Application of circFAM126A in preparation of medicine for reversing oxaliplatin drug resistance of gastric cancer

Abstract

The invention discloses application of circFAM126A in preparation of a medicine for reversing oxaliplatin resistance of gastric cancer, and belongs to the technical field of molecular biology. According to the application disclosed by the invention, by constructing a lentivirus for targeted interference of novel circFAM126A and transfecting gastric cancer cells, it is proved that the lentivirus carrying a specific interference sequence can stably knock down circFAM126A expression in the gastric cancer cells, the drug resistance of the gastric cancer cells to oxaliplatin is effectively reversed, the tumor cell death effect induced by chemotherapeutic drugs is remarkably enhanced, and the tumor cell death effect is remarkably improved. Meanwhile, the proliferation and clone formation capability of gastric cancer cells is inhibited. Meanwhile, it is found that circFAM126A is highly expressed in oxaliplatin-resistant gastric cancer cells and is in positive correlation with poor prognosis of gastric cancer patients, a detection reagent aiming at circFAM126A can be used for auxiliary diagnosis of gastric cancer prognosis conditions, and the drug resistance degree of the gastric cancer cells to oxaliplatin can be evaluated by detecting the expression level of circFAM126A.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, and particularly relates to application of circFAM126A in preparation of a drug for reversing gastric cancer oxaliplatin drug resistance. BACKGROUND

[0002] The information disclosed in the background of the present application is only intended to increase the understanding of the overall background of the present application and should not necessarily be regarded as acknowledging or implicitly suggesting that this information constitutes prior art known to those of ordinary skill in the art.

[0003] Gastric cancer is one of the most common malignant tumors of the digestive system worldwide, and its high incidence and mortality pose a serious threat to human health. The five-year survival rate of patients is less than 20%, mainly due to the high metastatic properties of tumors and the limitations of existing treatment methods. Currently, the clinical treatment still takes surgical resection combined with adjuvant chemotherapy as the core scheme, and the double-drug combination therapy of fluorouracil and platinum drugs is the basic treatment choice for patients with perioperative, unresectable or metastatic gastric cancer. As the third generation of platinum drugs, oxaliplatin has become the first choice of platinum drugs in current chemotherapy regimens due to its unique mechanism of inhibiting DNA synthesis and replication, and plays an important role in the treatment of gastric cancer. However, the problem of drug resistance to platinum chemotherapy drugs such as oxaliplatin in patients with advanced gastric cancer during treatment is still a key bottleneck that restricts the improvement of treatment effect and leads to poor prognosis, which greatly limits the clinical application value of existing treatment schemes.

[0004] In recent years, as a class of non-coding RNA molecules with stable circular structure, circular RNA (circRNAs) has attracted widespread attention in the regulation of tumor occurrence and development. Studies have shown that it can participate in tumor biological processes through various ways such as adsorbing microRNA, interacting with RNA binding proteins or encoding functional proteins. Although previous studies have suggested that abnormal expression of circular RNA may be related to tumor resistance to oxaliplatin (OXA), in the field of gastric cancer, the specific molecular mechanism of how circular RNA mediates oxaliplatin resistance is still unclear, and relevant research is still in the exploratory stage. There is a lack of effective targets that can be directly applied to clinical transformation, which seriously hinders the in-depth analysis of gastric cancer drug resistance mechanism and the development of new treatment strategies. It is urgent to reveal the key regulatory molecules and their mechanisms through further research, to provide a theoretical basis for breaking through the problem of oxaliplatin resistance and improving the treatment effect of gastric cancer patients. SUMMARY

[0005] Therefore, the application provides application of circFAM126A in preparation of a drug for reversing gastric cancer oxaliplatin drug resistance, and circFAM126A can be used as a treatment target for gastric cancer oxaliplatin drug resistance, and interference with the expression of circFAM126A can significantly inhibit the proliferation and clonogenicity of gastric cancer cells and reverse the cell death effect induced by oxaliplatin, and meanwhile, circFAM126A is highly expressed in gastric cancer cells with oxaliplatin drug resistance and is positively correlated with poor prognosis of gastric cancer patients.

[0006] In a first aspect, the application provides application of circFAM126A in preparation of a drug for reversing gastric cancer oxaliplatin drug resistance, and the nucleotide sequence of circFAM126A is shown as SEQ ID NO. 1.

[0007] In the application, circFAM126A is a 2-10 exon of FAM126A gene on chr7:22999874-23030758, and the full-length circular mature sequence formed by reverse splicing is 1019 nt, and the sequence is as follows (SEQ ID NO. 1):

[0008] Preferably, the drug is an inhibitor of circFAM126A.

[0009] In vivo knockdown of circFAM126A inhibited the proliferation of oxaliplatin-resistant cells and enhanced their sensitivity to oxaliplatin, and partially reversed the oxaliplatin-induced cell death effect; while in vitro knockdown of circFAM126A effectively inhibited the tumorigenicity of oxaliplatin-resistant gastric cancer cells in nude mice and enhanced the sensitivity of resistant cells to oxaliplatin treatment.

[0010] Furthermore, the inhibitor of circFAM126A is a lentiviral vector that interferes with circFAM126A.

[0011] Furthermore, the lentiviral vector contains the circFAM126A shRNA sequence.

[0012] Furthermore, the nucleotide sequence of the circFAM126A shRNA is shown in SEQ ID NO. 2; SEQ ID NO. 2: GACATGGTTGAAGGTTTAGAA.

[0013] In this invention, the shRNA is delivered to oxaliplatin-resistant gastric cancer cells via transfection to effectively inhibit the expression of circFAM126A.

[0014] Secondly, the present invention provides the application of a reagent for detecting circFAM126A in the preparation of a gastric cancer prognostic assessment product; wherein the nucleotide sequence of circFAM126A is shown in SEQ ID NO. 1.

[0015] This invention found that circFAM126A is positively correlated with poor prognosis in gastric cancer patients, and therefore it can be used as a prognostic biomarker for gastric cancer.

[0016] Preferably, the gastric cancer prognostic assessment product includes PCR reagents.

[0017] Furthermore, the PCR reagent contains primers for detecting circFAM126A, the primers being composed of an upstream primer and a downstream primer, the sequence of the upstream primer being shown in SEQ ID NO. 3, and the sequence of the downstream primer being shown in SEQ ID NO. 4.

[0018] F: GAAATCACACCAACTTCCTCTCG (SEQ ID NO. 3); R: ACAACCATTCCTCCACAACCC (SEQ ID NO. 4).

[0019] Thirdly, the present invention provides the application of the reagent for detecting circFAM126A in the preparation of a reagent for detecting the degree of oxaliplatin resistance in gastric cancer cells.

[0020] Preferably, the reagent for detecting the degree of oxaliplatin resistance in gastric cancer cells includes a PCR reagent; the PCR reagent contains primers for detecting circFAM126A, the primers being composed of an upstream primer and a downstream primer, the sequence of the upstream primer being shown in SEQ ID NO. 3, and the sequence of the downstream primer being shown in SEQ ID NO. 4.

[0021] F: GAAATCACACCAACTTCCTCTCG (SEQ ID NO. 3); R: ACAACCATTCCTCCACAACCC (SEQ ID NO. 4).

[0022] Compared with the prior art, the present invention has achieved the following beneficial effects: (1) This invention is the first to discover and clarify circFAM126A as a key regulatory target for oxaliplatin resistance in gastric cancer, providing a novel approach to solving the clinical challenge of oxaliplatin resistance in gastric cancer treatment. This invention constructs a lentivirus that targets and interferes with circFAM126A and transfects it into gastric cancer cells. It has been demonstrated that the lentivirus carrying the specific interfering sequence can stably knock down circFAM126A expression in gastric cancer cells, effectively reversing the resistance of gastric cancer cells to oxaliplatin, significantly enhancing the tumor cell death effect induced by chemotherapy drugs, and inhibiting the proliferation and colony formation ability of gastric cancer cells. This mechanism lays the foundation for the development of highly effective targeted drugs to reverse drug resistance, and is expected to overcome the limitations of existing chemotherapy regimens and improve the treatment response rate of patients with advanced gastric cancer.

[0023] (2) The detection reagent for circFAM126A can not only be used for the auxiliary diagnosis of gastric cancer and provide molecular marker support for early screening of the disease, but also assess the resistance of gastric cancer cells to oxaliplatin by detecting its expression level, providing accurate basis for clinicians to formulate individualized treatment plans, helping to avoid the side effects and waste of medical resources caused by ineffective chemotherapy, and optimizing the treatment strategy. Attached Figure Description

[0024] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments and descriptions of the invention are used to explain the invention and do not constitute an undue limitation thereof. Obviously, those skilled in the art can obtain other drawings based on these drawings without any inventive effort.

[0025] Figure 1 This is a schematic diagram of circFAM126A formed by circularization of exons 2-10 of the FAM126A gene in Example 1 of the present invention, and a schematic diagram of the circFAM126A specific splicing site. Figure 2 This invention provides a comparison of the expression differences of circFAM126A in normal gastric mucosal epithelial cells, gastric cancer cells, and oxaliplatin-resistant gastric cancer cells, as well as a comparison of the expression differences of circFAM126A in gastric cancer cells treated with different concentrations of oxaliplatin. Figure 3 This is to verify the efficiency of circFAM126A knockdown in Embodiment 2 of the present invention; Figure 4 The IC50 results of oxaliplatin-resistant cells with knocked-down circFAM26A in Example 3 of this invention; Figure 5 In Example 3 of this invention, after knocking down circFAM126A in oxaliplatin-resistant gastric cancer cells, its effect on proliferation and apoptosis was detected in vitro. Figure 6 This illustrates the effect of circFAM126A knockdown on tumor growth in vivo in Example 4 of this invention. Tumor images and tumor weights are shown in the figure. Immunohistochemical staining of Ki-67 in each group of mouse subcutaneous tumors is also included. Figure 7 This invention provides a comparison of the expression levels of circFAM126A in different groups of tissue microarray samples from 104 gastric cancer patients, detected by in situ hybridization (ISH) in Example 5 of this invention. Figure 8 This is a comparison of the difference between circFAM126A expression level and malignant tumor stage in Example 5 of the present invention; Figure 9 This is a comparison of the expression level of circFAM126A and the differences between lymph nodes in the tumor region in Example 5 of the present invention; Figure 10 The Kaplan-Meier survival curve based on tissue microarray analysis in Example 5 of this invention shows the relationship between circFAM126A expression level and overall survival. Figure 11 This study validates the impact of circFAM126A on overall survival (OS) in patients using univariate and multivariate Cox regression analysis in Example 5 of this invention (forest plot form). Detailed Implementation

[0026] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0027] The technical solution of the present invention will be further described below with reference to specific embodiments. The present invention does not impose any special restrictions on the source of reagents used in the following embodiments; commercially available products well known to those skilled in the art can be used.

[0028] Example 1 This embodiment provides the screening and expression of circFAM126A.

[0029] 1. Screening of circFAM126A Whole transcriptome sequencing was performed on oxaliplatin-resistant gastric cancer cells and their parental cell lines. Differentially expressed circRNAs were screened using |log2(Foldchange)| ≥ 2 and P < 0.05 as the threshold. Subsequently, Venn diagrams were used to perform intersection analysis on significantly upregulated circRNAs in the differential expression data, revealing circFAM126A (hsa_circ_0008951) as the only candidate molecule that met the common high-expression criteria across all groups.

[0030] circFAM126A is a 1019nt full-length circular mature sequence formed by back splicing exons 2-10 of the FAM126A gene on chr7:22999874-23030758, as shown in SEQ ID NO. 1. Figure 1 A schematic diagram of circFAM126A formed by circularization of exons 2-10 of the FAM126A gene and a schematic diagram of the circFAM126A specific splice site.

[0031] 2. RT-qPCR detection of circFAM126A expression Total RNA was extracted from normal human gastric mucosal cells GES-1, gastric cancer cell lines (AGS, HGC-27), and their corresponding oxaliplatin-resistant cell lines (OXR), as well as from gastric cancer cells treated with different concentrations of oxaliplatin. Reverse transcription was performed using the PrimeScript RTReagent Kit, and qPCR was performed using SYBR Green Master Mix. Relative expression levels were analyzed using a 2-1 -ΔΔCt The method is used for calculation, with GAPDH as the internal reference.

[0032] Figure 2In the figure, A represents the difference in expression of circFAM126A in normal gastric mucosal epithelial cells, gastric cancer cells, and oxaliplatin-resistant gastric cancer cells. It can be seen that compared with normal human gastric mucosal cells GES-1, circFAM126A is highly expressed in gastric cancer cells; while compared with gastric cancer cells, the expression level of circFAM126A in oxaliplatin-resistant gastric cancer cells is further increased. Figure 2 B in the figure represents a comparison of the expression differences of circFAM126A in gastric cancer cells treated with different concentrations of oxaliplatin. It can be seen that the expression of circFAM126A increases with the increase of oxaliplatin concentration, which suggests that the expression of circFAM126A may be related to oxaliplatin resistance.

[0033] Example 2 This embodiment provides the construction of the circFAM126A interference sequence and cell transfection.

[0034] 1. Carrier Construction The human wild-type (WT) circFAM126A and sh-circFAM126A lentiviral vectors were synthesized by OBiO Technologies (China).

[0035] The lentiviral vector contains the circFAM126A shRNA sequence, whose nucleotide sequence is as follows (SEQ ID NO. 2): GACATGGTTGAAGGTTTAGAA.

[0036] 2. Oxaliplatin-resistant gastric cancer cells transfected with AGS and HGC-27 When the cells (2 mL / well) in the six-well plate reach 50% confluence, calculate the required viral load using the formula: Virus Volume = (Cell Number × MOI) / Titer. Discard 1 mL of the old medium in each well, add fresh medium containing the virus, and incubate for 4 hours. Then, replenish the medium to 2 mL. Change the medium after 24 hours and continue culturing until 90% confluence or for another 24 hours. Next, replace the original medium with medium containing 5 μg / mL puromycin for selection. Change the medium / passage every 2-3 days until uninfected cells die.

[0037] 3. RT-qPCR validation Changes in circFAM126A expression levels after transfection were detected using RT-qPCR. The primer sequences for circFAM126A are as follows: F: GAAATCACACCAACTTCCTCTCG (SEQ ID NO. 3); R: ACAACCATTCCTCCACAACCC (SEQ ID NO. 4).

[0038] Figure 3To knock down circFAM126A in oxaliplatin-resistant cells, RT-qPCR validation showed that the intervention had a significant effect.

[0039] Example 3 This embodiment provides the effect of circFAM126A on the malignant phenotype of oxaliplatin-resistant gastric cancer cells.

[0040] 1. CCK-8 cell proliferation experiment AGS and HGC-27 cells were treated with different concentrations of oxaliplatin (0, 0.625, 1.25, 2.5, 5, 10, 20 μM) for 36 hours. The treated AGS and HGC-27 cells were seeded in 96-well plates with 2000 cells per well. 10 μL of CCK-8 reagent was added at 0, 24, 48, 72 and 96 h, respectively. After incubation for 2 h, the absorbance was measured at 450 nm and cell growth curves were plotted.

[0041] 2. EDU cell proliferation experiment Cell proliferation activity was assessed using an EDU cell proliferation assay kit (Abogen, China). Cells were seeded in 96-well plates and treated with 50–70% confluence for 2 hours with 50 μM EdU medium. After fixation with 4% paraformaldehyde, cells were stained sequentially with Click-iT and 1×Hoechst 33342 for 30 minutes each. Images were acquired and analyzed using a fluorescence microscope (Olympus, Japan).

[0042] 3. Plate cloning experiment Cells were seeded at a density of 500 cells per well in 6-well plates and cultured for two weeks. After two weeks, the cells were fixed with 4% paraformaldehyde and stained with crystal violet (Solarbio, China). The colonies on the culture plates were then counted.

[0043] 4. Apoptosis assay Cells were seeded in 6-well plates and treated with 10 μM oxaliplatin for 36 hours after maintaining 50–70% confluence. For flow cytometry analysis, cells were collected and stained using the PI / Annexin V-FITC apoptosis detection kit (Vazyme, China). Stained samples were analyzed within 1 hour. FITC fluorescence was detected in the FL1 channel and PI fluorescence in the FL3 channel at 488 nm excitation wavelength. 10,000 cells were collected per sample. Data analysis was performed using software such as FlowJo.

[0044] Figure 4 IC50 results for oxaliplatin-resistant cells with knockdown of circFAM26A. Figure 4The results showed that the IC50 of oxaliplatin-resistant gastric cancer cells expressing circFAM126A was significantly lower than that of the control group, thus demonstrating the feasibility of circFAM126A as a molecular target for oxaliplatin resistance in gastric cancer.

[0045] EDU and clonogenic assays showed that knockdown of circFAM126A significantly inhibited cell proliferation. Figure 5 (A and B in the original text). Next, the apoptosis rate after 36 hours of oxaliplatin treatment was detected by flow cytometry. The results showed that, compared with the control group, knockdown of circFAM126A in oxaliplatin-resistant cells could partially reverse the oxaliplatin-induced cell death effect. Figure 5 (C in the middle).

[0046] Example 4 This embodiment provides an in vivo experiment on the effects of circFAM126A on gastric cancer growth.

[0047] 1. Establishment of xenograft tumor model 5×10 6 AGS and HGC-27 resistant cells were subcutaneously inoculated into 4-6 week old female BALB / c nude mice and randomly divided into three groups of 6 mice each. The mice were treated with Sh-Control and Sh-circFAM126A, respectively. Tumor volume changes were recorded using the formula V = 0.5 × length × width. 2 .

[0048] 2. Immunohistochemical staining After dewaxing and rehydration, the sections were subjected to high-temperature antigen retrieval using citrate buffer (pH 6.0). Endogenous peroxidase was blocked sequentially with 3% hydrogen peroxide, and non-specific binding sites were blocked with 5% BSA. Primary antibody (anti-Ki-67 antibody) was incubated overnight at 4°C, and the following day, HRP-labeled secondary antibody was added and incubated at room temperature for 1 hour. The original signal was developed using DAB substrate, and cell nuclei were counterstained with hematoxylin. Finally, the sections were dehydrated, cleared, and mounted.

[0049] Results from a nude mouse xenograft tumor model showed that, compared with the control group, nude mice in the circFAM126A knockdown group had smaller tumor volume and lighter weight. Figure 6 The AC in the circFAM126A knockdown group). Immunohistochemical staining confirmed that the proportion of Ki-67 positive tumor cells was significantly reduced in the circFAM126A knockdown group. Figure 6 (D in the text). The above results indicate that silencing circFAM126A can effectively inhibit the tumorigenicity of oxaliplatin-resistant gastric cancer cells in nude mice and enhance the sensitivity of oxaliplatin-resistant cells to oxaliplatin treatment.

[0050] Example 5 This embodiment demonstrates that high expression of circFAM126A is associated with poor prognosis in gastric cancer patients.

[0051] Figure 7 The expression levels of circFAM126A in different groups of tissue microarray samples from 104 gastric cancer patients were compared using in situ hybridization (ISH). It can be seen that the expression level of circFAM126A in tumor tissue was significantly increased compared with normal tissue. Figure 8 The study compared the differences between circFAM126A expression levels and malignant tumor stages, where stage I, stage II, stage III, and stage IV represent cancer stages. It can be seen that high expression of circFAM126A is positively correlated with advanced malignant tumor stages.

[0052] Figure 9 The study compared the expression levels of circFAM126A with those of regional lymph nodes in the tumor region. N0 represented no regional lymph node metastasis, while N1-3 represented the presence of regional lymph node metastasis, with the degree of metastasis increasing sequentially. It can be seen that high expression of circFAM126A is positively correlated with regional lymph node metastasis in the tumor region.

[0053] Figure 10 To illustrate the relationship between circFAM126A expression level and overall survival using Kaplan-Meier survival curves based on tissue microarray analysis, gastric cancer patients were categorized into high / low circFAM126A expression groups using the median as a threshold. Low represented patients with low circFAM126A expression, and High represented patients with high circFAM126A expression. It can be seen that high circFAM126A expression is positively correlated with poorer survival.

[0054] Table 1 summarizes the correlation between circFAM126A and clinicopathological features of gastric cancer patients. The results showed that high expression of circFAM126A was significantly associated with regional lymph node metastasis (P=0.001) and distant metastasis (P=0.002), but not with patient age, sex, in situ invasion, or tumor differentiation.

[0055] Table 1. Correlation between clinicopathological parameters and circFAM126A expression levels in gastric cancer patients.

[0056] To assess the prognostic value of circFAM126A, this study performed Cox regression analysis on 5-year overall survival (OS). Figure 11The impact of circFAM126A on overall survival (OS) was validated using univariate and multivariate Cox regression analyses (forest plot format). Univariate Cox regression analysis showed that circFAM126A overexpression, lymph node metastasis, and tumor differentiation were independent predictors of OS. Multivariate analysis confirmed that high circFAM126A expression and low tumor differentiation were independent prognostic factors affecting OS in gastric cancer patients.

[0057] In summary, circFAM126A is a key biomarker driving oxaliplatin resistance in gastric cancer. In clinical gastric cancer patients, its high expression is significantly associated with shorter overall survival (OS). This molecule drives oxaliplatin resistance through a regulatory mechanism, and its high expression level is closely related to metastatic progression, poor prognosis, and weakened treatment response. In preclinical models, targeted knockout of circFAM126A restored chemosensitivity and inhibited pathological progression, suggesting that inhibiting circFAM126A may be an effective strategy and potential target for overcoming oxaliplatin resistance.

[0058] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of circFAM126A in the preparation of drugs to reverse oxaliplatin resistance in gastric cancer, characterized in that, The nucleotide sequence of circFAM126A is shown in SEQ ID NO.

1.

2. The application as described in claim 1, characterized in that, The drug in question is an inhibitor of circFAM126A.

3. The application as described in claim 2, characterized in that, The inhibitor of circFAM126A is a lentiviral vector that interferes with circFAM126A.

4. The application as described in claim 3, characterized in that, The lentiviral vector contains the circFAM126A shRNA sequence.

5. The application as described in claim 4, characterized in that, The nucleotide sequence of the circFAM126A shRNA is shown in SEQ ID NO.

2.

6. The application of a reagent for detecting circFAM126A in the preparation of a gastric cancer prognostic assessment product, characterized in that... The nucleotide sequence of circFAM126A is shown in SEQ ID NO.

1.

7. The application as described in claim 6, characterized in that, The gastric cancer prognostic assessment product includes PCR reagents.

8. The application as described in claim 7, characterized in that, The PCR reagent contains primers for detecting circFAM126A, the primers being composed of an upstream primer and a downstream primer, the sequence of which is shown in SEQ ID NO. 3 and the sequence of which is shown in SEQ ID NO.

4.

9. The application of the reagent for detecting circFAM126A in the preparation of reagents for detecting the degree of oxaliplatin resistance in gastric cancer cells, characterized in that... The nucleotide sequence of circFAM126A is shown in SEQ ID NO.

1.

10. The application as described in claim 9, characterized in that, The reagent for detecting the degree of oxaliplatin resistance in gastric cancer cells includes a PCR reagent; the PCR reagent contains primers for detecting circFAM126A, the primers being composed of an upstream primer and a downstream primer, the sequence of the upstream primer being shown in SEQ ID NO. 3, and the sequence of the downstream primer being shown in SEQ ID NO. 4.

Images