Constitutive promoter and use thereof

Abstract

The invention provides a constitutive promoter and application thereof, the nucleotide sequence of the constitutive promoter comprises SEQ ID NO: 8, and the constitutive promoter is derived from SEQ ID NO: 1. The constitutive promoter almost shows activity in most tissues and many types of cells of the plant, and particularly has wide application prospects in roots, stems, leaves, flowers, pod peels and fruits of the plant.

Description

TECHNICAL FIELD

[0001] The present application relates to a constitutive promoter and its use, in particular to a constitutive promoter from cotton Ubiquitin gene and its use. BACKGROUND

[0002] One of the goals of plant genetic engineering is to produce plants with desirable characteristics or traits for agriculture, and the commonly desired traits include improving nutritional quality, increasing yield, conferring disease and pest resistance, improving drought and stress tolerance, improving horticultural quality, and conferring herbicide resistance, etc. Current technological advances have enabled researchers to obtain exogenous polynucleotide molecules (e.g. heterologous or naturally derived genes) and integrate the polynucleotide molecules into the plant genome, and the gene is expressed in plant cells to exhibit the corresponding traits. It is important that appropriate regulatory signals must be present in the appropriate structure to obtain the expression of the coding sequence of the newly inserted gene in plant cells. These regulatory signals typically include the promoter region, the 5' untranslated leader sequence, and the 3' transcription terminator / polyadenylation sequence.

[0003] Certain promoters are capable of directing RNA synthesis at a certain level of expression in most or all tissues and / or growth and development stages of plants, and these promoters are referred to as "constitutive promoters". Constitutive promoters can be divided into strong, medium and weak promoters according to their effect on directing RNA synthesis. Since in many cases it is necessary to express the target gene in different tissues of plants at the same time to obtain the desired gene function, constitutive promoters are particularly advantageous in the above-mentioned cases.

[0004] Some constitutive promoters that function in plant cells have been described in the prior art, including the promoter of the soybean cell elongation factor gene Gm17gTsf1, the nopaline synthase (nos) promoter carried on the tumor-inducing plasmid of Agrobacterium tumefaciens, the octopine synthase (ocs) promoter, and the cauliflower mosaic virus (caulimovirus) promoters, such as the cauliflower mosaic virus (CaMV) 19S or 35S promoter, the CaMV 35S promoter with repeated enhancers, and the figwort mosaic virus (FMV) 35S promoter, which have been applied in plant constructs for transgenic expression. Although some constitutive promoters have been obtained so far, there is still great interest in isolating more novel constitutive promoters that can control the expression of recombinant DNA constructs (or genes) at different levels, and be applied in gene stacking for the expression of multiple genes in the same transgenic plants. SUMMARY

[0005] The present application aims to provide a new constitutive promoter and use thereof, which can enable efficient expression of a heterologous nucleotide sequence in plant tissues.

[0006] To achieve the above-mentioned object, the present application provides a constitutive promoter, the nucleotide sequence of which comprises SEQ ID NO: 8, and the constitutive promoter is derived from SEQ ID NO: 1.

[0007] Further, the present application provides a constitutive promoter, the nucleotide sequence of which comprises SEQ ID NO: 8 and is selected from at least a part of SEQ ID NO: 1.

[0008] Further, the present application provides a constitutive promoter, the nucleotide sequence of which is shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8.

[0009] To achieve the above-mentioned object, the present application further provides a recombinant DNA construct comprising the above-mentioned constitutive promoter operably linked to a heterologous nucleotide sequence of interest.

[0010] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0011] To achieve the above-mentioned object, the present application further provides an expression cassette comprising the above-mentioned recombinant DNA construct.

[0012] To achieve the above-mentioned object, the present application further provides a recombinant vector comprising the above-mentioned expression cassette.

[0013] To achieve the above-mentioned object, the present application further provides a method for expressing a heterologous nucleotide sequence of interest in a plant, comprising: stably integrating the heterologous nucleotide sequence of interest operably linked to the above-mentioned constitutive promoter into a plant cell.

[0014] Further, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0015] Preferably, the heterologous nucleotide sequence of interest is expressed constitutively in plant tissues.

[0016] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0017] Preferably, the heterologous nucleotide sequence of interest encodes a herbicide-tolerance protein.

[0018] Preferably, the heterologous nucleotide sequence of interest encodes an insect resistance protein.

[0019] To achieve the above object, the present application further provides a plant or part comprising the above constitutive promoter.

[0020] To achieve the above object, the present application further provides a method for obtaining processed agricultural products, comprising processing the harvest of the above plant or part to obtain processed agricultural products.

[0021] To achieve the above object, the present application further provides a use of the above constitutive promoter for constitutive expression of a heterologous nucleotide sequence of interest in plant tissues.

[0022] Preferably, the plant is Arabidopsis thaliana, Brassica, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0023] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0024] In the present application, the term "comprising" or "including" means "including but not limited to".

[0025] In the present application, the term "promoter" means a DNA regulatory region, usually containing a TATA box that is capable of directing RNA polymerase II to initiate RNA synthesis at an appropriate transcription initiation site of a particular coding sequence. In the present application, the term "gene" means any DNA segment that, through steps of transcription and translation, contains a region of DNA ("transcribed DNA region") that is transcribed into an RNA molecule (e.g., mRNA) in a cell under the control of appropriate regulatory regions (e.g., a plant expressible promoter region). Thus, a gene can contain several operably linked DNA segments, such as a promoter, a 5' untranslated leader sequence, a coding region, and a 3' untranslated region containing a polyadenylation site. An endogenous plant gene is a gene that is naturally found in a plant species. A recombinant DNA construct is any gene that is not normally found in a plant species, or any gene whose promoter is not associated in nature with some or all of the transcribed DNA region or with at least another regulatory region of the gene.

[0026] The term "constitutive promoter" in the present invention refers to a special class of gene regulatory sequences. Under the control of this class of promoters, a certain degree of gene expression is exhibited by most or all tissues and / or growth and development stages of an organism. Constitutive promoters are used to express operably linked genes, heterologous nucleotide sequences of interest or gene editing system guide RNAs (gRNAs) in most cells of an organism, with a certain degree of persistence in the initiated expression. It is understood that for the term "constitutive promoter", there can be some variation in the absolute level of expression or activity between different tissues and developmental stages of an organism. The tissues are structural units in a plant body, which are formed by the aggregation of one or more types of cells with the same origin and performing the same function, such as protective tissue, transport tissue, nutritive tissue, mechanical tissue, meristem, several different tissues organically cooperate and closely contact to form different organs, and different organs cooperate with each other to more effectively complete the entire life activity process of the organism. The growth and development stages can be divided into embryonic stage, seedling stage, mature stage and senescence stage according to the differences in plant morphology and function.

[0027] The term "constitutive expression" in the present invention refers to the relatively stable and persistent expression of a gene or heterologous nucleotide sequence of interest in most or all tissues and / or growth and development stages of a plant, for example, the cauliflower mosaic virus CaMV 35S promoter, which can initiate high-intensity expression of foreign genes in most organs and different development periods in plants; constitutive promoters can also ensure the widespread expression of gRNAs in host cells, improving the efficiency and accuracy of gene editing. Isolated sequences having promoter activity and hybridizing to the promoter sequences of the present invention or fragments thereof under stringent conditions are included in the present invention. These sequences are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the sequences of the present invention. That is, the range of sequence identity is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0028] The present application provides a constitutive promoter whose nucleotide sequence comprises SEQ ID NO: 8 and is selected from at least a portion of SEQ ID NO: 1. SEQ ID NO: 8 is a fragment of SEQ ID NO: 1. With reference to SEQ ID NO: 1, the constitutive promoter of the present application can be extended to the 5' end or the 3' end of SEQ ID NO: 8 alone or to both the 5' end and the 3' end of SEQ ID NO: 8, but the length of the nucleotide sequence extended to both ends cannot exceed the 5' end or the 3' end of SEQ ID NO: 1 itself. In other words, the constitutive promoter whose nucleotide sequence is shown as SEQ ID NO: 8, or with reference to SEQ ID NO: 1, the constitutive promoter obtained by extending to either end of SEQ ID NO: 8 arbitrarily and the length of the extension does not exceed the 5' end or the 3' end of SEQ ID NO: 1 itself are within the scope of the present application. Furthermore, for such a constitutive promoter (with reference to SEQ ID NO: 1, the constitutive promoter obtained by extending to either end of SEQ ID NO: 8 arbitrarily and the length of the extension does not exceed the 5' end or the 3' end of SEQ ID NO: 1 itself), the other nucleotide sequence included in the constitutive promoter other than SEQ ID NO: 8 does not affect the activity of the sequence of SEQ ID NO: 8 itself. The second embodiment of the present application also demonstrates that the prGhPU1-08 promoter (SEQ ID NO: 8) has activity, and the prGhPU1-01 promoter (SEQ ID NO: 1), the prGhPU1-02 promoter (SEQ ID NO: 2), the prGhPU1-03 promoter (SEQ ID NO: 3), the prGhPU1-04 promoter (SEQ ID NO: 4), the prGhPU1-05 promoter (SEQ ID NO: 5), the prGhPU1-06 promoter (SEQ ID NO: 6), and the prGhPU1-07 promoter (SEQ ID NO: 7) all have activity. Those skilled in the art can reasonably predict, based on the content described in the present application, that the constitutive promoter whose nucleotide sequence comprises SEQ ID NO: 8 and is selected from at least a portion of SEQ ID NO: 1 all have the same or similar activity as SEQ ID NO: 8.

[0029] The promoter sequences and fragments thereof of the present application, when assembled into a DNA construct to operably link the promoter sequence to a heterologous nucleotide sequence of interest, are used to genetically manipulate any plant. By "operably linked" is meant that the promoter sequence of the present application is functionally connected to a second sequence in which the promoter sequence initiates and modulates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, are in the same reading frame. In this manner, the promoter nucleotide sequence and the heterologous nucleotide sequence of interest are provided together in an expression cassette to be expressed in a plant of interest. The expression cassette provides a number of restriction sites for insertion of the heterologous nucleotide sequence of interest which will be subject to transcriptional regulation by the regulatory regions comprising the promoter sequence of the present application. The expression cassette can additionally contain at least one additional gene to be co-transformed into the organism. Alternatively, the additional gene can be provided on a plurality of expression cassettes.

[0030] The expression cassette can additionally contain a selectable marker gene. Generally, the expression cassette will contain a selectable marker gene for selection of transformed cells. The selectable marker gene is used to select transformed cells or tissues. The selectable marker genes include, but are not limited to, genes encoding antibiotic resistance such as genes encoding neomycin phosphotransferase II (NPT) and hygromycin phosphotransferase (HPT), and genes conferring herbicide resistance such as phosphinothricin, bromoxynil, imidazolinone, and 2,4-dichlorophenoxyacetate (2,4-D) resistance genes.

[0031] The expression cassette includes the promoter sequence of the present application, a translation initiation region, a heterologous nucleotide sequence of interest, and a transcriptional and translational termination region functional in plants, transcribed in the 5'-3' direction. The heterologous nucleotide sequence of interest can be native or foreign or heterologous to the plant host. Alternatively, the heterologous nucleotide sequence of interest can be a native sequence or a selectively synthetic sequence. By "foreign" is meant that the introduced transcriptional initiation region does not exist naturally in the plant into which the transcriptional initiation region is introduced. For example, a recombinant DNA construct comprises a promoter sequence of the present application operably linked to a coding sequence that is different from the promoter sequence of the present application.

[0032] The termination region can be derived from the promoter sequence of the present application, from the operably linked heterologous nucleotide sequence of interest, or from another source. Conventional termination regions can be obtained from the Ti plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase (NOS) termination regions.

[0033] In making the expression cassette, the various DNA fragments can be manipulated to provide the DNA sequences in the proper orientation and, in appropriate combinations, to provide the desired reading frame. In doing so, it can be necessary to employ linkers, adapters, restriction-site engineered sequences, and the like, to generate the necessary restriction sites in the DNA fragments. Methods for these manipulations are well known to those skilled in the art and are described in many references, including Maniatis et al., 1982, Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; Ausubel et al., 1987, Current Protocols in Molecular Biology, John Wiley & Sons, NY; and Sambrook et al., 1989, Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

[0034] In appropriate cases, the heterologous nucleotide sequence of interest can be optimized to increase the amount of expression in the transformed plant. That is, the gene can be synthesized using plant-preferred codons to improve expression.

[0035] It is known in the art that additional sequence modifications can be made to increase the level of gene expression in a cellular host. These include but are not limited to removal of sequences encoding pseudoprolation signals, exon-intron splice site signals, transposon sequences, and other sequences that can be characterized as potentially detrimental to gene expression. The G-C content of the sequences can be adjusted to be at or near average G-C content commonly found in the host cell, calculated from known gene expression levels in the host cell. The sequences can be modified to avoid predicted hairpin mRNA secondary structures.

[0036] In the expression cassette or recombinant vector, the expression cassette can additionally contain a 5' leader sequence. The leader sequence can function to improve the efficiency of transcription. Leader sequences are known in the art and include, but are not limited to, picornavirus leader sequences, such as the EMCV leader (the 5' noncoding region of the encephalomyocarditis virus); potyvirus leaders, such as the TEV leader, the MDMV leader, and the human immunoglobulin heavy chain binding protein (BiP); the untranslated leader sequence from the mRNA of the coat protein of alfalfa mosaic virus (AMV RNA 4); the tobacco mosaic virus (TMV) leader; and the maize chlorotic mottle virus (MCMV) leader. Other known elements that improve transcription efficiency, such as introns, can also be used.

[0037] The promoter sequence of the present application can be used to initiate transcription of an antisense construct that is at least partially complementary to the messenger RNA (mRNA) of the heterologous nucleotide sequence of interest. Antisense nucleotide sequences are constructed to hybridize with the corresponding mRNA. The antisense sequence can be modified as long as it is long enough to hybridize with the corresponding mRNA and interfere with its expression. In this manner, an antisense construct having 80%, preferably 90%, more preferably 95% sequence identity with the corresponding antisense sequence can be used. In addition, a portion of the antisense nucleotide sequence can be used to disrupt the expression of the target gene. Generally, a sequence of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or more can be used.

[0038] The promoter sequences of the present application are used for constitutive expression of a heterologous nucleotide sequence of interest. A "heterologous nucleotide sequence" refers to a sequence that does not naturally occur with the promoter sequence. Although the nucleotide sequence is heterologous to the promoter sequence, it can be homologous or native or heterologous or foreign to the plant host. The heterologous nucleotide sequence operably linked to the promoter of the present application can encode a protein of interest. Examples of such heterologous nucleotide sequences include, but are not limited to, nucleotide sequences encoding polypeptides that confer resistance to abiotic stresses such as drought, temperature, salinity, ozone, and herbicides, or biotic stresses such as pathogen attack, including insects, viruses, bacteria, fungi, and nematodes, and prevent disease development associated with these organisms.

[0039] The herbicide tolerance proteins of the present application can express resistance and / or tolerance to herbicides. These genes include, but are not limited to, hydroxyphenylpyruvate dioxygenase (HPPD) genes, protoporphyrinogen oxidase (PPO) genes, acetolactate synthase (ALS) genes, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) genes, phosphinothricin acetyltransferase (PAT) genes, glyphosate oxidoreductase (GOX) genes, GAT genes, and the like.

[0040] In the present application, "insect resistance" refers to the ability of a plant to avoid the symptoms and damage caused by the plant-insect interaction. That is, to prevent or alternatively, to minimize or reduce plant damage, crop damage, plant deformation, and plant disease caused by insects. The insects can belong to the order Lepidoptera (e.g., corn earworm), Hemiptera (e.g., stink bugs), Coleoptera (e.g., beetles), Orthoptera (e.g., grasshoppers), Homoptera (e.g., aphids), Diptera (e.g., flies), and the like. Insect resistance proteins of interest are known in the art and include, but are not limited to, Bacillus thuringiensis toxic proteins; lectins, wherein lectins include snowdrop lectin, pea lectin, concanavalin A, wheat germ agglutinin, potato lectin, peanut lectin, and the like; lipoxygenases, wherein lipoxygenases include pea lipoxygenase 1 or soybean lipoxygenase; insect chitinases, and the like.

[0041] Different pests transmit viruses from infected plants to healthy plants in different ways. The viruses include, but are not limited to, rice tungro bacilliform virus, tobacco mosaic virus, sweet potato feathery mottle virus, and sweet potato chlorotic dwarf virus, and the like. Thus, it can be desirable to constitutively express in plant tissues a heterologous nucleotide sequence that has anti-pathogen activity or that minimizes the effects of a viral pathogen.

[0042] The promoter sequences and methods of the present application can be used to modulate the expression of any heterologous nucleotide sequence of interest in a plant host to alter the phenotype of the plant. Various phenotypic alterations of interest include, but are not limited to, altering the fatty acid composition of the plant, altering the amino acid content of the plant, altering the pathogen defense mechanisms of the plant, and the like. Such alterations can be achieved by providing for the expression of a heterologous product or increasing the expression of an endogenous product of the plant. Alternatively, such alterations can be achieved by decreasing the expression of one or more endogenous products of the plant, particularly enzymes or cofactors. Such alterations will result in a transformed plant having an altered phenotype.

[0043] The transformation protocol and the protocol for introducing the nucleotide sequence into the plant will vary depending on the type of plant or plant cell being transformed, i.e., monocot or dicot. Suitable methods for introducing the nucleotide sequence into the plant cell and subsequently into the plant genome include, but are not limited to, Agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation, or whisker silicon-mediated DNA introduction.

[0044] The transformed cells can be grown into plants in accordance with conventional ways. These plants are crossed with the same transformed strain or different transformed strains, and the progeny are evaluated for expression of the desired phenotypic characteristic. The progeny can be grown and evaluated for a second or more generations to ensure that the expression of the desired phenotypic characteristic is stable and inherited in the desired manner.

[0045] The term "plant" refers to the whole plant, including all plant and plant populations, such as those that occur naturally or by cultivation of plants or plant varieties, including plants that contain one or more imported DNA sequences. The plant can be a plant that has been modified using methods of genetic engineering or by optimized breeding or by combinations of these methods.

[0046] The term "plant part" includes plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or in plant parts such as leaves, pollen, embryos, flowers, seeds, roots, root tips, anthers, and the like. It is understood that plant parts of transgenic plants within the scope of the application include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves and roots, the latter three derived from the transformed plant or its progeny and which have at least one cell that contains a transgene.

[0047] In one aspect, the plant part is a plant cell. In yet another aspect, the plant part is a non-regenerable cell or a regenerable cell. In another aspect, the plant cell is a somatic cell.

[0048] Non-regenerable cells are cells that cannot be regenerated into a whole plant through in vitro culture. Non-regenerable cells can be in a plant or plant part (e.g., a leaf) of the application. Non-regenerable cells can be in a seed or seed coat of the seed. A mature plant organ (including a mature leaf, a mature stem, or a mature root) comprises at least one non-regenerable cell.

[0049] In another aspect, the plant cell is a reproductive cell, such as an ovule or a cell that is part of pollen. In one aspect, the pollen cell is a vegetative (non-reproductive) cell, or a sperm cell.

[0050] The application provides a process for obtaining a processed agricultural product from a harvest of a plant or part comprising the constitutive promoter of the application. The term "processed agricultural product" refers to any composition or product that is comprised of material derived from a plant, seed, plant cell, or plant part comprising the constitutive promoter of the application. In particular, the term "processed agricultural product" includes, but is not limited to, protein concentrate, protein isolate, starch, flour, biomass, and seed oil.

[0051] The application provides a constitutive promoter and uses thereof, with the following advantages:

[0052] 1. The application discloses a constitutive promoter from a cotton Ubiquitin gene, the nucleotide sequence of the constitutive promoter comprises SEQ ID NO: 8, and is derived from SEQ ID NO: 1.

[0053] 2. The constitutive promoter of the application shows activity in almost all tissues and many types of cells of a plant, particularly in the roots, stems, leaves, flowers, pod skins, and fruits of a plant.

[0054] 3. The constitutive promoter of the application can drive constitutive expression of an exogenous gene in plant tissues.

[0055] The technical solutions of the application are described in further detail below with reference to the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0056] Figure 1 Structure diagram of the vector DBNBC-Dual_LUC containing LUC and REN reporter genes of the application;

[0057] Figure 2 Structure diagram of the recombinant expression vector DBN11-G containing the prGhPU1-01 promoter sequence of the application;

[0058] Figure 3 Structure diagram of the vector DBNBC-HTG containing the herbicide-tolerant gene HTG of the application;

[0059] Figure 4 The structure of the recombinant expression vector DBN22-G of the application is shown in the schematic diagram. DETAILED DESCRIPTION

[0060] The technical solutions of the constitutive promoter and the use thereof of the application are further illustrated below through specific examples.

[0061] The first embodiment, obtaining the constitutive promoter of the application

[0062] 1. Obtaining the prGhPU1-01 promoter sequence

[0063] By querying the cotton expression profile database (Cotton Functional Genomic Database, https: / / cottonfgd.org), genes with high abundance expression in root, stem, leaf, flower and other tissues can be retrieved. The 1866bp sequence upstream of the gene Gh_A10G005800 is selected and named as the promoter prGhPU1-01. The cotton variety JM14 genomic DNA sequence is used as the PCR amplification template, and primer 1 and primer 2 are designed for PCR amplification:

[0064] Primer 1: 5'-attaagaattccaaagactccag-3', as shown in SEQ ID NO: 9 in the sequence listing;

[0065] Primer 2: 5'-cttttttggctaaagagaaaatc-3', as shown in SEQ ID NO: 10 in the sequence listing.

[0066] The PCR reaction system is as follows:

[0067]

[0068] The primers comprise 2.5μL of each primer at a concentration of 10uM, and the reaction buffer is the reaction buffer in the New England Company High-Fidelity DNA Polymerase kit. In the above PCR reaction system, supplement with nuclease-free water to 50μL. The specific operation steps are carried out according to the New England Company PCR Using High-Fidelity DNA Polymerase(M0491) kit instructions.

[0069] The PCR reaction conditions are as follows:

[0070]

[0071]

[0072] The PCR amplification product is connected with a blunt end Blunt vector (Cloning Vector of Fullmoon Gold Company, Beijing), and the operation steps are performed according to the Blunt Vector instruction of Fullmoon Gold Company product, and then the connection product is sequenced (Sanger sequencing method), and the prGhPU1-01 promoter sequence is confirmed, as shown in SEQ ID NO: 1 in the sequence table.

[0073] 2, obtain prGhPU1-02, prGhPU1-03, prGhPU1-04, prGhPU1-05 and prGhPU1-06, prGhPU1-07 and prGhPU1-08 promoter sequences

[0074] The prGhPU1-01 gene sequence is used as a PCR amplification template, and the following primer pairs are designed respectively: primer 2 (SEQ ID NO: 10) and primer 3 (SEQ ID NO: 11), primer 2 (SEQ ID NO: 10) and primer 4 (SEQ ID NO: 12), primer 2 (SEQ ID NO: 10) and primer 5 (SEQ ID NO: 13), primer 2 (SEQ ID NO: 10) and primer 6 (SEQ ID NO: 14), primer 2 (SEQ ID NO: 10) and primer 7 (SEQ ID NO: 15), primer 2 (SEQ ID NO: 10) and primer 8 (SEQ ID NO: 16), primer 2 (SEQ ID NO: 10) and primer 9 (SEQ ID NO: 17), and the above-mentioned primer pairs are used for PCR amplification reaction according to the above-mentioned method of obtaining prGhPU1-01 promoter sequence, and prGhPU1-02 promoter sequence (SEQ ID NO: 2), prGhPU1-03 promoter sequence (SEQ ID NO: 3), prGhPU1-04 promoter sequence (SEQ ID NO: 4), prGhPU1-05 promoter sequence (SEQ ID NO: 5), prGhPU1-06 promoter sequence (SEQ ID NO: 6), prGhPU1-07 promoter sequence (SEQ ID NO: 7) and prGhPU1-08 promoter sequence (SEQ ID NO: 8) are obtained in turn.

[0075] 3, synthesis of the above-mentioned prGhPU1-01 to prGhPU1-08 promoter sequences

[0076] The 5' and 3' ends of the above-mentioned prGhPU1-01 promoter sequence, prGhPU1-02 promoter sequence, prGhPU1-03 promoter sequence, prGhPU1-04 promoter sequence, prGhPU1-05 promoter sequence, prGhPU1-06 promoter sequence, prGhPU1-07 promoter sequence, and prGhPU1-08 promoter sequence, and prGm17gTsf1 control promoter sequence (SEQ ID NO: 18), pr35S control promoter sequence (SEQ ID NO: 19), and prAtH4A748:1TEV chimeric control promoter sequence (SEQ ID NO: 20) were respectively connected to universal adapter primer 1:

[0077] 5' end universal adapter primer 1: 5'-ctaaaaccaaaatccagtggactagt-3', as shown in SEQ ID NO: 21 in the sequence listing;

[0078] 3' end universal adapter primer 1: 5'-atgtttttggcgtcttccat-3', as shown in SEQ ID NO: 22 in the sequence listing.

[0079] Second embodiment, verification of the effects of promoter elements driving LUC reporter gene expression in transgenic tobacco

[0080] 1. A dual-luciferase (Dual-Luciferase Reporter) reporter system was introduced, and recombinant expression vectors containing the prGhPU1-01 promoter sequence, recombinant expression vectors containing the prGhPU1-02 promoter sequence, recombinant expression vectors containing the prGhPU1-03 promoter sequence, recombinant expression vectors containing the prGhPU1-04 promoter sequence, recombinant expression vectors containing the prGhPU1-05 promoter sequence, recombinant expression vectors containing the prGhPU1-06 promoter sequence, recombinant expression vectors containing the prGhPU1-07 promoter sequence, and recombinant expression vectors containing the prGhPU1-08 promoter sequence were constructed.

[0081] The construction of vectors using conventional enzyme digestion methods is well known to those skilled in the art. The structure of the vector DBNBC-Dual_LUC (vector backbone: pCAMBIA2301 (available from CAMBIA) with resistance marker modified) containing LUC and REN reporter genes is shown in FIG. 1. Figure 1Spec: spectinomycin gene; RB: right border; prAtAct2: Arabidopsis thaliana Act2 gene promoter (SEQ ID NO: 23); REN: Renilla luciferase gene (SEQ ID NO: 24); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 25); Spel: restriction enzyme Spel recognition site; LUC: firefly luciferase gene (SEQ ID NO: 26); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 27); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 28); spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 29); cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 30); tNos: terminator of nopaline synthase gene (SEQ ID NO: 31); LB: left border).

[0082] The above-mentioned vector DBNBC-Dual_LUC was subjected to a restriction enzyme Spel reaction to linearize the vector DBNBC-Dual_LUC, and the linearized DBNBC-Dual_LUC expression vector was obtained by purifying the cleavage product. The prGhPU1-01 promoter sequence of the universal linker primer 1 was subjected to a recombination reaction with the linearized DBNBC-Dual_LUC expression vector, and the operation steps were performed according to the instruction manual of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949), thereby constructing a recombinant expression vector DBN11-G, the structure of which is schematically shown in Figure 2

[0083] ​The recombinant expression vector DBN11-G is transformed into E. coli DH5a competent cells by heat shock method. The heat shock conditions are as follows: 100 μL of E. coli DH5a competent cells, 20 μL of recombinant plasmid DNA (recombinant expression vector DBN11-G), mix gently, heat shock at 42°C for 30 s, immediately place on ice for 2 min; add 250 μL of antibiotic-free LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, adjust pH to 7.5 with NaOH), incubate at 37°C with shaking (200 rpm / min) for 1 h. Then invert culture at a temperature of 37°C for 12 h on the LB solid plate containing 50 mg / L of spectinomycin, pick positive clone colonies, and incubate at a temperature of 37°C with shaking (200 rpm / min) overnight in LB liquid medium containing 50 mg / L of spectinomycin. Extract the plasmid by alkaline lysis method: centrifuge the bacterial solution at a speed of 12000 rpm for 1 min, remove the supernatant, and suspend the precipitated bacterial cells with 100 μL of ice-precooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); add 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of absolute ethanol, mix, and place at room temperature for 5 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, discard the supernatant, and wash the precipitate with 70% (V / V) ethanol, then air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at a temperature of 37°C for 30 min; and store at -20°C for later use. The extracted plasmid is sequenced and identified. The results show that the recombinant expression vector DBN11-G contains the nucleotide sequence shown in SEQ ID NO: 1 in the sequence table, i.e., the prGhPU1-01 promoter sequence.

[0084] According to the above method of constructing the recombinant expression vector DBN11-G containing the prGhPU1-01 promoter sequence, the prGhPU1-02 promoter sequence connected with the universal adapter primer 1, the prGhPU1-03 promoter sequence connected with the universal adapter primer 1, the prGhPU1-04 promoter sequence connected with the universal adapter primer 1, the prGhPU1-05 promoter sequence connected with the universal adapter primer 1, the prGhPU1-06 promoter sequence connected with the universal adapter primer 1, the prGhPU1-07 promoter sequence connected with the universal adapter primer 1, the prGhPU1-08 promoter sequence connected with the universal adapter primer 1, the prGm17gTsf1 control promoter sequence connected with the universal adapter primer 1, the pr35S control promoter sequence connected with the universal adapter primer 1, and the prAtH4A748:ITEV chimeric control promoter sequence connected with the universal adapter primer 1 are respectively recombined with the linearized DBNBC-Dual_LUC expression vector to sequentially obtain the recombinant expression vectors DBN12-G to DBN21-G, and the correct insertion of the above nucleotide sequences in the recombinant expression vectors DBN12-G to DBN21-G is verified by sequencing.

[0085] 2. Transformation of Agrobacterium with recombinant expression vectors

[0086] The correctly constructed recombinant expression vectors DBN11-G to DBN21-G are respectively transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA; Cat. No: 18313-015) by the liquid nitrogen method, and the transformation conditions are as follows: 100 μL of Agrobacterium LBA4404, 3 μL of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, and then placed in a 37°C water bath for 10 min; the transformed Agrobacterium LBA4404 is inoculated into an LB test tube and cultured at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, and then spread on an LB solid plate containing 50 mg / L of rifampicin and 50 mg / L of spectinomycin until positive monoclonal colonies are grown, and the monoclonal colonies are cultured and the plasmid is extracted, and the extracted plasmid is identified by sequencing, and the results show that the structures of the recombinant expression vectors DBN11-G to DBN21-G are completely correct.

[0087] 3. Transient transformation of tobacco leaves

[0088] Tobacco leaves are high-efficiency protein expression bioreactors, and foreign genes are introduced into tobacco leaves by the Agrobacterium injection infiltration method for expression, and high-throughput protein expression is used to verify the effect of the constitutive promoter of the application.

[0089] The tobacco leaf transformation method is as follows:

[0090] Step 1, planting tobacco, cultivating tobacco under the condition of 14h light / 10h darkness, temperature 25℃, relative humidity 70% for 4-5 weeks, harvesting tobacco leaves;

[0091] Step 2, picking the Agrobacterium strains transformed with recombinant expression vectors DBN11-G, DBN12-G, DBN13-G, DBN14-G, DBN15-G, DBN16-G, DBN17-G, DBN18-G, DBN19-G, DBN20-G and DBN21-G respectively in part 2 of this example, and cloning them in 1 mL of LB liquid medium (10 g / L of tryptone, 10 g / L of yeast extract, 5 g / L of NaCl, 50 mg / mL of rifampicin, 50 mg / mL of spectinomycin, 10 mg / mL of tetracycline) containing antibiotics, and culturing them at 28℃ with shaking (200 rpm) until the Agrobacterium grows to the logarithmic phase (OD 600 = 0.5-0.6), taking 1 mL of the logarithmic phase Agrobacterium liquid and transferring it to 20 mL of LB liquid medium (10 g / L of tryptone, 10 g / L of yeast extract, 5 g / L of NaCl, 50 mg / mL of rifampicin, 50 mg / mL of spectinomycin, 10 mg / mL of tetracycline) containing antibiotics, and culturing them at 28℃ with shaking (200 rpm) until the Agrobacterium grows to the logarithmic phase (OD 600 = 0.5-0.6), centrifuging them at room temperature at a speed of 5000 rpm for 10 min, collecting the bacterial cells, and suspending the Agrobacterium cells in infiltration liquid (containing 10 mM MgCl2, 10 mM MES, 150 uM acetyl-syringone, pH = 5.6) to OD 600 = 0.8, and letting them stand at room temperature for 2-3 h, to obtain Agrobacterium liquid for injection transformed with recombinant expression vectors DBN11-G to DBN21-G respectively;

[0092] Step 3, a small hole is gently punctured on the back of the tobacco leaf obtained in Step 1 of the example with a 1 mL needle (note that the hole should not be punctured through), and then the needle tube without the needle is used to suck the Agrobacterium liquid containing the recombinant expression vector DBN11-G to DBN21-G for injection, and the recombinant expression vector DBN11-G to DBN21-G is injected into the tobacco leaf through the small hole of the tobacco leaf, so that the T-DNA (including one of the prAtAct2 promoter sequence, the REN gene sequence, the t35s terminator sequence, the prGhPU1-01 promoter sequence, the prGhPU1-02 promoter sequence, the prGhPU1-03 promoter sequence, the prGhPU1-04 promoter sequence, the prGhPU1-05 promoter sequence, the prGhPU1-06 promoter sequence, the prGhPU1-07 promoter sequence, the prGhPU1-08 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:1TEV chimeric control promoter sequence, the LUC gene sequence, the tPsE9 terminator sequence, the prAtUbi10 promoter sequence, the spAtCTP2 nucleotide sequence, the cEPSPS gene sequence, and the tNos terminator sequence) in the recombinant expression vector DBN11-G to DBN21-G is transferred into the tobacco leaf; and a wild type tobacco leaf (CK1) is used as a control. The water-stained area of the tobacco leaf is marked with a marker pen;

[0093] Step 4, the tobacco leaf injected in Step 3 of the example and the wild type tobacco leaf are placed in the dark for 12 h, and then are cultured in a constant temperature incubator at 21℃ for 2 days, the marked area of the tobacco leaf is cut off, and three same quality tobacco leaves marked area into which the recombinant expression vector DBN11-G to DBN21-G is transferred and the wild type tobacco leaf are taken as biological repeats, are frozen with liquid nitrogen, and then 1×Passive lysis buffer (PLB) buffer is added, centrifuged at 12000 rpm for 10 min at 4℃, and the supernatant is taken for standby.

[0094] 4, Effect detection of the constitutive promoter of the application on driving LUC reporter gene expression in a tobacco leaf

[0095] Step 5, 100 μL of the supernatant in Step 4 is added to an enzyme-labeled plate, and three repeats are set, 100 μL of 1×Luciferase Reaction Buffer LAR II (freeze-dried powder luciferase assay substrate is dissolved in luciferase assay buffer II (Promega Company, Dual-Glo®Luciferase Assay Kit, Cat#E2980) is added, and the plate is incubated at 21℃ for 10 min. Step 6, add 100 μL 1x Renilla Luciferase Reaction Stop & Glo (obtained by dissolving 200 μL of Stop & Glo Substrate (50x) in 10 mL of Stop & Glo buffer, and stored in -80°C in the dark), shake plate mixing, and use the enzyme marker BioTek-H1MF to detect the Renilla luciferase activity value, and the detection is completed within 30 min, and the unit of the detected Renilla luciferase (REN) activity value is RLU (relative light unit).

[0096] Step 6, add 100 μL 1x Renilla Luciferase Reaction Stop & Glo (obtained by dissolving 200 μL of Stop & Glo Substrate (50x) in 10 mL of Stop & Glo buffer, and stored in -80°C in the dark), shake plate mixing, and use the enzyme marker BioTek-H1MF to detect the Renilla luciferase activity value, and the detection is completed within 30 min, and the unit of the detected Renilla luciferase (REN) activity value is RLU (relative light unit).

[0097] In order to eliminate the group error caused by different transformation efficiencies of plant tissues due to infection of Agrobacterium and other factors, the REN gene is used as an internal reference, and the high and low ratio of LUC / REN reflects the relative activity strength of the promoter (LUC / REN ratio = (LUC value of tobacco leaves into which different recombinant expression vectors are transformed - LUC value of wild type tobacco leaves) / (REN value of tobacco leaves into which different recombinant expression vectors are transformed - REN value of wild type tobacco leaves)), and the test results of LUC and REN enzyme activity detection of the transiently transformed tobacco leaves are shown in Table 1.

[0098] Table 1, LUC and REN enzyme activity values and LUC / REN ratio in transiently transformed tobacco leaves

[0099]

[0100]

[0101] The results of Table 1 show that: (1) the promoters prGhPU1-01, prGhPU1-02, prGhPU1-03 and prGhPU1-04, prGhPU1-05, prGhPU1-06, prGhPU1-07 and prGhPU1-08 universally have activity, and can drive LUC gene expression in tobacco leaves; (2) compared with the pr35S and prAtH4A748:lTEV control promoters, prGhPU1-01, prGhPU1-02 and prGhPU1-04 have higher activity in driving LUC gene expression in tobacco leaves.

[0102] Third embodiment, verification of the effect of the promoter element driving LUC reporter gene expression in transgenic Arabidopsis

[0103] 1. Transformation of Agrobacterium with the recombinant expression vector

[0104] The correctly constructed recombinant expression vectors DBN11-G, DBN19-G to DBN21-G of part 1 of the above second embodiment were transformed into Agrobacterium GV3101 by liquid nitrogen method, the transformation conditions were: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, 37°C water bath for 10 min; the transformed Agrobacterium GV3101 was inoculated in LB test tube at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, and then coated on the LB solid plate containing 50 mg / L of Rifampicin and 50 mg / L of Spectinomycin until positive monoclonal colonies were grown, the monoclonal colonies were picked and cultured, and the plasmid was extracted, and the extracted plasmid was sequenced and identified, the results showed that the structure of the recombinant expression vectors DBN11-G, DBN19-G to DBN21-G was completely correct.

[0105] 2. Obtaining of transgenic Arabidopsis plant

[0106] Wild-type Arabidopsis seeds were suspended in 0.1% (w / v) agarose solution. The suspended seeds were stored at 4°C for 2 days to complete the need for dormancy to ensure synchronous germination of the seeds. Vermiculite mixed with horse manure soil and irrigated with water at the bottom to wet, the soil mixture was drained for 24 h. The pretreated seeds were planted on the soil mixture and covered with a humidity cover for 7 days. The seeds were germinated and the plants were cultured in a greenhouse under long-day conditions (16 h light / 8 h dark) with constant temperature (22°C) and constant humidity (40-50%) and light intensity of 120-150 μmol / m 2 s -1 The plants were initially irrigated with Hoagland's nutrient solution, and then irrigated with deionized water, keeping the soil moist but not wet.

[0107] Flower dip method was used to transform Arabidopsis. One or more 15-30 mL pre-cultures of LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.5 adjusted with NaOH) containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated with selected Agrobacterium colonies. The pre-cultures were incubated overnight at 28°C with constant shaking at 220 rpm. Each pre-culture was used to inoculate two 500 mL cultures of the LB broth containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) and the cultures were incubated overnight at 28°C with constant shaking. The cells were pelleted by centrifugation at room temperature for 20 min at approximately 4000 rpm and the resulting supernatant was discarded. The cell pellet was gently resuspended in 500 mL of osmotic medium containing ½ x MS salts / B5 vitamins, 10% (w / v) sucrose, 0.044 μΜ benzylaminopurine (10 μL / L (1 mg / mL stock in DMSO)), and 300 μL / L Silwet L-77. Approximately 1 month old Arabidopsis plants were dipped in the osmotic medium with resuspended cells for 5 min, ensuring that the newest inflorescences were submerged. The Arabidopsis plants were then laid on their sides and covered, and were kept moist in the dark for 24 h. The plants were then grown normally under a 16 h light / 8 h dark photoperiod at 22°C. Seeds were harvested approximately 4 weeks later.

[0108] Newly harvested (containing prGhPU1-01 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, prAtH4A748:1TEV chimeric control promoter sequence) T1 seeds were dried at room temperature for 7 days. Seeds were sown in 26.5 cm x 51 cm germination trays, with each tray receiving 200 mg of T1 seeds (approximately 10,000 seeds), which had been previously suspended in distilled water and stored at 4°C for 2 days to complete the need for dormancy to ensure synchronized germination of the seeds.

[0109] The vermiculite was mixed with horse manure and bottom watered to moist with gravity drainage. The pretreated seeds were evenly sown on the soil mixture using a pipette and covered with a humidity dome for 4-5 days. The dome was removed 1 day prior to initial transformant selection using post-emergence spraying of glyphosate (selecting for the co-transformed EPSPS gene).

[0110] T1 plants (cotyledon stage and 2-4 leaf stage, respectively) were sprayed with a 0.5% solution of Roundup herbicide (glyphosate at 356 g ae / L) using a DeVilbiss compressed air nozzle at a spray volume of 10 mL / plate (703 L / ha) at 7 days after planting (DAP) and again at 11 DAP to provide an effective amount of 420 g ae / ha of glyphosate per application. Surviving plants (actively growing plants) were identified 4-7 days after the last spray and transplanted into 7 cm x 7 cm square pots prepared with horse manure and vermiculite (2-4 plants per pot). Transplanted plants were covered with a humidity dome for 3-4 days and placed in a temperature 22°C growth chamber or directly into the greenhouse as before. The dome was then removed and plants were transplanted into the greenhouse (temperature 22 ± 5°C, 50 ± 30% RH, 14 h light: 10 h dark, minimum 500 μE / m2s natural + supplemental light) at least 1 day before testing the effect of the promoter element driving the LUC reporter gene. 2 -1 The effect of the constitutive promoter of the present application on driving LUC reporter gene expression in different tissues of Arabidopsis was tested.

[0111] 3、The effect of the constitutive promoter of the present application on driving LUC reporter gene expression in different tissues of Arabidopsis was tested.

[0112] T1 transformants were selected from the untransformed seed background using the glyphosate selection scheme. The T1 Arabidopsis plants of Part 2 of this example into which the prGhPUl-01 promoter sequence was introduced, the T1 Arabidopsis plants into which the prGml7gTsf1 control promoter sequence was introduced, the T1 Arabidopsis plants into which the pr35S control promoter sequence was introduced and the T1 Arabidopsis plants into which the prAtH4A748:1TEV chimeric control promoter sequence was introduced were sampled at different times in different parts of the above T1 Arabidopsis plants, respectively, as test samples:

[0113] At the rosette stage, 3 parts were sampled as test samples: root, stem and leaf;

[0114] At the bolting stage, 4 parts were sampled as test samples: root, stem, leaf and flower;

[0115] At the mature stage, 4 parts were sampled as test samples: root, stem, leaf and pod.

[0116] Wild type Arabidopsis (CK2) at the same growth stage and in the same part were sampled as negative control samples.

[0117] ​Three same quality of the test samples of different periods and different parts of the wild type Arabidopsis thaliana plant and the negative control sample of the same period and same part of the wild type Arabidopsis thaliana plant were taken as biological repeats, frozen with liquid nitrogen, grinded, then 1xPLB buffer was added, centrifuged at 4℃, 12000rpm for 10min, and the supernatant was taken for standby.

[0118] The test samples and the negative control samples were detected for the activity of double luciferase according to the method of step 5 and step 6 in the second embodiment 4, taking REN gene as the internal reference, and the ratio of LUC / REN reflected the relative activity strength of the promoter (the ratio of LUC / REN=(the LUC value of the test sample of different periods and different parts of the wild type Arabidopsis thaliana plant) / (the LUC value of the wild type Arabidopsis thaliana plant of the same period and same part)). The ratio of LUC / REN of the stably transformed Arabidopsis thaliana of different periods and different parts was shown in Table 2.

[0119] Table 2, the ratio of LUC / REN of the stably transformed Arabidopsis thaliana of different periods and different parts

[0120]

[0121] The results of Table 2 showed that: (1) the promoter prGhPU1-01 of the application existed activity, which expressed in the roots, stems, leaves, flowers and pods of the Arabidopsis thaliana plant, indicating that the promoter prGhPU1-01 could drive the constitutive expression of the heterologous gene in the plant.

[0122] (2) in the leaves of the Arabidopsis thaliana plant in the bolting stage and the pods in the mature stage, the activity of prGhPU1-01 driving the expression of LUC gene was higher compared with the prGm17gTsf1, pr35S and prAtH4A748:lTEV control promoters.

[0123] (3) in the stems and roots of the Arabidopsis thaliana plant and the flowers in the bolting stage, the activity of prGhPU1-01 driving the expression of LUC gene was higher compared with the prAtH4A748:lTEV control promoter.

[0124] Fourth embodiment, verification of the effect of the promoter element driving the expression of LUC reporter gene in transgenic soybean

[0125] 1、Recombinant expression vector transformed Agrobacterium

[0126] The correctly constructed recombinant expression vectors DBN11-G, DBN19-G to DBN21-G were transformed into Agrobacterium EHA101 by liquid nitrogen method, and the transformation conditions were as follows: 100 μL Agrobacterium EHA101, 3 μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, and then placed in 37°C water bath for 10 min; the transformed Agrobacterium EHA101 was inoculated into LB test tube, and incubated at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, then coated on the LB solid plate containing 50 mg / L of Rifampicin and 50 mg / L of Spectinomycin until positive monoclonal colonies were grown, and the monoclonal colonies were picked and cultured, and the plasmid was extracted, and the extracted plasmid was sequenced and identified, and the results showed that the structure of the recombinant expression vectors DBN11-G, DBN19-G to DBN21-G was completely correct.

[0127] 2. Obtaining of transgenic soybean plants

[0128] According to the commonly used Agrobacterium infection method, the cotyledon node tissue of the aseptic culture soybean variety SY2043C was co-cultured with the Agrobacterium described in Part 1 of the present embodiment, so as to introduce the T-DNA (including prAtAct2 promoter sequence, REN gene sequence, t35s terminator sequence, one selected from prGhPU1-01 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence and prAtH4A748: lTEV chimeric control promoter sequence, LUC gene sequence, tPsE9 terminator sequence, prAtUbi10 promoter sequence, spAtCTP2 nucleotide sequence, cEPSPS gene sequence and tNos terminator sequence) in the above-described recombinant expression vectors DBN11-G, DBN19-G to DBN21-G into the soybean chromosome, and the soybean plants into which the prGhPU1-01 promoter sequence was introduced, the soybean plants into which the prGm17gTsf1 control promoter sequence was introduced, the soybean plants into which the pr35S control promoter sequence was introduced, and the soybean plants into which the prAtH4A748: lTEV chimeric control promoter sequence were obtained.

[0129] For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds are germinated in soybean germination medium (3.1 g / L B5 salts, B5 vitamins, 20 g / L sucrose, 8 g / L agar, pH 5.6). The seeds are inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1 °C; photoperiod (light / dark) 16 / 8 h. One day after germination, one cotyledon and the first true leaf are removed and inoculated onto a pretreatment medium containing cytokinin (4.3 g / L MS salts, B5 vitamins, 20 g / L sucrose, 8 g / L agar, 4 g / L 2-(N-morpholino)ethanesulfonic acid (MES), 2 mg / L zeatin (ZT), 1 mg / L 6-benzyladenine (6-BAP), 40 mg / L acetosyringone (AS), pH = 5.3). Three days after inoculation onto the pretreatment medium, the cotyledon node is wounded with the back of a scalpel, and the wounded cotyledon node tissue is contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the prGhPU1-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence to the wounded cotyledon node tissue (Step 1: infection step). In this step, the cotyledon node tissue is preferably immersed in the Agrobacterium suspension (OD 660= 0.5-0.8, in infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3) to initiate inoculation. The cotyledonary node tissue is co-cultivated with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6) after the infection step. Following this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, pH 5.6) is provided with at least one antibiotic (cefotaxime 150-250 mg / L) known to inhibit the growth of Agrobacterium, without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the cotyledonary node regenerated tissue pieces are cultured on medium containing the selection agent (glyphosate) and growing transformed callus is selected (step 4: selection step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on selection solid medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, 6-benzylaminopurine (6-BAP) 1 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6) with the selection agent, resulting in the selective growth of transformed cells. The transformed cells are then regenerated into plants (step 5: regeneration step), preferably, the cotyledonary node regenerated tissue pieces grown on medium with the selection agent are cultured on solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0130] The resistant tissue pieces obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6) and cultured to differentiate at 25°C. The small seedlings differentiated are transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured to about 10 cm high at 25°C and then moved to a greenhouse for cultivation to seed.

[0131] 3. Verification of transgenic soybean plants by TaqMan

[0132] About 100 mg of leaves of the soybean plants into which the prGhPU1-01 promoter sequence is introduced, the soybean plants into which the prGm17gTsf1 control promoter sequence is introduced, the soybean plants into which the pr35S control promoter sequence is introduced and the soybean plants into which the prAtH4A748:lTEV chimeric control promoter sequence is introduced are taken as samples, and the genomic DNA is extracted by using the DNeasy Plant Maxi Kit of Qiagen. The copy number of the EPSPS gene is detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of the prGhPU1-01, prGm17gTsf1, pr35S and prAtH4A748:lTEV genes. At the same time, wild-type soybean plants are used as controls, and the detection and analysis are performed according to the following method. The experiment is set in triplicate, and the average value is taken.

[0133] The specific method for detecting the copy number of the EPSPS gene is as follows:

[0134] Step 6: About 100 mg of leaves of the soybean plants into which the prGhPU1-01 promoter sequence is introduced, the soybean plants into which the prGm17gTsf1 control promoter sequence is introduced, the soybean plants into which the pr35S control promoter sequence is introduced, the soybean plants into which the prAtH4A748:lTEV chimeric control promoter sequence is introduced and wild-type soybean plants are taken, respectively, and are ground into homogenate in a mortar by using liquid nitrogen. Three replicates are taken for each sample.

[0135] Step 7: The genomic DNA of the above samples is extracted by using the DNeasy Plant Mini Kit of Qiagen, and the specific method is referred to the product manual.

[0136] Step 8, the genomic DNA concentration of the above sample was determined by NanoDrop 2000 (Thermo Scientific);

[0137] Step 9, the genomic DNA concentration of the above sample was adjusted to the same concentration value, which was in the range of 80-100 ng / μL;

[0138] Step 10, the copy number of the sample was identified by Taqman probe fluorescence quantitative PCR method, the sample with identified known copy number was used as a standard, and the sample of wild type soybean plant was used as a control, each sample was repeated for 3 times, and the average value was taken; the fluorescence quantitative PCR primer and probe sequences were as follows:

[0139] The following primer and probe were used to detect the EPSPS gene sequence:

[0140] Primer 1: ggtgtgcaggtgaagtctgaag as shown in SEQ ID NO: 32 in the sequence listing;

[0141] Primer 2: gtctttggtccacgcaaggt as shown in SEQ ID NO: 33 in the sequence listing;

[0142] Probe 1: cggtgatcgtcttccagt as shown in SEQ ID NO: 34 in the sequence listing;

[0143] The PCR reaction system was as follows:

[0144]

[0145] The 50x primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration and 860 μL of 1x TE buffer, and was stored in amber test tubes at 4°C.

[0146] The PCR reaction conditions were as follows:

[0147]

[0148] The data was analyzed by SDS2.3 software (Applied Biosystems).

[0149] The results of the analysis of the EPSPS gene copy number further confirm that the prGhPU1-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence have been integrated into the genome of the soybean plants tested, and that the soybean plants transformed with the prGhPU1-01 promoter sequence, the soybean plants transformed with the prGm17gTsf1 control promoter sequence, the soybean plants transformed with the pr35S control promoter sequence, and the soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence all obtained single copy transgenic soybean plants.

[0150] 4. Detection of the effect of the constitutive promoter of the present application on the expression of LUC reporter gene in each tissue of soybean

[0151] The soybean plants transformed with the prGhPU1-01 promoter sequence, the soybean plants transformed with the prGm17gTsf1 control promoter sequence, the soybean plants transformed with the pr35S control promoter sequence, and the soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence in Part 3 of this example were sampled at different periods and different parts of the above transgenic soybean plants to obtain test samples:

[0152] At the vegetative growth period (V3 stage), 3 parts were sampled as test samples: roots, stems, and leaves;

[0153] At the reproductive growth period, 6 parts were sampled as test samples: roots, stems, leaves, flowers, pod skins, and fruits;

[0154] Wild-type soybean plants (CK3) at the same growth period and the same part were sampled as negative control samples.

[0155] The test samples at different periods and different parts and the negative control samples (3 replicates of the same mass were sampled from each part of each strain at each period) of wild-type soybean plants (CK3) at the same period and the same part were frozen in liquid nitrogen and ground, then 1xPLB buffer was added, centrifuged at 4°C and 12000 rpm for 10 min, and the supernatant was collected for use.

[0156] The test samples and the negative control samples were subjected to dual luciferase detection according to the method of Step 5 and Step 6 in the second embodiment 4, with REN gene as the internal reference, and the LUC / REN ratio reflecting the relative activity strength of the promoter (the definition of LUC / REN ratio is the same as that of LUC / REN ratio in Table 2 in the third embodiment above). The LUC / REN ratio of the stably transformed soybean at different periods and different parts is shown in Table 3.

[0157] Table 3: LUC / REN ratio of different parts of stable transformed soybean at different periods

[0158]

[0159]

[0160] The results of Table 3 show that: (1) the promoter prGhPU1-01 of the application can express in roots, stems, leaves, flowers, pod skins and fruits of soybean plants, indicating that the promoter prGhPU1-01 can drive the constitutive expression of a heterologous gene of interest in plants; (2) in the leaves of the vegetative growth period of soybean, the activity of prGhPU1-01 driving LUC gene expression is higher than that of the prAtH4A748:lTEV control promoter; (3) in the leaves, stems, flowers and roots of the reproductive growth period of soybean, the activity of prGhPU1-01 driving LUC gene expression is higher than that of the prAtH4A748:lTEV control promoter.

[0161] Fifth embodiment: detection of herbicide resistance effect of transgenic Arabidopsis thaliana plants

[0162] 1. Construct a recombinant expression vector of prGhPU1-01 driving herbicide-tolerant gene HTG.

[0163] The 5' and 3' ends of the prGhPU1-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence and the prAtH4A748:lTEV chimeric control promoter sequence are respectively connected to the universal adapter primer 2:

[0164] 5' end universal adapter primer 2: 5'-cacgtgaccctagtcacttaaagcttggcgcgcc-3', as shown in SEQ ID NO: 35 in the sequence listing;

[0165] 3' end universal adapter primer 2: 5'-cagtagctggtgttggaggcat-3', as shown in SEQ ID NO: 36 in the sequence listing.

[0166] The construction of vectors using conventional enzyme digestion methods is well known to those skilled in the art. The structure of the vector DBNBC-HTG (vector backbone: pCAMBIA2301 (CAMBIA Company) with resistance label modified) containing the herbicide-tolerant gene HTG is shown in Figure 1. Figure 3Spec: spectinomycin gene; RB: right border; Ascl: restriction enzyme Ascl recognition site; HTG: hydroxyphenylpyruvate dioxygenase gene (SEQ ID NO: 37); t35s: cauliflower virus 35s terminator (SEQ ID NO: 25); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 28); spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 29); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 30); tNos: terminator of nopaline synthase gene (SEQ ID NO: 31); LB: left border).

[0167] The above vector DBNBC-HTG was subjected to a restriction enzyme Ascl reaction to linearize the vector DBNBC-HTG, and the linearized DBNBC-HTG expression vector was obtained by purifying the enzyme reaction product. The prGhPU1-01 promoter sequence of the universal linker primer 2 was recombined with the linearized DBNBC-HTG expression vector, and the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949), to construct a recombination expression vector DBN22-G, the structure of which is shown in Figure 4

[0168] ​The recombinant expression vector DBN22-G is transformed into E. coli DH5a competent cells by heat shock method. The heat shock conditions are as follows: 100 μL of E. coli DH5a competent cells, 20 μL of recombinant plasmid DNA (recombinant expression vector DBN22-G), mix gently, heat shock at 42°C for 30 s, immediately place on ice for 2 min; add 250 μL of antibiotic-free LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, adjust pH to 7.5 with NaOH), incubate at 37°C with shaking (200 rpm / min) for 1 h. Then invert culture at a temperature of 37°C for 12 h on the LB solid plate containing 50 mg / L of spectinomycin, pick positive clone colonies, and incubate at a temperature of 37°C with shaking (200 rpm / min) overnight in LB liquid medium containing 50 mg / L of spectinomycin. Extract the plasmid by alkaline lysis method: centrifuge the bacterial solution at a speed of 12000 rpm for 1 min, remove the supernatant, and suspend the precipitated bacterial cells with 100 μL of ice-precooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); add 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of absolute ethanol, mix, and place at room temperature for 5 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, discard the supernatant, and wash the precipitate with 70% (V / V) ethanol, then air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at a temperature of 37°C for 30 min; and store at -20°C for later use. The extracted plasmid is sequenced and identified. The results show that the recombinant expression vector DBN22-G contains the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing, i.e., the prGhPU1-01 promoter sequence.

[0169] According to the method for constructing the recombinant expression vector DBN22-G containing the prGhPU1-01 promoter sequence described above, the prGm17gTsf1 control promoter sequence connected with the universal adapter primer 2, the pr35S control promoter sequence connected with the universal adapter primer 2 and the prAtH4A748:lTEV chimeric control promoter sequence connected with the universal adapter primer 2 are respectively subjected to recombination reactions with the linearized DBNBC-HTG expression vector to sequentially obtain recombinant expression vectors DBN23-G to DBN25-G, and the correct insertion of the above nucleotide sequences in the recombinant expression vectors DBN23-G to DBN25-G is verified by sequencing.

[0170] 2. Transformation of Agrobacterium with the recombinant expression vector

[0171] According to the method for transforming Agrobacterium with the recombinant expression vector in part 1 of the third embodiment, the correctly constructed recombinant expression vectors DBN22-G to DBN25-G are respectively transformed into Agrobacterium GV3101 by the liquid nitrogen method, and the results of sequencing verification show that the structures of the recombinant expression vectors DBN22-G to DBN25-G are completely correct.

[0172] 3. Detection of the herbicide resistance effect of the herbicide-resistant gene HTG driven by the promoter in the transgenic Arabidopsis thaliana plant

[0173] According to the method in part 2 of the third embodiment, the inflorescences of Arabidopsis thaliana are soaked in the Agrobacterium bacterial solution in part 2 of the embodiment to transfer the T-DNA in the recombinant expression vectors DBN22-G to DBN25-G constructed in part 2 of the embodiment into the chromosomes of Arabidopsis thaliana, and the corresponding transgenic Arabidopsis thaliana plants are obtained, i.e., Arabidopsis thaliana T1 plants into which the prGhPU1-01 promoter sequence is transferred, Arabidopsis thaliana T1 plants into which the prGm17gTsf1 control promoter sequence is transferred, Arabidopsis thaliana T1 plants into which the pr35S control promoter sequence is transferred, and Arabidopsis thaliana T1 plants into which the prAtH4A748:lTEV chimeric control promoter sequence is transferred.

[0174] The T1 transformants were selected from the non-transformed seed background using the glyphosate selection scheme. The T1 Arabidopsis plants transformed with the prGhPU1-01 promoter sequence, the T1 Arabidopsis plants transformed with the prGm17gTsf1 control promoter sequence, the T1 Arabidopsis plants transformed with the pr35S control promoter sequence, the T1 Arabidopsis plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence and the wild-type Arabidopsis plants (CK4) (18 days after sowing) were sprayed with topramezone at 4 times the field concentration (100 g ai / ha) to detect the herbicide tolerance of Arabidopsis. After 7 days of spraying, the damage degree of each plant to the herbicide was calculated according to the proportion of leaf whitening area (the proportion of leaf whitening area = the leaf whitening area / the total leaf area x 100%): 0 level for no whitening phenotype, 1 level for the proportion of leaf whitening area less than 50%, 2 level for the proportion of leaf whitening area more than 50%, and 3 level for the proportion of leaf whitening area 100%.

[0175] The resistance of each transformation event of the recombinant expression vector was scored according to the formula X = [∑(N x S) / (T x M)] x 100 (X-phytotoxicity score, N-number of plants with the same damage, S-number of phytotoxicity grades, T-total number of plants, and M-highest phytotoxicity grade), and the resistance was evaluated according to the score: highly resistant plants (0-15), moderately resistant plants (16-33), low resistant plants (34-67), and non-resistant plants (68-100). The experimental results are shown in Table 4.

[0176] Table 4, experimental results of the tolerance of transgenic Arabidopsis T1 plants to topramezone

[0177]

[0178] For Arabidopsis, topramezone at 4 times the field concentration is an effective dose of high pressure treatment. The results in Table 4 show that: (1) compared with CK4, the Arabidopsis plants transformed with the prGhPU1-01 promoter sequence are all tolerant to topramezone at 4 times the field concentration. Therefore, the constitutive promoter prGhPU1-01 of the application can drive the expression of a heterologous gene of interest in plants. (2) Compared with the pr35S and prAtH4A748:lTEV control promoters, the prGhPU1-01 drives the herbicide resistance effect of the herbicide-tolerant gene HTG in transgenic Arabidopsis plants to be better.

[0179] In summary, the constitutive promoter from the cotton Ubiquitin gene is disclosed for the first time. The constitutive promoter of the application shows activity in most tissues and many types of cells of plants, especially in the roots, stems, leaves, flowers, pod skins and fruits of plants, and has a wide application prospect in plants.

[0180] Finally, it should be noted that the above examples are merely used to illustrate the technical solutions of the present application but not to limit the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or equivalent replaced without departing from the spirit and scope of the technical solutions of the present application.

Claims

1. A constitutive promoter comprising, the nucleotide sequence of which comprises SEQ ID NO: 8, and the constitutive promoter is derived from SEQ ID NO:

1.

2. The constitutive promoter of claim 1, wherein, the nucleotide sequence of which comprises SEQ ID NO: 8, and is selected from at least a portion of SEQ ID NO:

1.

3. The constitutive promoter of claim 1 or 2, wherein, the nucleotide sequence of which is set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO:

8.

4. A recombinant DNA construct comprising the constitutive promoter of any one of claims 1-3 operably linked to a heterologous nucleotide sequence of interest.

5. The recombinant DNA construct of claim 4, wherein, the heterologous nucleotide sequence of interest encodes a protein of interest.

6. An expression cassette comprising the recombinant DNA construct of claim 4 or 5.

7. A recombinant vector comprising the expression cassette of claim 6.

8. A method of expressing a heterologous nucleotide sequence of interest in a plant, comprising, comprises: stably integrating into a plant cell a heterologous nucleotide sequence of interest operably linked to the constitutive promoter of any one of claims 1-3.

9. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato, or peanut.

10. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, constitutive expression in plant tissue of the heterologous nucleotide sequence of interest.

11. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, the heterologous nucleotide sequence of interest encodes a protein of interest.

12. The method of expressing a heterologous nucleotide sequence of interest in a plant of claim 11, wherein, the heterologous nucleotide sequence of interest encodes a herbicide tolerance protein.

13. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 11, wherein, the heterologous nucleotide sequence of interest encodes an insect resistance protein.

14. A plant or part, characterized in that, the constitutive promoter of any one of claims 1-3.

15. A method of obtaining processed agricultural products, characterized by, comprises processing a harvest of the plant or part of claim 14 to obtain a processed agricultural product.

16. Use of the constitutive promoter of any one of claims 1-3 for constitutive expression in plant tissue of a heterologous nucleotide sequence of interest.

17. Use of the constitutive promoter according to claim 16 for the constitutive expression of a heterologous nucleotide sequence of interest in plant tissue, characterized in that, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato, or peanut.

18. Use of the constitutive promoter according to claim 16 for the constitutive expression of a heterologous nucleotide sequence of interest in plant tissue, characterized in that, the heterologous nucleotide sequence of interest encodes a protein of interest.

Images