Use of circRNA-clk1 in intestinal ischemia-reperfusion injury
By highly expressing the cDNA sequence of circRNA-clk1 (SEQ ID NO.1), acute lung injury and ferroptosis in an intestinal ischemia-reperfusion injury model were inhibited, solving the treatment challenge of intestinal ischemia-reperfusion injury and significantly reducing mortality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-22
- Publication Date
- 2026-03-27
AI Technical Summary
There are no effective treatments for acute lung injury and ferroptosis caused by intestinal ischemia-reperfusion injury, resulting in a high mortality rate. Current treatments are mainly symptomatic, lacking specific interventions.
Inhibiting acute lung injury in an intestinal ischemia-reperfusion injury model by overexpressing circRNA-clk1, and using the cDNA sequence of circRNA-clk1 (SEQ ID NO.1) for treatment, including using lentiviruses that overexpress circRNA-clk1 to upregulate its expression as a target for drug screening.
It inhibited ferroptosis and acute lung injury in the intestinal ischemia-reperfusion injury model, reduced the content of ferrous ions in lung tissue and serum, alleviated the degree of lung injury, and protected lung tissue.
Smart Images

Figure CN120966988B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological medicine, in particular to the application of circRNA-clk1 in intestinal ischemia-reperfusion injury. BACKGROUND
[0002] Intestinal ischemia-reperfusion injury (IRI) is a big problem in the field of clinical critical illness, which is common in intestinal obstruction, trauma, shock and other diseases. When the mesenteric artery is interrupted due to thrombosis or compression, the intestinal cells will be acutely injured due to hypoxia and sugar deficiency, and the "second hit" after the blood flow is restored will cause severe oxidative stress and inflammatory response, leading to destruction of the intestinal mucosal barrier, bacterial translocation, and even induction of multiple organ failure. According to statistics, the mortality rate of such patients in the intensive care unit is as high as 30%, and there is currently a lack of effective intervention means in clinical practice.
[0003] Cellular ferroptosis as a new type of programmed cell death has become a research hotspot in recent years. It is different from apoptosis or necrosis, and depends on iron ion-mediated lipid peroxidation, characterized by mitochondrial crinkling, glutathione (GSH) depletion and glutathione peroxidase 4 (GPx4) inactivation. In intestinal IRI, ischemia and hypoxia will lead to intracellular iron ion accumulation, activation of acyl-coenzyme A synthetase long-chain family member 4 (ACSL4), promotion of polyunsaturated fatty acid oxidation, and ultimately trigger a cascade of cellular ferroptosis. How to block this pathway has become the key to improving the prognosis of intestinal IRI.
[0004] In addition, according to relevant research, during the process of intestinal ischemia-reperfusion, lipopolysaccharide from the ischemic intestine into the systemic circulation can activate macrophages and mononuclear cells in the circulating blood and tissues and organs to release tumor necrosis factor (TnF), causing neutrophil aggregation and adhesion to endothelial cells, causing lung injury. In addition, the release of elastase by activated infiltrating neutrophils, and the inflammatory response mediated by phospholipase A2 (pLA2), etc., all play an important role in acute lung injury caused by intestinal ischemia-reperfusion. Currently, the treatment for acute lung injury caused by intestinal ischemia-reperfusion is relatively limited in clinical practice, mainly relying on symptomatic treatment, but the complication and mortality rate remains high. Therefore, it is of great clinical significance to find effective treatment methods and intervention measures. SUMMARY
[0005] The present application provides a circular RNA, circRNA-clk1, which can participate in cellular ferroptosis and intestinal damage caused by intestinal ischemia-reperfusion injury. By overexpressing circRNA-clk1, acute lung injury in an intestinal ischemia-reperfusion injury model can be inhibited.
[0006] To achieve this purpose, the present application provides the following technical solutions:
[0007] In the first aspect of the present application, the use of a reagent for detecting a biomarker in a sample in the preparation of a product for diagnosing intestinal ischemia-reperfusion injury and related diseases thereof is provided, wherein the biomarker is circRNA-clk1, and the nucleotide sequence of the cDNA corresponding to circRNA-clk1 comprises SEQ ID NO. 1.
[0008] In the present application, the cDNA sequence of circRNA-clk1 corresponding to SEQ ID NO. 1 is:
[0009] atgagacattcaaagagaacttactgtcctgactgggatgaaagagactgggattatggaacatggagaagcagcagcagtcacaaaagaaagaagagatcacatagcagcgcccgtgagcaaaagcgctgcaggtacgatcactccaaaacgacagacagctattatctggaaagcagatccataaatgagaaagcttatcatagtcgacgctatgttgatgaatacaggaatgactacatgggctacgagccagggcatccctatggagaacctggaagcagataccagatgcatagtagcaagtcctctggtaggagtggaagaagcagttacaaaagtaaacacaggagtcgccaccacacttcgcagcaccattcacacgggatgaaattgttgatactttaggtgaaggtgctttcggaaaagtggtggaatgcatcgatcataaagt.
[0010] Preferably, the related diseases of intestinal ischemia-reperfusion injury include cell ferroptosis caused by intestinal ischemia-reperfusion injury.
[0011] Preferably, the related diseases of intestinal ischemia-reperfusion injury include acute lung injury caused by intestinal ischemia-reperfusion injury.
[0012] In the second aspect of the present application, the use of a reagent for up-regulating the expression of circRNA-clk1 in the preparation of a drug for preventing and treating intestinal ischemia-reperfusion injury and related diseases thereof is provided, wherein the nucleotide sequence of the cDNA corresponding to circRNA-clk1 comprises SEQ ID NO. 1.
[0013] Preferably, the reagent for up-regulating the expression of circRNA-clk1 comprises a lentivirus overexpressing circRNA-clk1.
[0014] Preferably, the related diseases include cell ferroptosis caused by intestinal ischemia-reperfusion injury and acute lung injury caused by intestinal ischemia-reperfusion injury.
[0015] In a third aspect, the application provides an application of circRNA-clk1 as a target in screening drugs for preventing and treating intestinal ischemia-reperfusion injury and related diseases, characterized in that the nucleotide sequence of the cDNA corresponding to the circRNA-clk1 comprises SEQ ID NO. 1.
[0016] Preferably, the related diseases include cell ferroptosis caused by intestinal ischemia-reperfusion injury and acute lung injury caused by intestinal ischemia-reperfusion injury.
[0017] In a fourth aspect, the application provides a circRNA-clk1, wherein the cDNA sequence corresponding to the circRNA-clk1 is shown in SEQ ID NO: 1.
[0018] Compared with the prior art, the application has the beneficial effects and significant progress in that:
[0019] 1. The application finds the differentially expressed circular RNA, i.e., circRNA-clk1, through model and lung sample chip whole transcriptome screening of the control group.
[0020] 2. The application verifies through experiments that knocking out or down-regulating the expression of circRNA-clk1 causes more ferrous ions in the lung tissue and serum of mice. Therefore, by overexpressing circRNA-clk1, cell ferroptosis of the intestinal ischemia-reperfusion injury model can be inhibited.
[0021] 3. The application verifies through experiments that knocking out or down-regulating the expression of circRNA-clk1 causes more severe acute lung injury in mice. Therefore, by overexpressing circRNA-clk1, acute lung injury of the intestinal ischemia-reperfusion injury model can be inhibited. BRIEF DESCRIPTION OF DRAWINGS
[0022] To make the technical solutions of the application clearer, the following will briefly introduce the drawings needed for the embodiments of the application.
[0023] Obviously, the drawings in the following description are only part of the drawings in the application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative labor, but these other drawings also belong to the drawings needed for the embodiments of the application.
[0024] Figure 1A figure of ferrous ion content in lung tissue and serum of each group of mice in Example 1 of the present application;
[0025] Figure 2 A figure of GSH detection results of each group of mice in Example 1 of the present application;
[0026] Figure 3 A figure of ROS detection results of each group of mice in Example 1 of the present application;
[0027] Figure 4 A figure of lung injury results of each group of mice in Example 2 of the present application;
[0028] Figure 5 A figure of transmission electron microscope (TEM) observation of each group of mice in Example 2 of the present application;
[0029] Figure 6 A figure of Western blot results of each group of mice in Example 3 of the present application;
[0030] Figure 7 A figure of Fe detection results of each group of mice in Example 4 of the present application. DETAILED DESCRIPTION
[0031] In order to make the objects, technical solutions and advantages of the embodiments of the present application clearer, the following further describes the present application with specific embodiments. It should be understood that these embodiments are only used to illustrate but not limit the scope of the present application. The experimental methods in the following examples without specific conditions are usually according to the conventional conditions or according to the conditions suggested by the manufacturers. Unless otherwise specified, the percentages and parts are weight percentages and weight parts. The experimental materials and reagents used in the following examples are commercially available unless otherwise specified.
[0032] Unless otherwise indicated, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. It should be noted that the terms used herein are only for the purpose of describing the specific embodiments of the present application, and are not intended to limit the exemplary embodiments of the present application.
[0033] The following explains some of the terms mentioned in the present application.
[0034] In the present application, circRNA is an endogenous RNA, which is unique in that it forms a closed loop structure by reverse splicing, and lacks the 5' cap and 3' poly(A) tail of linear RNA. This structure makes it highly resistant to nucleases, so it is more stable in cells.
[0035] In the present application, cDNA (complementary DNA) is a DNA molecule synthesized by reverse transcription process with RNA as template, and the letter "c" in its name represents "complementary". This DNA is generated by reverse transcriptase, and is completely complementary to the original RNA template.
[0036] In the following, the technical solutions of the present application are described in detail with specific examples.
[0037] Example 1
[0038] 1. Screening of circRNA-clk1
[0039] In this example, the differentially expressed circular RNA found by model and control group lung sample chip whole transcriptome screening. The circular RNA is named circRNA-clk1, and the cDNA sequence corresponding to circRNA-clk1 is:
[0040] atgagacattcaaagagaacttactgtcctgactgggatgaaagagactgggattatggaacatggagaagcagcagcagtcacaaaagaaagaagagatcacatagcagcgcccgtgagcaaaagcgctgcaggtacgatcactccaaaacgacagacagctattatctggaaagcagatccataaatgagaaagcttatcatagtcgacgctatgttgatgaatacaggaatgactacatgggctacgagccagggcatccctatggagaacctggaagcagataccagatgcatagtagcaagtcctctggtaggagtggaagaagcagttacaaaagtaaacacaggagtcgccaccacacttcgcagcaccattcacacgggatgaaattgttgatactttaggtgaaggtgctttcggaaaagtggtggaatgcatcgatcataaagt.
[0041] 2. Construction of intestinal ischemia / reperfusion (II / R) mouse model
[0042] Mice underwent midline incision surgery after being anesthetized with 50 mg / kg sodium pentobarbital via intraperitoneal injection. The superior mesenteric artery was occluded for 45 minutes using a vascular clamp, followed by 180 minutes of reperfusion to induce intestinal ischemia / reperfusion. A sham-operated control group of mice underwent a similar procedure but without vascular occlusion.
[0043] 3. Experimental Grouping
[0044] circClk1 CKO refers to mice with conditional knockout of RNA-clk1 (CKO).
[0045] WT mice are sham-operated mice.
[0046] II / R is a mouse model of intestinal ischemia / reperfusion (II / R).
[0047] Sham is a sham surgery model.
[0048] 4. Detection of ferrous ion content
[0049] The content of ferrous ions in the lung tissue and serum of mice in each group was measured.
[0050] The results are as follows Figure 1 As shown in the figure, 1a represents the ferrous ion content in the serum of mice in each group, and 1b represents the ferrous ion content in the lung tissue of mice in each group. The results show that the lung tissue and serum of circRNA-clk1 CKO mice showed higher ferrous ion content.
[0051] 5. GSH / MDA testing
[0052] The GSH / GSH content in the tissues and cells of mice in each group was assessed according to the instructions of the GSH detection kit (D79962, Shanghai Sangon Biotech, China) and the GSH detection kit (BC1175, Solarbio, China).
[0053] The results are as follows Figure 2 and 3 As shown, where, Figure 2 'a' represents the GSH test result. Figure 2 b represents the MDA detection result. Figure 3 The results show that GSH was significantly suppressed in circRNA-clk1 CKO mice, and MDA and ROS levels were elevated in the II / R model, particularly in circRNA-clk1 CKO mice.
[0054] Example 2
[0055] 1. Lung Injury Score
[0056] The lung injury score was performed on the four groups of mice of Example 1, and the specific steps are as follows.
[0057] The mouse lung tissue was fixed in 10% formalin, then embedded in paraffin section, cut into 5μ thick section. Then, the section was stained with hematoxylin and eosin (HE), and examined using a Nikon-U optical microscope equipped with an Optronics DEI-470 digital camera. In order to evaluate acute lung injury (ALI), a five-point scoring system (0-4) was used, based on several parameters: criteria included assessment of alveolar and interstitial edema, inflammatory cell infiltration within alveoli, alveolar hemorrhage, and atelectasis, which were as follows:
[0058] 0: normal, tissue occupancy < 15%, alveolar space occupancy > 85%.
[0059] 1: mild injury, tissue occupancy 15-25% alveolar space occupancy 75-85%.
[0060] 2: moderate injury, tissue occupancy 25-50%, alveolar space occupancy 50-75%.
[0061] 3: severe injury, tissue occupancy 50-75%, alveolar space occupancy 25-50%.
[0062] 4: very severe injury, tissue occupancy 75-100%, alveolar space occupancy 0-25%.
[0063] The lung injury results are shown in Table 1, and the lung tissue sections are shown in Figure 1. Figure 4 As shown in Table 1 and Figure 1, the circRNA-clk1 CKO II / R mice had more severe II / R-ALI pathology compared to WT mice. It can be seen that circRNA-clk1 has a protective effect on ALI.
[0064] 2. Transmission electron microscopy (TEM) observation
[0065] Transmission electron microscopy (TEM) observation was performed on the four groups of mice of Example 1, and the specific steps are as follows.
[0066] The lung tissue was preserved in 0.05M sodium borate buffer solution 2.5% glutaraldehyde solution (pH adjusted to 7.2) at 25°C for 2 hours. Subsequently, the sample was post-fixed with 2% OsO4 in 0.1M sodium borate buffer for 2 hours, then stained in 1% aqueous iodine acid salt overnight. The sample was dehydrated in ethanol, resin, sectioned, mounted on copper mesh, and stained with iodine acid salt and lead citrate. The sample was observed by transmission electron microscopy (TEM) (FEI, Oregon).
[0067] The results are shown in Figure 2.Figure 5 As shown, compared with WT mice, circRNA-clk1 CKO IIR mice have smaller mitochondria, fewer or no cristae, and torn outer membranes.
[0068] Example 3: Protein Blotting
[0069] Western blot experiments were performed using the four groups of mice from Example 1. The specific steps are as follows.
[0070] RIPA lysis buffer (catalog number 89900; Thermo Fisher Scientific) was used for protein extraction from cells and tissues. PVDF membranes (catalog number 88585; Thermo Fisher Scientific) were incubated with 5% BSA for 2 hours at room temperature, followed by overnight incubation with primary antibodies at 4°C. The membranes were then incubated at 37°C with the secondary antibody HRP-labeled goat anti-small IgG (HL). The primary antibodies used in this example included Fth1 (Abcam, USA), Fpn (Abcam, USA), TfR (Affinity Biosciences, China), Dmt1 (Affinity Biosciences, China), Ftmt (Affinity Biosciences, China), Nrf2 (Abcam, USA), Gpx4 (Abcam, USA), ACSL4 (Affinity Biosciences, China), and β-actin (Abcam, USA).
[0071] The results are as follows Figure 6 As shown, compared with control mice, the expression of ferroptosis protein ACSL4 was significantly increased and the expression of antiferroptosis protein GPX4 was further decreased in the lung tissue of circRNA-Clk1 CKO mice.
[0072] Example 4 Fe Detection
[0073] Fe detection experiments were conducted using four groups of mice from Example 1. The specific steps are as follows.
[0074] Cellular total Fe, ferric and ferrous iron levels were determined by Fe detection kit following the instruction manual. Briefly, after washing lung tissues or cells with PBS on ice, homogenization was performed with Dounce homogenizer in Fe detection buffer, followed by centrifugation at 16,000 x g for 10 min, and the supernatant was collected for detection. Samples (25 μΐ) were diluted to 100 μΐ in 96-well plates using detection buffer. For total Fe quantification, 5 μΐ of Fe reducing reagent was added; for ferrous Fe, 5 μΐ of detection buffer was added. All samples and standards were then incubated at 37 °C for 30 min, followed by the addition of 100 μΐ of Fe probe to each well, mixed well, and incubated at 37 °C for 1 h in the dark. Absorbance was read at 593 nm with a plate reader. Finally, Fe levels were calculated according to the standard curve and normalized to protein levels determined by Bradford protein detection method.
[0075] Results are shown in Figure 7 Further elevation of iron importers (TfR, DMT1) and further reduction of iron exporters (FPN) and iron storage proteins (FTMT, FTH1) were observed. These results indicate that iron accumulation in cells is exacerbated upon RNA-Clkl deletion. This indicates that in the absence of circRNA-clkl, iron accumulation and cellular iron death is accelerated.
[0076] In the description of the above specification:
[0077] The description of the terms "the embodiments", "the embodiments of the present application", "as shown", "further", "further improved technical solutions" and the like means that the specific features, structures, materials or characteristics described in the embodiments or examples are contained in at least one embodiment or example of the present application; in the present specification, the illustrative description of the above terms is not necessarily for the same embodiment or example, and the specific features, structures, materials or characteristics described can be combined or combined in any one or more embodiments or examples in a suitable manner; in addition, the person skilled in the art can combine or combine the different embodiments or examples described in the specification and the features of the different embodiments or examples without contradiction.
[0078] Finally, it should be noted that:
[0079] The above embodiments are only used to illustrate the technical solutions of the present application, and are not limited thereto;
[0080] Although the present application has been described in detail with reference to the foregoing embodiments, it will be understood by those skilled in the art that modifications can be made to the foregoing embodiments, or some or all of the technical features thereof can be substituted equivalently, and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present application. Non-essential improvements and adjustments or substitutions made by those skilled in the art based on the content of the present specification are within the scope of the present application.
Claims
1. Use of circRNA-clk1 for the preparation of a product for the diagnosis of intestinal ischemia-reperfusion injury and diseases related thereto, characterized in that, The nucleotide sequence of the cDNA corresponding to the circRNA-clk1 is SEQ ID NO. 1, and the related diseases include cell ferroptosis caused by intestinal ischemia-reperfusion injury and acute lung injury caused by intestinal ischemia-reperfusion injury.
2. The use of a lentivirus comprising circRNA-clk1 overexpression in the preparation of a drug for preventing and treating intestinal ischemia-reperfusion injury and related diseases, characterized in that, The nucleotide sequence of the cDNA corresponding to the circRNA-clk1 is SEQ ID NO. 1, and the related diseases include cell ferroptosis caused by intestinal ischemia-reperfusion injury and acute lung injury caused by intestinal ischemia-reperfusion injury.
3. Application of circRNA-clk1 as a target in screening drugs for preventing and treating intestinal ischemia-reperfusion injury and related diseases, characterized in that, The nucleotide sequence of the cDNA corresponding to the circRNA-clk1 is SEQ ID NO. 1, and the related diseases include cell ferroptosis caused by intestinal ischemia-reperfusion injury and acute lung injury caused by intestinal ischemia-reperfusion injury.
Citation Information
Patent Citations
Circular RNA marker for detecting cerebral ischemia-reperfusion injury and application
CN110387415A
Application of MCU inhibitor in preparation of medicine for preventing or treating intestinal ischemia-reperfusion injury
CN120617515A