Molecular marker closely linked with soybean bottom pod height QTL qFPH12 and application thereof

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked with soybean bottom pod height QTL qFPH12 and application. A bottom pod height QTL qFPH12 is identified on the 12th chromosome of the soybean by using whole genome association analysis, the remarkably associated SNP of the QTL qFPH12 is located at the 5th, 514th and 017th bases of the 12th chromosome of a reference genome Glycinemaxv2.1, and 1.04%-2.21% of phenotypic variation can be explained. The PARMS marker developed by the SNP is used for detecting 256 soybean varieties, the typing is clear, the operation is simple and convenient, and the PARMS marker is suitable for soybean bottom pod polymer breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to a molecular marker closely linked to QTLqFPH12 in soybean bottom pods and its application. Background Technology

[0002] Soybean (Glycine max L.) is an important dual-purpose crop for grain and oil, providing high-quality plant protein for human food and animal feed. Improving soybean yield has always been one of the core goals of soybean production. Currently, while mechanized harvesting technology has significantly improved soybean harvesting efficiency, the high loss rate during harvesting also limits the actual yield per unit area. This makes breeding high-yielding and high-quality soybean varieties suitable for mechanized harvesting a pressing challenge in the breeding field. First pod height (FPH) is a key indicator for assessing the suitability of soybean varieties for mechanized harvesting, and its value directly affects harvest quality. If the first pod is too low, mechanical operations can easily lead to the lower part of the plant being accidentally cut off or missed, resulting in total yield loss. Moreover, a low first pod height can cause the bottom pods to rot, reducing the yield per soybean plant. Therefore, identifying key genetic loci that regulate first pod height is of significant practical importance for advancing high-yield soybean breeding.

[0003] Studies have shown that the height of the bottom pod is regulated by a combination of factors, exhibiting a positive correlation with yield while also being influenced by environmental conditions such as planting density and sowing date. Branching characteristics, in particular, have a greater impact than environmental factors. From a genetic perspective, the height of the soybean bottom pod is controlled by multiple genes working synergistically, making it difficult to precisely locate relevant loci using traditional genetic analysis methods. Previous studies have primarily used recombinant inbred line (RIL) populations for QTL (quantitative trait locus) analysis. For example, Liang Huizhen et al. constructed genetic maps based on SSR molecular markers and used mixed linear modeling (MLM) to detect major agronomic traits in 447 RIL populations, identifying five QTLs associated with pod height. Yuan Baoqi et al. constructed genetic maps from 138 RIL populations and identified three related QTLs using complete interval mapping (ICIM). Cheng Chunguang et al. used composite interval mapping (CIM) to study RIL populations, identifying 11 major-effect QTLs on six linkage groups. Jiang et al. analyzed bottom pod height data from 147 recombinant inbred lines over eight consecutive years using CIM, identifying 11 related QTLs on five chromosomes. Identifying bottom pod height QTLs with stable genetic backgrounds, significant effects, and broad applicability, and developing corresponding high-throughput molecular markers, is of great significance for promoting ideal soybean plant architecture breeding.

[0004] This invention is based on an associated population constructed from 768 core soybean germplasm resources from home and abroad. Combining population genotype data and bottom pod height phenotype data, genome-wide association analysis was used to identify a major QTL locus qFPH12 that regulates the variation of soybean bottom pod height. A PARMS marker closely linked to it was also developed, which can be used to assist in soybean plant type breeding. Summary of the Invention

[0005] The purpose of this invention is to provide a reagent for detecting bases at positions 5,514,017 on soybean chromosome 12 and its application in high-selection breeding of soybean bottom pods.

[0006] Another object of the present invention is to provide the application of a reagent for detecting bases at positions 5,514,017 of soybean chromosome 12 in the preparation of a high screening kit for soybean bottom pods.

[0007] The final objective of this invention is to provide a high-screening breeding method for soybean bottom pods.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] Obtaining a molecular marker tightly linked to the high QTL qFPH12 in soybean basal pods:

[0010] (1) Population Construction and Phenotypic Identification: 768 soybean accessions with broad genetic diversity from 23 provinces in my country were selected as core resources to construct soybean-related populations. They were planted at the Chongqing Academy of Agricultural Sciences Baishiyi Base (2023CQ) in 2023 and the Anhui Academy of Agricultural Sciences Hefei Experimental Base (2024HF) in 2024. The field trials employed a randomized block design with three replicates. Planting was done in two rows, with 20 plants per family per row, 2m long and 0.5m apart. After maturity, the bottom pod height of 10 plants per row was examined, and the average of the three replicates for each environment was taken as the phenotypic value for that environment.

[0011] (2) Genotyping analysis: Using the BGI T7 sequencing platform, whole-genome resequencing was performed on 768 materials from the associated population. Genotyping was performed on the 768 materials using resequencing technology. The average sequencing depth was ~20×, and SNPs with a deletion rate >10% and a minimum allele frequency <0.05 were filtered out. Finally, 6,339,330 high-quality SNPs were retained for whole-genome association analysis.

[0012] (3) Genome-wide association analysis: Association analysis was performed using a mixed linear model (MLM) in GEMMAX software, with a significance threshold set at P ≤ 1 / n (n being the number of SNPs, 6,339,330). A stable associated QTL locus, qFPH12, was found on chromosome 12, showing significant association in both the 2023CQ and 2024HF environments, explaining 1.04%–2.21% of the phenotypic variation. Its peak SNP marker was named S12_5514017, located at nucleotide 45,310,798 on chromosome 12 of the soybean genome reference genome Glycine_max_v2.1, with an allele of C / T. In both the 2023CQ and 2024HF environments, materials containing the high-bottom-pod high allele had an average bottom-pod height 76.81%–293.10% higher than materials containing the low-bottom-pod high allele.

[0013] (4) PARMS marker development: Specific primers were designed based on the upstream and downstream sequences of the S12_5514017 site to construct a PARMS detection system. The primer sequences are as follows:

[0014] PARMS12:CGCCCTAACAACATTGCAAT,

[0015] PARMS12P1: GAAGGTGACCAAGTTCATGCTCTGACCTGGAATAAGCTTGGT, and PARMS12P2: GAAGGTCGGAGTCAACGGATTCTGACCTGGAATAAGCTTGGC.

[0016] The scope of protection of this invention includes:

[0017] Application of reagents for detecting the genotype of soybean chromosome 12 at positions 5,514,017 in the breeding of high-yield soybean bottom pods.

[0018] Application of reagents for detecting bases at positions 5,514,017 on soybean chromosome 12 in the preparation of a high-screening kit for soybean bottom pods.

[0019] In the above-described applications, if the base at position 5,514,017 of soybean chromosome 10 is detected to be T, then the soybean is determined to be a high-bottom-pod, high-type material.

[0020] In the above-described applications, if the base at position 5,514,017 of soybean chromosome 10 is detected to be C, then the soybean is determined to be a short-bottomed, tall-pod type.

[0021] In the above applications, the preferred reagent is a primer.

[0022] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by the present invention: PARMS12: CGCCCTAACAACATTGCAAT, PARMS12P1: GAAGGTGACCAAGTTCATGCTCTGACCTGGAATAAGCTTGGT and PARMS12P2: GAAGGTCGGAGTCAACGGATTCTGACCTGGAATA AGCTTGGC.

[0023] A high-selection breeding method for soybean bottom pods includes detecting bases at positions 5,514,017 of soybean chromosome 12 using conventional methods in the art. These conventional methods include, but are not limited to, sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry.

[0024] The version number of the soybean reference genome used in this invention is Glycine_max_v2.1, and the URL is https: / / ensembl.gramene.org / Glycine_max / .

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The QTL qFPH12 identified in this invention is stably expressed under two environmental conditions and can explain 1.04%-2.21% of the high phenotypic variation in bottom pods, and has high breeding application value.

[0027] (2) The developed PARMS markers are easy to operate, low in cost, and have clear typing, making them suitable for high-throughput screening of large-scale breeding populations. Detailed Implementation

[0028] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The version number of the soybean reference genome used in this invention is Glycine_max_v2.1, and the URL is https: / / ensembl.gramene.org / Glycine_max / .

[0029] Example 1:

[0030] SNP molecular markers significantly associated with high QTL qFPH12 in soybean bottom pods:

[0031] Test materials: 768 soybean accessions with broad genetic diversity from 23 provinces in my country were used as core resources to construct a soybean-related population.

[0032] (1) Identification of bottom pod height in soybean populations: Soybeans were planted at the Baishiyi Base of Chongqing Academy of Agricultural Sciences (2023CQ) in 2023 and the Hefei Experimental Base of Anhui Academy of Agricultural Sciences (2024HF) in 2024. The field trial adopted a randomized block design with three replicates. The plants were planted in two rows, with 20 plants per family per row, 2m long and 0.5m apart. After maturity, the bottom pod height of 10 plants per row was examined, and the average of the three replicates under each environment was taken as the phenotypic value of the material under that environment.

[0033] (2) Genotyping analysis: Using the BGI T7 sequencing platform, whole-genome resequencing was performed on 768 materials from the associated population. Genotyping was performed on the 768 materials using resequencing technology. The average sequencing depth was ~20×, and SNPs with a deletion rate >10% and a minimum allele frequency <0.05 were filtered out. Finally, 6,339,330 high-quality SNPs were retained for whole-genome association analysis.

[0034] (3) Genome-wide association analysis: Combining population genotype and phenotypic data, the mixed linear model (MLM) in GEMMAX software was used for association analysis, with the significance threshold set to P≤1 / n (n is the number of SNPs, 6339330).

[0035] (4) Obtaining qFPH12 and its significantly associated SNP markers: Association analysis results showed that a stable associated QTL site qFPH12 was found on chromosome 12, which was significantly associated in both environments and could explain 1.04%-2.21% of the phenotypic variation (Table 1). Its peak SNP marker was named S12_5514017, located at 45310798 bases on chromosome 12 of the soybean Glycine_max_v2.1 reference genome, with an allele of C / T and a flanking sequence of: 5'-ATATCTTCCCGAGTTTTTTAGCGGCTCACCCTGACCTGGAATAAGCTTGG[C / T]AGTAGGATCCATTGCAATGTTGTTAGGGCGACAATCAAGCATACTTGTCT-3'. In both environments, the average bottom pod height of materials containing the high-bottom-pod high allele was 76.81%-293.10% higher than that of materials containing the low-bottom-pod high allele.

[0036] Table 1 qFPH12 and its associated SNP markers

[0037]

[0038] Example 2:

[0039] Development of a PARMS marker highly tightly linked to soybean basal pods:

[0040] Based on the nucleotide sequences preceding and following the peak SNP marker S12_5514017, which is significantly associated with qFPH12, the PARMS marker detection primer sequences were obtained according to primer design principles as follows:

[0041] PARMS12:CGCCCTAACAACATTGCAAT,

[0042] PARMS12P1: GAAGGTGACCAAGTTCATGCT CTGACCTGGAATAAGCTTGGT, PARMS12P2: GAAGG TCGGAGTCAACGGATT CTGACCTGGAATAAGCTTGGC.

[0043] The underlined part is the fluorescent connector.

[0044] The method for detecting the genotype of the soybean qFPH12 locus using the above PARMS primer set is as follows:

[0045] (1) Extract genomic DNA from the soybeans to be tested.

[0046] (2) Preparation of the reaction system. The reaction system consisted of 5 μL, including 2.5 μL of 2×PARMS PCR reaction mix (a product of Wuhan Jingtai Biotechnology Co., Ltd.), aqueous solutions of primers PARMS12, PARMS12P1, and PARMS12P2, DNA, and water. In the reaction system, the concentrations of primers PARMS12P1 and PARMS12P2 were both 150 nM, and the concentration of primer PARMS12 was 400 nM.

[0047] (3) Add 5 μL of paraffin oil to the reaction system (to prevent sample evaporation), and then perform PCR amplification.

[0048] The reaction program was as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, decreasing by 0.8℃ per cycle until reaching 57℃, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 32 cycles.

[0049] (4) After completing step (3), the signal is read on the TECAN Infinite M1000 and then the following judgment is made: if blue is displayed, the corresponding soybean is or is suspected to be a tall bottom pod tall soybean; if green is displayed, the corresponding soybean is or is suspected to be a short bottom pod tall soybean.

[0050] Using the primers described above, the sequence amplified from the high-pod, high-quality material Shiyan Shanzi Ban soybean (a local soybean variety collected from Shiyan City, Hubei Province, and one of the 768 materials in Example 1) is as follows:

[0051] 5'-CTGACCTGGAATAAGCTTGG T AGTAGGATCCATTGCAATGTTGTTAGGGCG-3'

[0052] The amplification product sequence of the short-bottomed, tall material Jiyu 166 is:

[0053] 5'-CTGACCTGGAATAAGCTTGG C AGTAGGATCCATTGCAATGTTGTTAGGGCG-3'.

[0054] Example 3:

[0055] Universality of PARMS markers in selection for soybean bottom pod height:

[0056] The PARMS primer set designed in Example 2 was used to detect the genotype and genetic effect of the qFPH12 locus in the soybean to be tested. 256 soybean varieties (lines) from both domestic and international sources were used for the test. Field identification was conducted in 2024 at the Baishiyi Base of the Chongqing Academy of Agricultural Sciences (2024CQ) according to the method used in Example 1, and the height of the bottom pod was also examined.

[0057] The results showed that among the 256 soybean materials, 22 had the TT genotype, with an average bottom pod height of 28.67 cm; and 234 had the CC genotype, with an average bottom pod height of 12.56 cm. The difference in bottom pod height between the TT and CC genotypes was highly significant (P-value = 2.76e-24). This result indicates that the qFPH12 locus is segregated in the 256 domestic and international soybean materials and has a stable and reliable genetic effect.

[0058] The above results indicate that the prepared PARMS molecular marker qFPH12 has a significant genetic effect on the bottom pod height of soybean and has a good screening effect.

Claims

1. Application of reagents for detecting bases at positions 5,514,017 on soybean chromosome 12 in high-selection breeding of soybean bottom pods.

2. Application of reagents for detecting bases at positions 5,514,017 on soybean chromosome 12 in the preparation of a high-screening kit for soybean bottom pods.

3. The application according to claim 1 or 2, characterized in that: If the reagent detects that the base at position 5,514,017 of chromosome 12 of soybean is T, then the soybean is determined to be a high-bottom-pod high-type material.

4. The application according to claim 1 or 2, characterized in that: If the reagent detects that the base at position 5,514,017 of chromosome 12 of soybean is C, then the soybean is determined to be a short-bottomed, tall-pod type.

5. The application according to claim 1 or 2, characterized in that: The reagent is a primer.

6. The application according to claim 5, characterized in that: The primers are PARMS12:CGCCCTAACAACATTGCAAT, PARMS12P1:GAAGGTGACCAAGTTCATGCTCTGACCTGGAATAAGCTTGGT and PARMS12P2:GAAGGTCGGAGTCAACGGATTCTGACCTGGAATAAGCTTGGC.

7. A high-selection breeding method for soybean bottom pods, comprising detecting the genotype of the 5,514,017th base of soybean chromosome 12, wherein the method comprises sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry method.

Images