop in China. As a key nutrient organ formed in the long-term evolution of plants, the development of root system directly affects the ability of rice to absorb nutrients and water, and plays a core role in the accumulation of biological yield and its conversion to economic yield.
[0003] At present, more than 40 genes regulating rice root system development have been successfully cloned, most of which are closely related to yield traits. For example, OsCCC1 participates in cell elongation by maintaining K + / Na + / Cl- balance, and mutation of the gene leads to shortening of the length of the main root, lateral root and crown root, and causes significant decrease in panicle number, thousand-grain weight and grain number per panicle, ultimately resulting in yield reduction of rice. The gene OsKASI encoding β-ketoacyl-acyl carrier protein synthase regulates root system development and thousand-grain weight by participating in the fatty acid synthesis pathway. The neutral / alkaline invertase gene OsCYT-INV1 provides carbon source and energy for early root development by catalyzing the hydrolysis of sucrose to glucose and fructose, thereby affecting the morphological development of the main root, adventitious root and lateral root. These research results show that the functions of proteins encoded by different genes are significantly different in regulating root growth, reflecting the complexity of the regulation of rice root system development by multiple factors and multiple signal pathways. Therefore, further mining of new rice root system regulation genes and functional verification will help to deeply analyze the molecular regulation network of root system development, and provide important gene resources and theoretical basis for genetic improvement of rice root system.
[0004] DISCLOSURE
[0005] To solve the problems of the prior art, the present disclosure provides an application of a rice root system development regulation gene. The technical solution is as follows:
[0006] The present disclosure provides an application of a rice root system development regulation gene, which comprises: using the gene DMT1 as the rice root system development regulation gene for regulating rice root system development, wherein the sequence of the gene DMT1 is shown as SEQ ID NO: 1 in the sequence listing.
[0007] Specifically, the RNAi technology is used to silence the rice root system development regulation gene for reducing the root length, root system volume and root system projection area of rice.
[0008] The technical scheme provided by the embodiments of the present disclosure has the beneficial effects that the embodiments of the present disclosure provide an application of a rice root system development regulation gene, the application includes using the gene DMT1 as a rice root system development regulation gene to regulate rice root system development, and the function of regulating rice root system development is determined, which has very important application in agricultural production. BRIEF DESCRIPTION OF DRAWINGS
[0009] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings needed in the embodiment description will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present disclosure, and other drawings can also be obtained by those skilled in the art without creative labor.
[0010] Figure 1 is a statistical diagram of DMT1 expression in the control group R185 and the experimental group DMT1-RNAi plants provided by the embodiments of the present disclosure, the data in the diagram represent the mean ± standard deviation, and the asterisk on the error line represents a significant difference compared with the control group (p value is calculated by one-way ANOVA, **p<0.01);
[0011] Figure 2 is a root scanning comparison diagram of the control group R185 and the experimental group DMT1-RNAi plants grown for 14 days provided by the embodiments of the present disclosure, and the scale in the diagram is 1 cm;
[0012] Figure 3 is a root length statistical diagram of the control group R185 and the experimental group DMT1-RNAi plants grown for 14 days provided by the embodiments of the present disclosure, the data in the diagram represent the mean ± standard deviation, and the asterisk on the error line represents a significant difference compared with the control group (p value is calculated by one-way ANOVA, **p<0.01);
[0013] Figure 4 is a root volume statistical diagram of the control group R185 and the experimental group DMT1-RNAi plants grown for 14 days provided by the embodiments of the present disclosure, the data in the diagram represent the mean ± standard deviation, and the asterisk on the error line represents a significant difference compared with the control group (p value is calculated by one-way ANOVA, *p<0.05);
[0014] Figure 5 is a root projection area statistical diagram of the control group R185 and the experimental group DMT1-RNAi plants grown for 14 days provided by the embodiments of the present disclosure, the data in the diagram represent the mean ± standard deviation, and the asterisk on the error line represents a significant difference compared with the control group (p value is calculated by one-way ANOVA, **p<0.01). DETAILED DESCRIPTION
[0015] For the purposes of making the objectives, technical solutions and advantages of the present disclosure clearer, further detailed descriptions will be made to the embodiments of the present disclosure with reference to the drawings.
[0016] Embodiments
[0017] The embodiments of the present disclosure provide an application of a rice root system regulation gene, and the application comprises: using the gene DMT1 as a rice root system development regulation gene to regulate rice root system development, wherein the sequence of the gene DMT1 is shown as SEQ ID NO: 1 in the sequence listing.
[0018] Specifically, the rice root system development regulation gene is used to reduce the root length, root system volume and root system projection area of rice after being silenced by using the RNA interference technology.
[0019] Further, the rice material used in the embodiments is R185.
[0020] The PDK intron is amplified from the pKANNIBAL plasmid by using the KOD-plus high-fidelity enzyme through PCR (Polymerase Chain Reaction).
[0021] The PDK intron is amplified by using the forward primer PdkP3F (as shown in SEQ ID NO: 2 in the sequence listing, specifically: CTCGAGGAATTCGGTACCCC) and the reverse primer PdkP4R (as shown in SEQ ID NO: 3 in the sequence listing, specifically: TTCGAACCCAATTTCCCAACTG) through the first amplification reaction, and the template is the pKANNIBAL plasmid.
[0022] The DMT1 target fragment 1 is amplified from the vector DMT1-WM036 containing the DMT1 coding region by using the KOD-plus high-fidelity enzyme through PCR.
[0023] The cDNA of the R185 rice is extracted to obtain the cDNA of the R185 rice.
[0024] The DMT1 target fragment 1 is amplified by using the forward primer R1F (as shown in SEQ ID NO: 4 in the sequence listing, specifically: GATGGCACGTACCTGAGGAACG) and the reverse primer P3RR2R (as shown in SEQ ID NO: 5 in the sequence listing, specifically: GGGGTACCGAATTCCTCGAGAATCTTGCCGCTGGCCTTGCA) through the second amplification reaction, and the template is the cDNA of the R185 rice.
[0025] The DMT1 target fragment 2 was amplified from the vector DMT1-WM036 containing the DMT1 coding region by PCR using KOD-Plus high fidelity enzyme.
[0026] The DMT1 target fragment 2 was amplified by a third amplification reaction using the forward primer R1F (as shown in SEQ ID NO: 4 in the sequence listing, specifically GATGGCACGTACCTGAGGAACG) and the reverse primer P4FR2R (as shown in SEQ ID NO: 6 in the sequence listing, specifically AATCTTGCCGCTGGCCTTGCAAATCTTGCCGCTGGCCTTGCA), and the template was the cDNA of R185 rice;
[0027] The amplification system of each 50 μL of the first amplification reaction, the second amplification reaction and the third amplification reaction included: 10×buffer 5 μL; 2 mM dNTP 5 μL; forward primer 1.5 μL at a concentration of 10 μM; reverse primer 1.5 μL at a concentration of 10 μM; template 1 μL; KOD-Plus-Neo polymerase 1 μL at a concentration of 1 U / μL; and ddH2O 35 μL.
[0028] The amplification procedure of the first amplification reaction, the second amplification reaction and the third amplification reaction was as follows: 98℃ pre-denaturation for 2 min; then 30 cycles, each cycle including: 98℃ denaturation for 10 s, 55℃ annealing for 15 s, and 68℃ extension for 40 s.
[0029] The amplification products were recovered and purified to obtain the purified PDK intron, the DMT1 target fragment 1 and the DMT1 target fragment 2.
[0030] The purified PDK intron was connected with the purified DMT1 target fragment 1 and the DMT1 target fragment 2 by overlap extension PCR technology.
[0031] The amplification system of the overlap extension PCR included: first round of reaction amplification and second round of reaction amplification.
[0032] The amplification system of the first round of reaction amplification included: 10×buffer 5 μL; 25 mM MgSO4 3 μL; 2 mM dNTPs 5 μL; PDK intron 50 ng; DMT1 target fragment 1 50 ng; DMT1 target fragment 2; and ddH2O to a total volume of 50 μL.
[0033] The amplification procedure of the first round of reaction amplification was as follows: 94℃, pre-denaturation for 2 min; then 10 cycles, each cycle including: 98℃ for 10 s, 50℃ for 60 s, and 68℃ for 45 s, to obtain the first round of amplification product.
[0034] The amplification system for the second round of reaction amplification comprises: 50 μL of the first amplification product; 5 μL of 10×buffer; 3 μL of 25 mM MgSO4; 5 μL of 2 mM dNTPs; 3 μL of forward primer R1F; 2 μL of KOD Plus Neo; and 27 μL of ddH2O.
[0035] The amplification procedure for the second round of reaction amplification is: 94°C, pre-denaturation for 2 min; then 18 cycles, each cycle comprising: 98°C for 10 s, 55°C for 30 s, 68°C for 1 min, to obtain the second round of amplification product.
[0036] After the overlap extension PCR reaction is completed, the amplification product is obtained, 2 μL of the amplification product is taken for agarose gel electrophoresis detection, and the target product is about 2300 bp. After adding A, it is connected with the PCXU N vector digested by Xcm I at 16°C overnight. Escherichia coli TOP10 is transformed, single colonies are picked, and a fragment with a size of about 2.3 kb is selected for company sequencing.
[0037] The DMT1-RNAi vector with correct sequencing is transformed into Agrobacterium competent cells EH105 (purchased from Shanghai Uptide Biotechnology Co., Ltd.) by using the electroporation method, and then is transformed into the recipient material R185 rice by using the Agrobacterium-mediated method, so as to obtain the DMT1-RNAi rice plant, and the specific method is as follows:
[0038] 1. Induction of callus:
[0039] 15 g of mature, full, and hull-removed R185 seeds are weighed and placed in a 50 mL centrifuge tube.
[0040] The seeds are first washed with distilled water for 4 times, then treated with 75% ethanol for 2-5 min, finally washed with distilled water for 4 times, 0.15% mercury chloride is added, and the seeds are treated by a shaker at 130 rpm for 12 min. A alcohol lamp is lit, a spoon and tweezers are burned, and are ready for use. The mercury chloride treated seeds are transferred to a clean bench, and are continuously washed with sterilized distilled water (to remove residual mercury chloride on the seeds), and then the treated seeds are transferred to filter paper and dried for two hours on the clean bench.
[0041] The dried seeds are transferred to N6 induction medium with tweezers, and are sealed with parafilm after being labeled. The seeds are cultured in a 28°C dark incubator for about 4 weeks.
[0042] 2. Subculture:
[0043] The newly generated compact callus around the callus is picked to new N6 induction medium, and is cultured in a 28°C dark incubator for 10 days.
[0044] 3. Infection:
[0045] 50 mL of centrifuge tube is added with 30 mL of 1 / 2N6 liquid medium (1 / 1000 AS is added), and the Agrobacterium containing DMT1-RNAi vector is scraped with a sterile spoon, and the concentration is adjusted to OD 600 = 0.8-1.0.
[0046] The callus is carefully transferred to the bacterial solution with a spoon, and the bacterial solution is uniformly mixed with the callus. After 15 minutes, the callus is transferred to a new sterilized filter paper. After drying, the infected callus is transferred to 1 / 2N6 solid medium (1 / 1000 AS is added). The culture is incubated in a 20°C dark incubator for two days.
[0047] 4. Bacteria removal
[0048] The culture dish is taken out of the dark incubator and placed on a clean bench to dry for 15 minutes. The callus is placed in a sterilized bottle and washed four times with sterilized water.
[0049] 250 mL of sterilized water containing 1 / 1000 cefotaxime is added to the bottle, and the bottle is shaken at 100 rpm for 10 minutes. The sterilized water is poured out, and the operation is repeated once.
[0050] 250 mL of sterilized water containing 1 / 500 cefotaxime is added to the bottle, and the bottle is shaken at 100 rpm for 10 minutes. The sterilized water is poured out, and the operation is repeated once.
[0051] The callus is transferred to a new sterilized filter paper with a spoon and dried for 3 hours.
[0052] 5. Screening
[0053] The dried callus is transferred to N6 solid medium containing 250 mg / L cefotaxime and 50 mg / L hygromycin (screening medium), and incubated in a 28°C dark incubator for 30 days.
[0054] 6. Differentiation
[0055] The well-grown compact callus obtained by screening is transferred to MS medium (differentiation medium) and incubated in a 28°C incubator under light for 40 days.
[0056] 7. Rooting and seedling raising
[0057] The green seedlings grown on the differentiation medium are transferred to 1 / 2MS medium (rooting medium), and incubated in a 28°C incubator under light for 15 days. After 15 days, the seedlings are taken out of the 1 / 2MS medium and placed in a centrifuge tube containing sterilized water, and the sterilized water is replaced frequently. After 1 week, the seedlings are planted in the field, and T1 generation seeds can be obtained after the seedlings mature.
[0058] The homozygous DMT1-RNAi strain is selected for subsequent experiments.
[0059] After soaking and germinating the seeds of the control material R185 and the experimental material DMT1-RNAi homozygous strain, 30 seeds with normal germination and consistent growth rate are selected and sowed in the hydroponic box. The liquid medium is purchased from Coolaber Company (NS1040). When the seedlings grow to 14 days, the expression of DMT1 in the control group R185 and the experimental group DMT1-RNAi is determined, and the determination results are shown in Table 1. Figure 1 Figure 1 It can be seen that the expression of DMT1 in the control group R185 is significantly higher than that in the experimental group DMT1-RNAi. Figure 2 Figure 2 It can be seen that the root system of the control material R185 is significantly longer than that of the experimental material DMT1-RNAi.
[0060] At the same time, the root length, root volume and root projection area of the control material R185 and the experimental material DMT1-RNAi after growing for 14 days are measured, and the measurement results of 3 repeats of each group are counted, and the specific counting results are shown in Table 2. Figures 3 to 5 Figures 3 to 5 It can be seen that compared with the control material R185, the root length, root volume and root projection area of the experimental material DMT1-RNAi are significantly reduced.
[0061] The above only describes optional embodiments of the present disclosure, and does not limit the present disclosure. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present disclosure shall be included in the protection scope of the present disclosure.
Claims
1. The application of a gene regulating rice root development, characterized in that, The application includes using the gene DMT1 as a rice root development regulatory gene to regulate rice root development, wherein the sequence of the gene DMT1 is shown in SEQ ID NO: 1 in the sequence listing.
2. The application according to claim 1, characterized in that, The application includes: silencing the rice root development regulatory gene using RNA interference technology to reduce the root length, root volume, and root projection area of rice.