PLS3 gene SNP (Single Nucleotide Polymorphism) marker for rapidly detecting economic traits of Tibetan chicken, detection method and application

By designing specific primer pairs for PCR amplification and enzyme digestion, the problems of high SNP detection cost and difficulty in haplotype inference were solved, enabling rapid and convenient detection of economic traits in Tibetan chickens and improving the efficiency and accuracy of Tibetan chicken breeding.

CN120967014AActive Publication Date: 2025-11-18SOUTHWEST UNIVERSITY FOR NATIONALITIES

Patent Information

Application Number
CN202511502327.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-21
Publication Date
2025-11-18
Estimated Expiration
2045-10-21

AI Technical Summary

Technical Problem

Existing technologies for SNP detection are costly and difficult to accurately infer haplotypes and estimate genetic effects, which limits their large-scale application in the animal breeding industry, especially in Tibetan chicken breeding where there is a lack of research on the relationship between the PLS3 gene and economic traits.

Method used

This invention provides a rapid method for detecting SNP markers of the PLS3 gene in Tibetan chickens. Specific primer pairs are designed for PCR amplification and enzyme digestion. The BstZ17 I restriction site is used to identify economic traits of Tibetan chickens, including traits such as breast width, live weight, semi-eviscerated weight, and leg muscle rate. The detection is performed using a kit or test strip.

Benefits of technology

It enables rapid, simple, and low-cost detection of economic traits in Tibetan chickens, accurately screening out superior individuals and improving the efficiency and accuracy of Tibetan chicken breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120967014A_ABST
    Figure CN120967014A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of molecular biological detection, and particularly relates to a PLS3 gene SNP marker for rapidly detecting economic traits of Tibetan chicken, a detection method and application. It is found for the first time that G / A mutation at the 28469th site of the Tibetan chicken PLS3 gene is closely related to whether the gene has a BstZ17 I restriction enzyme cutting site or not, and is closely related to main economic traits of Tibetan chicken. Based on the new discovery and the SNP site, the invention provides a method for rapidly detecting the SNP site and screening economic characters of Tibetan chicken. The method is simple to operate, convenient and fast, low in cost and reliable in result.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology detection, and particularly relates to a SNP marker for rapid detection of economic traits of Tibetan chicken and a detection method and application thereof. PLS3 The present application belongs to the field of molecular biology detection, and particularly relates to a SNP marker for rapid detection of economic traits of Tibetan chicken and a detection method and application thereof. BACKGROUND

[0002] Single Nucleotide Polymorphism (SNP) refers to the variation of different types of bases at a specific nucleotide position in the genomic DNA sequence due to base conversion, insertion, deletion or transversion. In other words, SNP refers to a single base variation at a specific position in the chromosomal DNA sequence, and such variation shows individual differences due to various reasons. When the frequency of such variation in a population reaches 1% or above, it can be considered as polymorphism. SNP marker is the third generation of DNA genetic marker technology, and it has become an effective means for detecting the expression level of genetic material due to its high specificity, and is widely used in the research of biological genetic diversity and molecular breeding field. Through SNP analysis, target genes can be quickly screened, and the utilization rate of germplasm resources can be improved, so SNP detection technology has great potential and application prospect. However, the cost of SNP detection is high, which limits the large-scale application of whole genome selection in animal breeding field. In addition, how to accurately infer haplotype from SNP, and how to estimate the genetic effect of haplotype and SNP, so as to make it the basis for accurate estimation of breeding value, is also a difficult problem in the application of SNP.

[0003] Animal Molecular Breeding is a method of combining molecular genetic theory and traditional quantitative genetic theory, using genetic information and multi-gene information at the molecular level to analyze the genetic traits of livestock to be improved, so as to quickly and efficiently breed livestock breeds. Molecular breeding, i.e. molecular mark-assist selection (MAS), is a method of selecting breeding materials by means of DNA molecular markers, and then realizing the improvement of livestock traits. MAS is a method of combining molecular biology and traditional genetic breeding to breed new varieties. In livestock breeding, through the selection of DNA markers closely related to economic traits, the purpose of early selection and improving selection accuracy is achieved, so as to obtain greater genetic progress.

[0004] PLS3 Also known as T-plastin, it is a subtype in the actin cross-linking and binding protein family. PLS3Encoding an actin-binding protein with a wide expression pattern, it plays a role in actin binding and binding within the cytoskeleton by inhibiting cofilin-mediated depolymerization of actin filaments. Currently, there is no... PLS3 A study on the relationship between genes and economic traits of Tibetan chickens. Summary of the Invention

[0005] The purpose of this invention is to provide a rapid method for detecting economic traits in Tibetan chickens. PLS3 Gene SNP markers, detection methods, and applications.

[0006] To achieve the above-mentioned objectives, the technical solution adopted by this invention is: an SNP molecular marker affecting the traits of Tibetan chickens, wherein the SNP molecular marker is located in the Tibetan chicken... PLS3 At position 28469 of the gene, the mutated base is either G or A. The genotype of the SNP molecular marker is any one of GG, AA, or AG.

[0007] Correspondingly, the SNP molecular markers are used in detecting economic traits of Tibetan chickens or in the breeding of Tibetan chickens.

[0008] Accordingly, kits, test strips, or detection reagents containing the SNP molecular marker. The kits, test strips, or detection reagents include at least a specific primer pair for amplifying the SNP molecular marker. The primer pair includes: an upstream primer as shown in SEQ ID NO: 1; and a downstream primer as shown in SEQ ID NO: 2.

[0009] Accordingly, the application of the kit, test strip, or detection reagent in detecting Tibetan chicken traits. The application includes the following steps: (1) Obtain blood from the Tibetan chicken to be tested; (2) Extracting genomic DNA from blood; (3) Perform PCR amplification on genomic DNA to obtain PCR amplification products; (4) The PCR amplification products were digested with enzymes, electrophoresed and analyzed to determine the genotype of the SNP molecular marker in the Tibetan chicken to be tested.

[0010] Accordingly, a method for rapid identification of the SNP molecular marker includes the following steps: (1) PCR amplification of Tibetan chicken PLS3 Gene; (2) Determine whether the obtained PCR amplification product can be digested by the restriction endonuclease BstZ17 I; if both strands can be digested by BstZ17 I, then it is identified as... PLS3 The genotype at position 28469 of the gene is GG; if neither strand can be cleaved by BstZ17 I, it is identified as... PLS3If only one strand can be cut by BstZ17 I, it is identified as PLS3 The genotype of the gene at position 28469 is AG.

[0011] Correspondingly, a method for rapidly judging economic traits of Tibetan chickens by using the SNP molecular marker, the method comprising the following steps: (1) PCR amplifying the Tibetan chicken PLS3 gene; (2) judging whether the obtained PCR amplification product can be cut by the restriction enzyme BstZ17 I; if the result is that both strands can be cut by BstZ17 I, it is identified that PLS3 the genotype of the gene at position 28469 is GG; if the result is that one strand can be cut by BstZ17 I, it is identified that PLS3 the genotype of the gene at position 28469 is AG; and if the result is that both strands cannot be cut by BstZ17 I, it is identified that PLS3 the genotype of the gene at position 28469 is AA; identified PLS3 The economic traits of the Tibetan chicken with the genotype of the gene at position 28469 being GG are better than those of the Tibetan chicken with the genotype of the gene at position 28469 being AA, and the economic traits of the Tibetan chicken with the genotype of the gene at position 28469 being AA are better than those of the Tibetan chicken with the genotype of the gene at position 28469 being AG.

[0012] The present application has the following beneficial effects: the present application first finds that the A / G mutation of the gene at position 28469 of the Tibetan chicken PLS3 is closely related to the existence of the BstZ17 I cutting site of the gene and is closely related to the main economic traits (breast width, live weight, half-cleaned weight, leg muscle weight and leg muscle rate) of the Tibetan chicken.

[0013] Based on the new finding and the SNP site, the present application provides a method for rapidly detecting the SNP site and screening the economic traits of the Tibetan chicken. The method is simple, convenient, fast, low in cost and reliable in result. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 For PLS3 the sequencing peak graph of the gene at position 28469 A > G; Figure 2 For PLS3 the enzyme cutting electrophoresis result graph of the gene at position 28469 A > G. DETAILED DESCRIPTION

[0015] The present application first finds that the A / G mutation of the gene at position 28469 of the Tibetan chicken PLS3The A / G mutation of the gene at the 28469th position (in an intron region) is closely related to the presence or absence of the BstZ17 I enzyme cutting site of the gene, and is closely related to the main economic traits (breast width, live weight, half-cleaned weight, leg muscle weight and leg muscle rate) of the Tibetan chicken.

[0016] If the site is not mutated, the genotype is AA, and there is no BstZ17 I enzyme cutting site on both strands, and the main economic traits (breast width, live weight, half-cleaned weight, leg muscle weight and leg muscle rate) of the Tibetan chicken are moderate.

[0017] If the site is mutated to genotype AG, one strand forms a BstZ17 I enzyme cutting site, and the main economic traits (breast width, live weight, half-cleaned weight, leg muscle weight and leg muscle rate) of the Tibetan chicken are decreased compared with AA genotype.

[0018] If the site is mutated to genotype GG, both strands have BstZ17 I enzyme cutting sites, and the main economic traits (breast width, leg muscle weight and leg muscle rate) of the Tibetan chicken are significantly increased compared with AA genotype.

[0019] Based on the new discovery, the application provides a primer pair for rapidly detecting the Tibetan chicken, which is based on the SNP site, i.e., the SNP site of the Tibetan chicken PLS3 The 28469th position of the gene is designed to accurately amplify the DNA fragment containing the SNP site.

[0020] Optionally, the primer pair comprises: The upstream primer is 5'-TGGGGTGGCTTTTTGTCAGT-3' (SEQ NO ID: 1). The downstream primer is 5'-CAGGGGGAAGGAAGGCAAAT-3' (SEQ NO ID: 2). The application also provides a method for rapidly detecting the Tibetan chicken by using the primer pair: PCR amplifying the partial gene fragment of the Tibetan chicken PLS3 The partial gene fragment (preferably amplifying the region from the 28297th position to the 28809th position, and the total length of the amplified fragment is 531 bp), after Sanger sequencing and analyzing the results of the PCR amplified DNA fragment product, using the restriction enzyme BstZ17 I to cut the PCR amplification product, and then performing agarose gel electrophoresis. According to the results of agarose gel electrophoresis, the genotype of the SNP site of the gene at the 28469th position is identified. PLS3 The genotype of the SNP site of the gene at the 28469th position.

[0021] If the result is that both strands can be cut by BstZ17 I, it is identified PLS3Genotype of gene at position 28469 is GG, and the Tibetan chicken with excellent economic traits is identified; if the result is that one strand can be cut by BstZ17 I enzyme, then the Tibetan chicken with poor economic traits is identified PLS3 Genotype of gene at position 28469 is AG, and the Tibetan chicken with poor economic traits is identified; if the result is that both strands cannot be cut by BstZ17 I enzyme, then the Tibetan chicken with ordinary economic traits is identified PLS3 Genotype of gene at position 28469 is AA, and the Tibetan chicken with ordinary economic traits is identified.

[0022] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. If not specifically indicated, the technical means used in the embodiments are conventional means familiar to those skilled in the art, and the obtained data are all average values obtained after at least 3 repetitions, and the data obtained in each repetition are all valid data.

[0023] Embodiment one: Tibetan chicken PLS3 Gene DNA sequence amplification and SNP detection 1. Tibetan chicken sample collection: In this embodiment, 3 strains of Tibetan chicken populations are collected as detection objects, and the specific collection conditions are shown in Table 1.

[0024] Table 1 Collection of Tibetan chicken samples

[0025] 2. DNA extraction, purity detection and construction of DNA pool of Tibetan chicken blood samples The high-efficiency animal genomic DNA extraction kit of Beijing Chengke Biotechnology Co., Ltd. is used to extract the DNA of 180 Tibetan chicken blood samples according to the method in the instruction manual. The nucleic acid concentration and OD 260 / 280 value of the DNA sample are determined. If the OD 260 / 280 value is in the range of 1.8-2.0, it indicates that the purity of the DNA sample is relatively high, and the subsequent experiment can be carried out.

[0026] The 180 qualified DNA samples are diluted to a concentration of 50 ng / μL by adding dd H2O, and 10 samples are randomly selected from each strain, and a total of 30 samples are obtained. In the above 30 samples, 15 μL is taken from each sample and placed in a 1.5 mL centrifuge tube to construct a DNA mixed pool. After vortex mixing, it is stored at -20℃ for standby.

[0027] 3. Primer design According to the chicken PLS3The DNA sequence of the gene (NC_052535.1) is a reference sequence (https: / / www.ncbi.nlm.nih.gov / nuccore / NC_052535.1?report=genbank&from=2906836&to=2951321), and the primer pair XP3 is designed using Primer 5.0, and the sequences are as follows: Upstream primer: 5'- TGGGGTGGCTTTTTGTCAGT -3' (SEQ NO ID: 1); Downstream primer: 5'- CAGGGGGAAGGAAGGCAAAT -3' (SEQ NO ID: 2).

[0028] The primer sequence is located in the second intron region of the Tibetan chicken PLS3 gene.

[0029] 4. PCR amplification and sequencing Gradient temperature (57℃, 58℃, 59℃, 60℃, 61℃, 62℃) was used for PCR amplification of the DNA mixed pool sample, and the PCR reaction system is shown in Table 2, and the PCR reaction program is shown in Table 3.

[0030] Table 2 PCR reaction system

[0031] Table 3 PCR reaction program

[0032] The PCR amplification product was subjected to agarose gel electrophoresis, and the most single and bright temperature band PCR amplification product was selected according to the electrophoresis band results, and was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for Sanger sequencing. The results are shown in Figure 1 . The sequencing peak chart detection found that the AG double peak in Figure 1 , the SNP site is located at position 28469 of the Tibetan chicken PLS3 gene. Figure 1 The boxed part is the mutation site at position 28469.

[0033] Example Two: PCR-RFLP detection of SNP site of Tibetan chicken PLS3 gene and analysis of population genetics index 1. PCR-RFLP detection of SNP site PCR amplification: 180 DNA samples were amplified by PCR with the temperature of 56℃, and the PCR reaction system and PCR reaction procedure were the same as in Example 1. The amplified products were subjected to 2% agarose gel electrophoresis. The results showed that 180 samples could clearly see 513bp bands on the electrophoretogram, proving that the primer XP3 could amplify the target fragment containing the SNP site.

[0034] PCR-RFLP detection: the PCR amplification products of 180 samples were respectively digested with restriction enzyme BstZ17 I at 37℃ for 1h, and then subjected to 3% agarose gel electrophoresis. The enzyme digestion system is shown in Table 4.

[0035] Table 4 Enzyme digestion system

[0036] The electrophoresis conditions were voltage 90V electrophoresis for 40min, and after the different sizes of DNA fragments were separated clearly, the gel imaging instrument was used to take pictures for analysis, and the genotype of each sample was recorded. The results are shown in Table 5. Figure 2

[0037] Figure 2 In the table, lane 7 is Marker I, and the 6 bands from bottom to top are 100bp, 200bp, 300bp, 400bp, 500bp and 600bp. The results show that the band type can clearly distinguish the three genotypes (AA, GG, AG), 108 for AA genotype, 3 for GG genotype, and 69 for AG genotype.

[0038] 2、 PLS3 Analysis of population genetics index of gene 28469 A > G site The definitions and formulas used in the analysis of population genetics index are as follows: (1) Genotype frequency: refers to the proportion of the number of individuals of a certain genotype in a population to the total number of individuals.

[0039] (2) Allele frequency: refers to the proportion of the number of a certain allele on a specific chromosome to the total number of alleles at the locus in a population, which aims to reflect the diversity of genes in the population, and the proportion ranges from 0 to 1.

[0040] (3) Genetic homozygosity: refers to the degree of combination of alleles at a specific gene site on a chromosome in a population. The calculation formula is as follows: , ​n represents the number of alleles, i represents i alleles, and Pi represents the frequency of alleles.

[0041] (4) Genetic heterozygosity: refers to the proportion of heterozygous genotypes at a specific genetic locus of a chromosome in a population. The calculation formula is as follows: , n represents the number of alleles, i represents i alleles, and Pi represents the frequency of alleles.

[0042] (5) Effective allele number: refers to the number of alleles required to produce the same homozygosity as the actual population in an ideal state, which is actually the inverse of genetic homozygosity. The calculation formula is as follows: , n represents the number of alleles, i represents i alleles, and Pi represents the frequency of alleles.

[0043] (6) Polymorphic information content: refers to an important marker for evaluating the genetic polymorphism of a population, reflecting the degree of polymorphism at a locus. Genetic markers can provide a measure of information content in linkage analysis. The calculation formula is as follows: , where n represents the number of alleles, i and j represent i alleles and j alleles, respectively, and Pi and Pj represent the frequencies of the i th and j th alleles, respectively.

[0044] (7) Genetic effect analysis of SNPs sites: use Excel software to perform preliminary statistics on the data, and analyze the genetic diversity of each SNPs site. Subsequently, use the general linear model in SPSS software to perform association analysis of genotypes and growth traits and slaughter traits of each SNPs site. The linear model used is: ,

[0045] where Yijk represents the phenotypic value of growth traits and slaughter traits; u represents the population mean of growth traits and slaughter traits; Ai represents the i th strain (i = 1, 2, 3); Bj represents the gender effect (j = 1, 2, representing male and female, respectively); Ck represents the genotype effect of the k th (k corresponds to the genotype of each site); Dijk represents the random residual effect.

[0046] Tibetan chicken PLS3 The genetic indicators of the 28469 G>A site of the gene are shown in Table 5. Among them, PIC>0.5 is highly polymorphic, 0.25 2H is the coefficient of Hardy-Weinberg equilibrium test; the number in the bracket represents the number of genotypes.

[0047] Table 5 Tibetan chicken PLS3 Genetic index of the 28469 A > G locus

[0048] 3. Tibetan chicken PLS3 Association analysis of the 28469 A > G locus and economic traits The main economic traits of Tibetan chicken were measured, including chest width, live weight, half-cleaned weight, leg muscle weight and leg muscle rate. SPSS software was used for single factor analysis of variance PLS3 Association analysis of the 28469 A > G locus genotype and economic traits of Tibetan chicken PLS3 The association analysis of the 28469 A > G locus genotype and economic traits of Tibetan chicken is shown in Table 6. In the same trait, different letters represent the significance of difference; abc represents P < 0.05.

[0049] Table 6 Tibetan chicken PLS3 Association analysis of the 28469 G > A locus genotype and economic traits of Tibetan chicken

[0050] As can be seen from Table 6, the 28469 A > G locus of Tibetan chicken PLS3 The 28469 A > G locus is significantly related to economic traits, and there are significant differences in chest width, live weight, half-cleaned weight, leg muscle weight and leg muscle rate among the three genotypes of Tibetan chicken. The GG genotype significantly improves the chest width, live weight, half-cleaned weight, leg muscle weight and leg muscle rate of Tibetan chicken, indicating that PLS3 The mutation of the 28469 A > G locus can be used as a candidate molecular marker for improving the economic traits of Tibetan chicken.

[0051] The above-described embodiments are only preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications, variations, modifications and replacements of the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A SNP molecular marker affecting the traits of Tibetan chickens, characterized in that: The SNP molecular marker is located in Tibetan chickens. PLS3 At the 28469th base of the gene, the mutated base is either G or A.

2. The SNP molecular marker affecting Tibetan chicken traits according to claim 1, characterized in that: The genotype of the SNP molecular marker is any one of GG, AA, or AG.

3. The application of the SNP molecular marker described in claim 1 or 2 in the detection of economic traits of Tibetan chickens or in the breeding of Tibetan chickens.

4. A kit, test strip, or detection reagent containing the SNP molecular marker as described in claim 1 or 2.

5. The kit, test strip, or detection reagent according to claim 4, characterized in that: The kit, test strip, or detection reagent shall include at least a specific primer pair for amplifying the SNP molecular marker.

6. The kit, test strip, or detection reagent according to claim 5, characterized in that: The primer pair includes: an upstream primer as shown in SEQ ID NO: 1; and a downstream primer as shown in SEQ ID NO:

2.

7. The use of the kit, test strip, or test reagent according to any one of claims 4 to 6 in detecting Tibetan chicken traits.

8. The application according to claim 7, characterized in that: Includes the following steps: (1) Obtain blood from the Tibetan chicken to be tested; (2) Extracting genomic DNA from blood; (3) Perform PCR amplification on genomic DNA to obtain PCR amplification products; (4) The PCR amplification products were digested with enzymes, electrophoresed and analyzed to determine the genotype of the SNP molecular marker in the Tibetan chicken to be tested.

9. A method for rapid identification of the SNP molecular marker as described in claim 1 or 2, characterized in that: The method includes the following steps: (1) PCR amplification of Tibetan chicken PLS3 Gene; (2) Determine whether the obtained PCR amplification product can be restricted by restriction endonucleases. BstZ17 I Enzyme digestion; if both strands can be digested BstZ17 I Enzyme digestion then identifies it as... PLS3 The genotype at position 28469 of the gene is GG; if neither strand can be... BstZ17 I Enzyme digestion then identifies it as... PLS3 The genotype at position 28469 of the gene is AA; if only one strand can be... BstZ17 I Enzyme digestion then identifies it as... PLS3 The genotype at position 28469 of the gene is AG.

10. A method for rapidly determining the economic traits of Tibetan chickens using the SNP molecular markers described in claim 1 or 2, characterized in that: The method includes the following steps: (1) PCR amplification of Tibetan chicken PLS3 Gene; (2) Determine whether the obtained PCR amplification product can be restricted by restriction endonucleases. BstZ17 I Enzyme digestion; if the result is that both strands can be digested... BstZ17 I Enzyme digestion is used for identification. PLS3 The genotype at position 28469 of the gene is GG; if the result is that one strand can be... BstZ17 I Enzyme digestion is used for identification. PLS3 The genotype at position 28469 of the gene is AG; if the result is that neither strand can be... BstZ17 I Enzyme digestion is used for identification. PLS3 The genotype at position 28469 of the gene is AA; Identification PLS3 The economic traits of Tibetan chickens with genotype GG at gene position 28469 are superior to those with genotype AA, and the economic traits of Tibetan chickens with genotype AA are superior to those with genotype AG.

Citation Information

Patent Citations

  • Method for detecting economic traits of Tibetan chicken by FOXO1 gene SNP (Single Nucleotide Polymorphism) marker and application of method

    CN112899376A

  • Application of chicken TRIM13 gene SNP molecular marker in chicken growth and slaughter character improvement breeding and breeding method

    CN114150071A

  • FBXO32 gene SNP (Single Nucleotide Polymorphism) marker for rapidly detecting economic traits of Tibetan chicken, detection method and application

    CN120866540A

Cited By

  • Molecular marker related to hen pitch length character and detection reagent and application thereof

    CN121780725A