Application of TaMT1 gene or encoded protein in regulation and control of drought resistance of wheat
By overexpressing the TaMT1 gene in wheat and using recombinant vectors and Agrobacterium-mediated transformation technology, the problems of growth inhibition and yield reduction in wheat drought resistance improvement in existing technologies have been solved, achieving high survival rate and high yield of wheat under drought conditions.
Patent Information
- Application Number
- CN202511466805.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-14
- Publication Date
- 2025-11-18
AI Technical Summary
In existing technologies, most wheat drought-resistant genes have negative effects such as growth inhibition, reduced biomass, or poor grain development when improving drought resistance. Furthermore, the regulatory mechanisms of the expression of some genes induced by environmental stress are unclear, making it impossible to accurately initiate drought-resistant responses when drought stress occurs, thus limiting their application effectiveness.
By overexpressing the TaMT1 gene or its encoded protein, genetic engineering can be carried out in wheat using recombinant vectors such as p110UBI-R to improve its drought resistance and yield. Transgenic plants can be constructed using Agrobacterium-mediated transformation technology to enhance their growth status and survival rate under drought conditions.
It significantly improved the growth status and survival rate of wheat under drought stress and increased the yield per plant. The TaMT1 gene and its encoded protein play an important role in regulating wheat drought resistance and yield.
Smart Images

Figure CN120966896A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and particularly relates to... TaMT1 Application of genes or encoded proteins in regulating wheat drought resistance. Background Technology
[0002] wheat( Triticum aestivum Wheat (L.) is one of the world's three most important food crops, and its yield and quality are directly related to food security and agricultural economic stability. According to statistics from the Food and Agriculture Organization of the United Nations, approximately 30% of global wheat-growing areas face seasonal or cyclical drought stress. Drought has become the primary abiotic stress factor limiting wheat yield increases—in severe drought years, wheat yield reductions can reach 30%-50%, with some areas even experiencing total crop failure, posing a serious challenge to global food security. Traditional breeding methods, due to their long cycles and limited germplasm resources, struggle to quickly overcome the bottleneck in drought resistance improvement. Furthermore, the large size of the wheat genome (hexaploid AABBDD) and its poor regeneration capacity led to a late start in genetic engineering breeding, although key progress has been made in recent years through molecular biology techniques.
[0003] With the development of genetic engineering technology, cloning drought-related genes and introducing them into wheat to achieve targeted improvement of drought resistance has become a research hotspot in recent years. Patent 202510810103.2 discloses the application of the TaWDR3 protein and its encoding gene in regulating wheat drought resistance, and its overexpression in wheat. TaWDR3 Genes can improve the growth status and survival rate of wheat under drought stress, which has important practical significance for breeding new drought-resistant crop varieties. Patent 202510580206.4 discloses a wheat drought-resistant gene. TaTZF1 wheat drought-resistant genes TaTZF1 When overexpression was transferred to wheat, overexpression was observed. TaTZF1 The transgenic plants showed significantly improved drought resistance compared to the wild type, proving that the gene... TaTZF1 Genes positively regulate drought resistance in wheat. However, in practical applications, most genes can only improve drought resistance in wheat individually, but are accompanied by negative effects such as growth inhibition, reduced biomass, or poor grain development, resulting in "drought resistance without increased yield." The drought resistance function of some genes is species-specific, and they are difficult to play an effective role after being expressed heterologously in wheat. In addition, the regulatory mechanisms of the expression of some genes induced by environmental stress are unclear, making it impossible to accurately initiate drought resistance responses when drought stress occurs, thus limiting the application effect. Summary of the Invention
[0004] To address the above problems, this invention proposes a... TaMT1 Application of genes or encoded proteins in regulating wheat drought resistance.
[0005] The technical solution of the present application is implemented as follows: The present application provides a kind of TaMT1 The application of gene or coding protein, the application is as shown in any of the following: (1) regulating drought resistance of plant; (2) regulating yield of plant; (3) cultivating transgenic plants with improved drought resistance; (4) cultivating transgenic plants with improved yield.
[0006] The nucleotide sequence of the above-mentioned TaMT1 The nucleotide sequence of the above-mentioned a. DNA molecule as shown in SEQ ID No.2; b. DNA molecule as shown in SEQ ID No.3; c. DNA molecule hybridized with the DNA molecule in a or b and coding the TaWDR2 protein of claim 1; d. DNA sequence with more than 99%, more than 95%, more than 90%, more than 85% or more than 80% identity with the DNA sequence in a or b or c.
[0007] The amino acid sequence of the above-mentioned coding protein is as shown in any of the following: 1) amino acid sequence as shown in SEQ ID No.1; 2) sequence with one or several amino acid insertions, deletions or mutations to the amino acid sequence as shown in SEQ ID No.1 and still having the function of amino acid in 1); 3) amino acid sequence with more than 99%, more than 95%, more than 90%, more than 85% or more than 80% identity with the amino acid sequence as shown in SEQ ID No.1; 4) fusion protein obtained by connecting tag to N terminal or / and C terminal of the protein of amino acid sequence as shown in SEQ ID No.1.
[0008] Among them, the sequence SEQ ID No.1 consists of 111 amino acid residues.
[0009] Preferably, the above-mentioned tag refers to a polypeptide or protein fused and expressed with the target protein by DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. The tag can be Flag tag, GFP tag, His tag, MBP tag, HA tag, myc tag, GST tag and / or SUMO tag, etc.
[0010] The insertion, deletion or mutation of one or several amino acid residues is an insertion, deletion or mutation of no more than 10 amino acid residues. The identity includes an amino acid sequence having 80% or more of the amino acid sequence shown in the sequence SEQ ID No. 1 of the present application.
[0011] The above-mentioned encoding protein can be artificially synthesized, or can be obtained by first synthesizing its encoding gene and then performing biological expression.
[0012] Preferably, the above-mentioned plant is wheat, and the drought resistance and / or yield of the wheat is improved by increasing the expression amount or activity of the above-mentioned gene or encoding protein. TaMT1 The transgenic wheat with improved drought resistance and / or yield is cultivated by increasing the expression amount or activity of the above-mentioned gene or encoding protein.
[0013] In a second aspect, the present application further provides a biological material, which is any one of the following: A1) contains the above-mentioned TaMT1 gene expression cassette; A2) contains the above-mentioned TaMT1 gene recombinant vector; A3) contains the above-mentioned A4) contains the above-mentioned TaMT1 gene recombinant microorganism; A5) contains the above-mentioned A6) contains the above-mentioned A7) contains the above-mentioned A8) contains the above-mentioned TaMT1 gene transgenic plant cell line; A9) contains the above-mentioned A10) contains the above-mentioned A11) contains the above-mentioned
[0014] Preferably, the above-mentioned A1) contains the above-mentioned TaWDR2 gene expression cassette ( TaMT1 gene expression cassette), refers to DNA capable of expressing TaMT1 gene in a host cell, which can include not only a promoter for initiating TaMT1 gene transcription, but also a terminator for terminating TaMT1 gene transcription. Further, the expression cassette can further include an enhancer sequence. The promoters that can be used in the present application include but are not limited to: constitutive promoters; tissue, organ and development specific promoters and inducible promoters.
[0015] The recombinant vector can be constructed using an existing expression vector containing the TaMT1 The plant expression vector includes binary Agrobacterium vector and vector for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA), etc. The plant expression vector can also contain the 3' untranslated region of the foreign gene, i.e. containing polyadenylation signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor. When using the gene of the present application to construct a plant expression vector, enhancers, including translation enhancers or transcription enhancers, can also be used, which can be ATG initiation codon or adjacent region initiation codon, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the initiation codon is wide, which can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants to produce color-changing enzymes or luminescent compounds (GUS gene, luciferase gene, etc.), marker genes of antibiotics (such as nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to herbicide phosphinothricin, hph gene conferring resistance to antibiotic hygromycin, and dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate), or chemical reagent resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene providing the ability to metabolize mannose. For the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress.
[0016] Preferably, the above-mentioned recombinant vector is a plasmid, cosmid, bacteriophage or viral vector.
[0017] Preferably, the above-mentioned recombinant microorganism is yeast, bacteria, algae or fungi.
[0018] In a third aspect, the present application provides a method for improving drought resistance and / or yield of wheat, comprising the step of: increasing the expression or activity of the above-mentioned TaMT1 gene or the above-mentioned protein-encoding gene, to improve the drought resistance and / or yield of wheat.
[0019] In a fourth aspect, the present application provides a method for breeding transgenic wheat with improved drought resistance and / or yield, comprising the step of: constructing a plant expression vector containing the above-mentionedTaMT1 The gene overexpression vector p110UBI-R was transferred into the plants to be improved, resulting in wheat plants with increased drought resistance and / or yield.
[0020] The present invention has the following beneficial effects: This application discloses a... TaMT1 The application of genes or encoded proteins in regulating wheat drought resistance, including those containing the gene shown in SEQ ID No. 2. TaMT1 The recombinant vector p110UBI-R containing the gene CDS sequence was transformed into wheat, and it was found that... TaMT1 The T3 generation transgenic lines obtained by overexpression showed a significantly higher survival rate under drought conditions than wild-type wheat, indicating that... TaMT1 The gene and its encoded protein have a positive regulatory function on wheat drought resistance and are overexpressed in wheat. TaMT1 Genes can improve wheat growth and survival rates under drought stress. Compared to the wild type, two... TaMT1 Overexpression of transgenic wheat lines (OE-1 and OE-2) increased single-plant yield by 34.5% and 24.2%, respectively, under drought conditions, indicating that... TaMT1 Overexpression of the gene significantly increases the yield per wheat plant under drought stress. TaMT1 The gene and its encoded protein have the function of positively regulating the yield of wheat per plant. This invention is of great significance in molecular breeding for regulating wheat drought resistance and yield. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 This invention relates to the introduction of the p110UBI-R vector into different wheat strains. TaMT1 Gene expression levels.
[0023] Figure 2 For the overexpression in this invention TaMT1 Phenotypic characteristics of wheat strains with different genes before and after drought treatment.
[0024] Figure 3 For the overexpression in this invention TaMT1 Survival statistics of wheat strains with different genes after drought treatment.
[0025] Figure 4 For the overexpression in this invention TaMT1Statistical data of yield of different strains of wheat under normal and drought conditions. DETAILED DESCRIPTION
[0026] The technical solutions of the present application will be clearly and completely described below in combination with the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative effort belong to the scope of protection of the present application.
[0027] In the following experimental examples, the test methods are conventional methods unless otherwise specified; and the materials, reagents, etc. used are reagents and materials available through commercial channels unless otherwise specified.
[0028] The present inventors previously identified a drought-related protein TaMT1 in wheat by using whole genome association analysis, which belongs to a class of plant metallothionein family and can participate in the clearance process of reactive oxygen species (ROS) in plants. It has been reported in literature that multiple genes encoding metallothionein in plants are induced to express under abiotic stresses such as drought, low temperature and high salt, but how they regulate the abiotic stress response process of plants is still unclear.
[0029] The p110UBI-GFP / Flag vector of the present application is produced by the present inventors independently, which is based on a commercial vector pCAMBIA, contains a conserved UBI gene promoter in monocotyledonous plants, a multiple cloning site and a GFP / Flag protein tag, is connected between the left and right borders of the vector through two restriction endonucleases Pst I and EcoR I, and contains kanamycin and rifamycin resistance genes that can be used for resistance screening, and is available to the public from the School of Life Sciences, Henan University.
[0030] The Agrobacterium tumefaciens EHA105 strain used in the present application is available to the public from the School of Life Sciences, Henan University.
[0031] The wild-type wheat material used in the present application is the variety "Fielder" (Triticum aestivum L. cv. Fielder), which is available to the public from the School of Life Sciences, Henan University.
[0032] Example 1: Obtaining of protein TaMT1 and its encoding gene 1. Take the seeds of wheat Fielder, soak them in water at room temperature for 48 hours, then place them in a refrigerator at 4℃ for 24 hours to germinate, and then transfer the germinated wheat seeds to nutrient soil for cultivation for two weeks. Freeze the whole plant in liquid nitrogen, grind and extract total RNA, perform reverse transcription, and obtain cDNA.
[0033] 2. PCR amplification was performed with the cDNA obtained in step 1 as a template, 5'- ATGCACACGCACCCTTGCTCGAC -3' as a forward primer, and 5'- CTATTGTGGTGATGAACGATTGATTTG -3' as a reverse primer to obtain a PCR product. The PCR reaction system and reaction procedure were as follows: The reaction system is shown in Table 1: Table 1 PCR reaction system The reaction procedure is shown in Table 2: Table 2 PCR reaction procedure 3. The amplified PCR product was subjected to agarose gel electrophoresis, and a DNA fragment of about 336 bp was separated, purified, and sequenced. The sequencing result showed that the nucleotide sequence of the DNA fragment is shown as SEQ ID No. 2, 1-336 in the sequence listing.
[0034] SEQ ID No. 2 in the sequence listing is the full-length coding region sequence of the gene encoding the protein TaMT1 shown in SEQ ID No. 1 in the sequence listing in wheat Fielder. The gene encoding the protein TaMT1 is named as gene TaMT1 .
[0035] Example 2: Application of TaMT1 in regulating drought resistance of wheat I. Construction of recombinant overexpression vector p110UBI-R and recombinant agrobacterium R1 1. Construction of recombinant overexpression vector p110UBI-R The DNA fragment shown as SEQ ID No. 2, 1-336 in the sequence listing was cloned into the BamH I enzyme cutting site between the vector p110UBI-GFP / Flag, and after sequencing and comparison, the recombinant overexpression vector p110UBI-R was obtained.
[0036] The recombinant overexpression vector p110UBI-R is a vector obtained by inserting the DNA fragment shown as SEQ ID No. 2, 1-336 in the sequence listing into the BamH I enzyme cutting site between the vector p110UBI-GFP / Flag, and keeping other sequences of the vector p110UBI-GFP / Flag unchanged.
[0037] 2. Obtaining of recombinant agrobacterium p110UBI-R The recombinant overexpression vector p110UBI-R was transformed into the agrobacterium EHA105 strain, and after PCR detection, the recombinant agrobacterium R1 containing the recombinant vector p110UBI-R was obtained.
[0038] II. Overexpression TaMT1 Obtaining of the transgenic wheat lines The recombinant Agrobacterium R1 was used to transform wild-type wheat Fielder by embryogenic callus infection method, and the T0 generation of wheat lines was harvested and the T1 generation of seeds was harvested; after the T1 generation of seeds was germinated, the resistant seedlings were obtained for subsequent planting and harvesting of seeds to obtain the T2 generation of seeds; after the T2 generation of seeds was germinated, different transgenic lines were randomly selected for RT-qPCR detection to determine the overexpression TaMT1 Wheat lines. Two transgenic lines with high gene expression were selected for drought resistance and yield determination, and were named OE-1 and OE-2, respectively. TaMT1
[0039] T0 generation represents the transformed generation of plants, T1 generation represents the seeds produced by selfing of T0 generation and the plants grown from it, and T2 generation represents the seeds produced by selfing of T1 generation and the plants grown from it.
[0040] The specific operation steps of the above-mentioned Agrobacterium-mediated wheat transgenic process are as follows: (1) Obtaining of wheat mature embryo-induced callus: take the dried seeds of mature wheat, remove the husks and place them in a sterile 100 mL triangular flask. Add 70% alcohol in the super-clean bench and surface sterilize for 45 s, constantly shaking the triangular flask during the process. Then transfer the seeds to a 2.5% sodium hypochlorite solution, add a drop of Triton X-100, and then place the seeds in a 28°C shaking incubator with 200 rpm shaking for 15 min. Then transfer the seeds to a 2.5% sodium hypochlorite solution in a 28°C shaking incubator with 200 rpm shaking for another 15 min. Discard the sterilization solution and rinse repeatedly with sterile distilled water until the rinsed solution is clear and free of foreign matter. Pour out the seeds and place them on a petri dish lined with sterile filter paper, and dry them in the super-clean bench for 45 min. Place the seeds on N6D solid medium one by one, and place them in a 28°C incubator for 4 weeks. Pick the tender yellow and smooth embryogenic callus and subculture it on new N6D solid medium for 5 days, which can be used for Agrobacterium transformation.
[0041] (2) Cultivation of Agrobacterium: take the transformed Agrobacterium stored at -80°C, spread it on YEB solid medium containing the corresponding antibiotic for streaking activation, then place the Agrobacterium in a 28°C incubator for 3 days. Pick well-grown single colonies and streak them again on YEB solid medium containing the corresponding antibiotic. After 1 day of 28°C incubation, scrape the firewood-sized solid strain with a sterile medicine spoon and suspend it in 30 mL of AAM (the final concentration of acetyl cinnamaldehyde is 40 mg / L) liquid medium for transformation.
[0042] (3) Agrobacterium transformation and co-cultivation: The small granular callus with vigorous growth after subculture was scraped from N6D medium and placed in a 100 mL triangular flask. The callus was suspended in AAM medium with Agrobacterium strain, soaked for 20 min, and then the AAM medium was discarded. The callus was placed on a sterile filter paper in a culture dish, and after being blown dry for 30 min in a clean bench, it was placed on N6D+AAM co-cultivation medium with a layer of filter paper. The callus was placed in a 23°C incubator and dark cultured for 4 days.
[0043] (4) Agrobacterium removal and screening culture: The callus at the end of co-cultivation was scraped into a sterile triangular flask with a sterile medicine spoon, washed several times with sterile distilled water until the washed water was clear. A certain volume of sterile distilled water was added again, and the callus was allowed to stand in the clean bench for 15 min, and then soaked twice with sterile distilled water containing a final concentration of 400 mg / L carbenicillin for 15 min each time. The callus at the end of soaking was poured onto a culture dish with sterile filter paper, and after being blown dry for 3 h in a clean bench, the callus was placed on N6D medium containing the corresponding antibiotic. It was placed in a 30°C incubator for dark culture, and subcultured every two weeks for two times. +
[0044] (5) Redifferentiation of resistant callus after infection: The callus after screening and subculture was transferred to a high osmotic medium according to different transgenic strains, and placed in a 30°C light incubator for light culture for 2 weeks until the callus turned green. The green callus was again transferred to a low osmotic medium until tender shoots grew. The tender shoots were transferred to a flask of rooting medium according to different clones, and placed in a 30°C light incubator for light culture for 2 weeks to obtain resistant seedlings.
[0045] (6) Water culture and transplanting of resistant seedlings: When the resistant seedlings grew to the top of the triangular flask, the filter membrane at the top was removed, and the seedlings were placed in the air. At the same time, sterile distilled water was added to the triangular flask, and the seedlings were acclimated in a light incubator. After the leaves of the seedlings were straight, the seedlings were pulled out of the triangular flask, the medium on the roots of the seedlings was washed off, and the seedlings were transplanted to a greenhouse for cultivation and management. After the plants flowered and pollinated under normal greenhouse conditions, the seeds were harvested.
[0046] Medium formula used in Agrobacterium-mediated wheat callus transformation process: N6D solid medium 1 L: sucrose, 30 g; NB Basal Medium, 4.1 g; Casein, 0.3 g; L-Proline, 2.875 g; 2,4-D, 0.2 g; Gelrite, 4 g; pH=5.8.
[0047] AAM Agrobacterium activation medium 1 L: AA-1, 1 mL; AA-2, 1 mL; AA-3, 1 mL; AA-4, 10 mL; AA-5, 1 mL; AA-6, 5 mL; AA-Sol, 10 mL; Casein, 0.5 g; Glucose, 36 g; Sucrose, 68.5 g; Aspartic acid, 0.3 g; L-Glutamine, 0.9 g; Myo-inositol, 0.1 g; KCl, 3 g; Acetyl-syringone, 40 mg; pH = 5.2.
[0048] AA-1 100 mL: MnSO4•6H2O, 1 g; H3BO4, 300 mg; ZnSO4•7H2O, 200 mg; KI, 75 mg; NaMoO4•2H2O, 25 mg; CuSO4•5H2O, 2.5 mg; CoCl2•6H2O, 2.5 mg.
[0049] AA-2 100 mL: CaCl2•2H2O, 15 g.
[0050] AA-3 100 mL: MgSO4•7H2O, 25 g.
[0051] AA-4 100 mL: FeSO4•7H2O, 278 mg; Na2EDTA, 373 mg.
[0052] AA-5 100 mL: NaH2PO4•2H2O, 15 g.
[0053] AA-6 100 mL: Nicotinic acid, 20 mg; Vitamin B1, 20 mg; Vitamin B6, 20 mg; Myo-inositol, 2 g.
[0054] AA-sol 100 mL: Arginine, 176.67 mg; Glycine, 75 mg.
[0055] N6D selection medium 1 L: Sucrose, 30 g; NB Basal Medium, 4.1 g; Casein, 0.3 g; L-Proline, 2.875 g; 2,4-D, 0.2 g; Gelrite, 4 g; pH = 5.8; Hygromycin 50 mg or Dibenzyl phosphine 2 mg; Carbenicillin 200 mg; Cefotaxime 250 mg.
[0056] High osmotic differentiation medium 1 L: sucrose, 30 g; sorbitol, 30 g; MS Medium, 4.43 g; Casein, 0.5 g; Gelrite, 4 g; pH = 5.8; Hygromycin, 50 mg or Dibrompropandiol, 2 mg; Carbenicillin, 200 mg; Cefotaxime, 250 mg; NAA, 0.3 mg; 6-BA, 3 mg.
[0057] Low osmotic differentiation medium 1 L: sucrose, 30 g; MS Medium, 4.43 g; Casein, 0.5 g; Gelrite, 4 g; pH = 5.8; Hygromycin, 50 mg or Dibrompropandiol, 2 mg; Carbenicillin, 200 mg; Cefotaxime, 250 mg; NAA, 0.3 mg; 6-BA, 3 mg.
[0058] Rooting medium 1 L: sucrose, 10 g; MS Medium, 2.215 g; Gelrite, 4 g; pH = 5.8.
[0059] The above RT-qPCR method for detecting transgenic wheat is as follows: take T2 generation transgenic strain wheat seedlings after germination for 14 days and wild type wheat seedlings under the same germination condition, extract total RNA of wheat leaves by using plant RNA small extraction kit of Tiangeng Company, and digest DNA by using DNase I. After determining the concentration by using NanoDrop2000 (Thermo Fisher, USA), take 2 μg to synthesize cDNA by using reverse transcription kit of Invitrogen Company with Oligo d(T) as primer. Amplify the cDNA of the gene by using specific quantitative detection primers QF and QR, take the wheat gene as an internal reference, and the primer is AF and AR. After analyzing the quantitative results, the expression amount of the gene in different transgenic wheat strains is as shown in the following table: TaMT1 The specific quantitative detection primers QF and QR are as follows: TaMT1 The cDNA of the gene is amplified, and the wheat gene is taken as an internal reference, and the primer is AF and AR. After analyzing the quantitative results, the expression amount of the gene in different transgenic wheat strains is as shown in the following table: Actin TaMT1 The specific quantitative detection primers QF and QR are as follows: Figure 1 The cDNA of the gene is amplified, and the wheat gene is taken as an internal reference, and the primer is AF and AR. After analyzing the quantitative results, the expression amount of the gene in different transgenic wheat strains is as shown in the following table: The specific quantitative detection primers QF and QR are as follows: QF: 5'- GGACAACAACTCTGCCGA -3'; QR: 5'- TACTTCTGGAGGTGGCTG -3'; AF: 5'- GACCGTATGAGCAAGGAGAT -3'; AR: 5'- CAATCGCTGGACCTGACTC -3'.
[0060] The results show that, compared with the wild type, the overexpression of the gene in the transgenic wheat strains can increase the expression of the gene in the transgenic wheat strains. TaMT1 Two transgenic lines (OE-1 and OE-2) of the gene TaMT1 The expression of the gene was significantly increased Figure 1 ).
[0061] III. Phenotypic analysis of drought resistance of transgenic wheat Pure lines of T3 generation of the transgenic wheat (OE-1 and OE-2) and wild type wheat (Fielder) were selected TaMT1 The transgenic wheat lines (OE-1 and OE-2) and wild type wheat (Fielder) were placed in a greenhouse after seed germination. After 20 days of growth under normal conditions, watering was stopped, and the plants were grown for another 2 weeks before phenotypic and plant survival rate statistics were performed.
[0062] The results showed that TaMT1 The growth of the transgenic wheat lines (OE-1 and OE-2) under drought conditions was significantly better than that of the wild type (Fielder), as shown by more relaxed leaves, less wilting Figure 2 , and significantly higher overall survival rate of the plants after drought treatment than the wild type Figure 3 . The above results showed that TaMT1 The gene and its encoded protein have a function of positively regulating the drought resistance of wheat, and overexpression of the gene in wheat can improve the growth state and increase the survival rate of wheat under drought stress conditions. TaMT1
[0063] IV. Phenotypic analysis of yield of transgenic wheat Pure lines of T3 generation of the transgenic wheat (OE-1 and OE-2) and wild type wheat (Fielder) were selected TaMT1 The transgenic wheat lines (OE-1 and OE-2) and wild type wheat (Fielder) were placed in a greenhouse after seed germination. After 30 days of growth under normal conditions, watering was limited to maintain the soil water content at about 8%, and the plants were grown until maturity, after which mature seeds were selected for statistical analysis of seed phenotype.
[0064] The results showed that the wild type wheat Fielder, TaMT1 The single plant yields of the two transgenic wheat lines (OE-1 and OE-2) under normal conditions were 9.02 g, 9.81 g and 9.27 g, respectively, and under drought conditions were 3.39 g, 4.56 g and 4.22 g, respectively. Compared with the wild type, the single plant yields of the two TaMT1 The single plant yields of the two transgenic wheat lines (OE-1 and OE-2) under drought conditions were increased by 34.5% and 24.2%, respectively Figure 4 , indicating that overexpression of the gene significantly increased the single plant yield of wheat under drought stress conditions. The above results showed that TaMT1 The gene and its encoded protein have a function of positively regulating the single plant yield of wheat, and overexpression of the gene in wheat can significantly increase the single plant yield of wheat under drought stress conditions. TaMT1 TaMT1 Genes, which can improve the yield of wheat under drought conditions.
[0065] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. TaMT1 Application of genes or encoded proteins in regulating wheat drought resistance and / or yield.
2. The application according to claim 1, characterized in that: The regulation is achieved by increasing... TaMT1 The expression level or activity of genes or encoded proteins can be used to improve wheat drought resistance and / or yield.
3. TaMT1 Application of genes or encoded proteins in the breeding of drought-resistant or high-yield transgenic wheat.
4. The application according to claim 3, characterized in that: The cultivation method involves increasing the concentration of certain nutrients in wheat plants. TaMT1 By adjusting the expression level or activity of genes or encoded proteins, transgenic wheat with improved drought resistance and / or increased yield can be bred.
5. The application according to claim 1 or 3, characterized in that: The TaMT1 The nucleotide sequence of the gene is shown in SEQ ID No. 2 or SEQ ID No.
3.
6. The application according to claim 1 or 3, characterized in that: The amino acid sequence of the encoded protein is shown in SEQ ID No.
1.
7. A biomaterial, characterized in that: Contains the contents of claim 5 TaMT1 Gene expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines.
8. A method for improving the drought resistance and / or yield of wheat, characterized in that, The steps are as follows: By improving TaMT1 The expression level of genes can be used to improve wheat drought resistance and / or yield.
9. A method for breeding transgenic wheat with improved drought resistance and / or increased yield, characterized in that, The steps are: build TaMT1 The gene overexpression vector p110UBI-R was transferred into the plants to be improved, resulting in wheat plants with increased drought resistance and / or yield.
10. The method according to claim 8 or 9, characterized in that: The TaMT1 The nucleotide sequence of the gene is shown in SEQ ID No. 2 or SEQ ID No. 3.
Citation Information
Patent Citations
Wheat drought-tolerant gene TaTZF1 and application thereof in plant drought tolerance
CN120330214A
Application of TaWDR3 protein and coding gene thereof in regulating drought resistance of wheat
CN120365394A