Ralstonia solanacearum report filamentous phage as well as construction method and application thereof

Abstract

The invention discloses a Ralstonia solanacearum report filamentous bacteriophage, which is characterized in that a luciferase luxAB gene is inserted into a filamentous bacteriophage RSCq genome and then electrically transformed into Ralstonia solanacearum GMI1000 to construct the Ralstonia solanacearum report filamentous bacteriophage RSCqluxAB, and the gene sequence of the Ralstonia solanacearum report filamentous bacteriophage RSCqluxAB is as shown in SEQ ID The invention further discloses a construction method and application of the ralstonia solanacearum report filamentous phage. The Ralstonia solanacearum report filamentous bacteriophage has a detection rate of 85% for 42 Ralstonia solanacearum test strains, is suitable for detection of various Ralstonia solanacearum, only infects Ralstonia solanacearum, has strong specificity, fast detection speed and high detection sensitivity, and can make up for the defects of the existing Ralstonia solanacearum detection technology. Furthermore, the preparation and detection processes of the ralstonia solanacearum reporter filamentous bacteriophage are simple to operate, and the detection cost is low by using capraldehyde as a substrate.

Description

Technical Field

[0001] This invention relates to the field of biological bacteriophage technology, specifically to a Ralstonia solanacearum reporter filamentous bacteriophage, its construction method, and its application. Background Technology

[0002] Bacterial wilt is a devastating bacterial disease worldwide characterized by its high pathogenicity, wide host range, and long survival time in soil. Ralstonia solanacearum has a wide host range, with over 90 host plant species distributed in my country alone. Besides common Solanaceae plants, it also includes newly reported plants such as bitter melon, leaf beet, fig, and blueberry, as well as naturally asymptomatic hosts like blue-eyed daisy, periwinkle, and snowdrop. Furthermore, the inoculum quantity of Ralstonia solanacearum in the stems of plants such as tomato, potato, dahlia, impatiens, and nandina is below the critical threshold of 10⁻⁶. 8 At a concentration of CFU / g, bacterial wilt symptoms are not observed; wilting only appears when the critical threshold is reached. This makes early diagnosis of bacterial wilt difficult, delaying the optimal time for chemical control. Therefore, establishing rapid and effective detection methods to promptly identify bacterial wilt pathogens carried in plant propagation material, seedlings, and plants for chemical control is crucial to reducing the occurrence and spread of the disease and minimizing yield loss.

[0003] Currently, there are many methods for detecting Ralstonia solanacearum, including plate culture colony counting, immunological methods such as ELISA, and molecular biology methods such as PCR. The disadvantages of plate culture colony counting are that it requires a long time to complete the culture and identification process, usually several days, making it unsuitable for rapid detection; it requires specialized laboratory equipment and culture media, is complex to operate, and requires professional knowledge; and the colony morphology of the strains may be atypical, leading to inaccurate results. The disadvantages of molecular biology detection methods such as PCR are that they require specialized instruments and reagents, resulting in higher costs; the detection process requires skilled operation and professional knowledge; and they are highly sensitive to environmental conditions, with improper operation potentially leading to inaccurate results. The disadvantages of immunological detection methods are that they require specific antibody reagents, resulting in higher costs; they rely on antibody specificity, and antibody cross-reactivity often leads to false positive results.

[0004] Reporter phage-based detection technology involves inserting a reporter gene into the genome of a bacteriophage. The reporter gene is then delivered to bacteria through infection, allowing for expression and thus enabling bacterial detection. Bacteriophages rely on host bacteria for survival; they cannot express the reporter gene before infecting a host. Only after successful infection can the presence of the host bacteria be confirmed through gene expression. Reporter phages offer several advantages. They only generate a detectable signal after infecting live host cells, allowing for accurate differentiation between live and dead bacteria and effectively avoiding false positives caused by residual dead bacteria in traditional detection methods. Furthermore, when a reporter phage infects a specific host, it can directly emit a detection signal without complex washing steps. This characteristic greatly simplifies the detection process, improves efficiency, and reduces operational complexity and cost, making it more suitable for rapid on-site testing and large-scale screening.

[0005] Currently, bacteriophages have been reported to be used for the detection of bacteria such as Escherichia coli, Staphylococcus aureus, Listeria, and Klebsiella pneumoniae, but there are no reports on their use in the detection of Ralstonia solanacearum, which requires further research. Summary of the Invention

[0006] To address the problems of complex operation, low timeliness, and high cost in existing methods for detecting Ralstonia solanacearum, this invention provides a Ralstonia solanacearum reporter filamentous phage, its construction method, and its application. A rapid detection tool for Ralstonia solanacearum is developed based on the filamentous phage RSCq, and a reporter filamentous phage for Ralstonia solanacearum is constructed using the luciferase luxAB gene. This method is then applied to the detection of Ralstonia solanacearum, providing a rapid, simple, and inexpensive new method for the rapid diagnosis of bacterial wilt disease.

[0007] To achieve the above objectives, the technical solution provided by the present invention is as follows:

[0008] A *Ralstonia solanacearum* reporter filamentous phage was constructed by inserting the luciferase luxAB gene into the genome of the filamentous phage RSCq, followed by electroporation into *Ralstonia solanacearum* GMI1000. The gene sequence of the *Ralstonia solanacearum* reporter filamentous phage RSCqluxAB is shown in SEQ ID NO.1.

[0009] The method for constructing Ralstonia solanacearum reporter filamentous phage as described above includes the following steps:

[0010] (1) Amplify promoter DNA;

[0011] (2) Amplify the luciferase luxAB gene cluster;

[0012] (3) The RSCqYFP01 vector was digested with restriction endonucleases NdeI and XbaI to remove the YFP fragment;

[0013] (4) The promoter DNA obtained in step (1) is fused in vitro with the luciferase luxAB gene cluster in step (2) and then cloned into the restriction site between NdeI and XbaI of RSCqYFP01 to generate the RSCq01kanlux plasmid.

[0014] (5) The 780bp E. coli replication element in the RSCq01kanlux plasmid obtained in step (4) was removed, and then electroporated into Ralstonia solanacearum GMI1000. The specific method is as follows: First, the RSCq01kanlux plasmid was digested with restriction endonucleases KpnI and PstI to obtain fragment one; then the RSCq01kanlux plasmid was digested with restriction endonucleases KpnI and XbaI to obtain fragment two; then the fragment located between the restriction sites XbaI and PstI was amplified using XPF, XPM1, XPM2 and XPR primers, and amplified by overlapping XPF and XPR primers. During amplification, the gene fragment containing the E. coli replication element was removed to form fragment three; finally, the above three gene fragments were ligated, and 10 μL of the ligation product was added to the electroporation competent cells of Ralstonia solanacearum GMI1000. After ice bath, the cells were electroporated, and the electroporated Ralstonia solanacearum was aspirated into a sterile 1.5 μL container using 700 μL of BG liquid medium. The culture was restored in mL centrifuge tubes, then spread onto the surface of BG solid medium containing kanamycin, and cultured to obtain Ralstonia solanacearum transformants;

[0015] (6) The Ralstonia solanacearum transformants obtained in step (5) were cultured in BG liquid medium, and the culture supernatant was filtered through a 0.22 μl filter to obtain the Ralstonia solanacearum reporter filamentous phage RSCqluxAB. The Ralstonia solanacearum reporter filamentous phage can be stably stored at 4℃ for more than 6 months, which is convenient for practical application.

[0016] Further, in step (1), the promoter DNA is amplified using proF and proR as primers and plasmid pK18mobSacB as template; in step (2), the luxAB gene cluster is amplified using luxF and luxR as primers and plasmid pMS402 template.

[0017] Further, the recovery culture described in step (5) is a recovery culture at 28°C for 3 h; then it is spread onto the surface of BG solid medium containing 25 μg / ml kanamycin and cultured at 28°C for 48 h.

[0018] Further, in step (5), after the ice bath, the sample is placed in a pre-cooled 1mm electrostimulation cup and subjected to 1.7 KV voltage electrostimulation treatment.

[0019] Further, the BG liquid culture medium mentioned in steps (5) and (6) is obtained by weighing 1 g of casaminoacid, 1 g of yeast extract, and 10 g of peptone into a beaker, adding 800 mL of deionized water, stirring evenly with a magnetic stirrer, adjusting the pH to 7.0 with 5 M NaOH solution, making up to 1 L, and sterilizing at 121°C for 20 minutes in an autoclave; before use, add 1 mL of filtered and sterilized 50% glucose solution to every 100 mL of culture medium; the BG solid culture medium mentioned in step (5) is obtained by adding 1.5% agar powder to the total volume of the BG liquid culture medium.

[0020] As described above, Ralstonia solanacearum reporter filamentous phages are used in the rapid detection of Ralstonia solanacearum.

[0021] Further, the above application involves incubating Ralstonia solanacearum reporter filamentous phage RSCqluxAB with the sample to be tested in BG liquid medium at 28°C for 3-12 hours, then adding the luminescent substrate decanal at 1% (v / v), and then detecting the luminescent signal under an ELISA reader.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] (1) The Ralstonia solanacearum reporter filamentous phage of the present invention has a detection rate of 85% for 42 Ralstonia solanacearum test strains, is applicable to the detection of various Ralstonia solanacearum strains, and only infects Ralstonia solanacearum, with high specificity.

[0024] (2) The Ralstonia solanacearum reporter filamentous phage of the present invention can be detected at 1.58 × 10⁻⁶ after 3 hours. 7 CFU / mL, detectable after 12 hours: 1.58 × 10⁻⁶ 4 The detection of Ralstonia solanacearum at a concentration of CFU / mL is fast and highly sensitive, and can also make up for the shortcomings of existing Ralstonia solanacearum detection technologies.

[0025] (3) The preparation and detection process of the Ralstonia solanacearum reporter filamentous phage of the present invention is simple and the detection cost is low when using decanal as a substrate. Attached Figure Description

[0026] Figure 1 Flowchart for constructing RSCqluxAB, a reporter filamentous bacteriophage for Ralstonia solanacearum;

[0027] Figure 2 Screening chart for optimal detection temperature of RSCqluxAB, a filamentous reporter bacteriophage of Ralstonia solanacearum;

[0028] Figure 3 Screening diagram for the optimal detection medium for RSCqluxAB of Ralstonia solanacearum reporter filamentous phage;

[0029] Figure 4 Flowchart of actual sample testing for Ralstonia solanacearum filamentous phage RSCqluxAB;

[0030] Figure 5 Detection limit diagram for Ralstonia solanacearum RSCqluxAB filamentous phage;

[0031] Figure 6 The RSCqluxAB detection spectrum of Ralstonia solanacearum filamentous bacteriophage;

[0032] Figure 7 Stability test results of R. qluxAB, a filamentous bacteriophage of Ralstonia solanacearum, stored at different temperatures. Detailed Implementation

[0033] The specific embodiments are described in detail below with reference to the accompanying drawings, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Unless otherwise specified, the raw materials and reagents used in the embodiments are commercially available.

[0034] The preparation methods for the culture media used in the following examples are as follows:

[0035] BG medium preparation: Weigh 1 g of casaminoacid, 1 g of yeast extract, and 10 g of peptone into a beaker. Add 800 mL of deionized water and stir thoroughly with a magnetic stirrer. Adjust the pH to 7.0 with 5 M NaOH solution, and bring the volume to 1 L. Dispense into Erlenmeyer flasks for later use (BG liquid medium). For solid medium, add 1.5% agar powder (BG solid medium). Autoclave at 121°C for 20 minutes. Before use, add 1 mL of filtered, sterilized 50% glucose solution per 100 mL of medium.

[0036] MP medium preparation: Weigh 0.5 g of (NH4)2SO4, 0.05 g of MgSO4·7H2O, and 3.4 g of KH2PO4, place them in a beaker, add 800 mL of deionized water, 1 μL of 0.45 mol / L FeSO4 solution, and 20 mL of glycerol, then stir thoroughly with a magnetic stirrer. Adjust the pH to 7.0 with 5M KOH solution, bring the volume to 1 L, dispense into Erlenmeyer flasks, and autoclave at 121°C for 20 minutes. Before use, add 1 mL of filtered sterilized 50% glucose solution to every 100 mL of medium.

[0037] Example 1

[0038] The construction method of Ralstonia solanacearum reporter filamentous phage RSCqluxAB is as follows:

[0039] (1) Using proF and proR as primers and plasmid pK18mobSacB as template, the promoter DNA was amplified;

[0040] (2) Using luxF and luxR as primers, the luxAB gene cluster was amplified using plasmid pMS402 template;

[0041] (3) The RSCqYFP01 vector was digested with restriction endonucleases NdeI and XbaI to remove the YFP fragment;

[0042] (4) The promoter DNA obtained in step (1) is fused in vitro with the luciferase luxAB gene cluster in step (2) and then cloned into the restriction site between NdeI and XbaI of RSCqYFP01 to generate the RSCq01kanlux plasmid.

[0043] (5) The 780bp E. coli replication element of the RSCq01kanlux plasmid obtained in step (4) was removed, and then electroporated into Ralstonia solanacearum GMI1000. The specific method is as follows: First, the RSCq01kanlux plasmid was digested with restriction endonucleases KpnI and PstI to obtain fragment one; then the RSCq01kanlux plasmid was digested with restriction endonucleases KpnI and XbaI to obtain fragment two; then the fragment located between the restriction sites XbaI and PstI was amplified using XPF, XPM1, XPM2 and XPR primers, and amplified by overlapping XPF and XPR primers. During amplification, the gene fragment containing the E. coli replication element was removed to form fragment three; finally, the above three gene fragments were ligated with T4 DNA ligase. 10 μL of the ligation product was added to 100 μL of electroporation competent cells of Ralstonia solanacearum standard strain GMI1000. After incubating on ice for 10 min, the cells were added to a pre-cooled 1 mm electroporation cuvette. KV voltage electrostimulation was performed, and the electrostimulated Ralstonia solanacearum was aspirated into sterile 1.5 mL centrifuge tubes using 700 μL of BG liquid medium. After recovery culture at 28°C for 3 h, it was then plated onto the surface of BG solid medium containing 25 μg / mL kanamycin and cultured at 28°C for 48 h to obtain Ralstonia solanacearum transformants. A schematic diagram of the construction is shown below. Figure 1 As shown, the sequences of the primers used for amplification are listed in Table 1 (SEQ ID NO.2-SEQ ID NO.9 in that order).

[0044] (6) The Ralstonia solanacearum transformants obtained in step (5) were cultured in BG liquid medium. The culture supernatant was filtered using a 0.22 μl filter to obtain the Ralstonia solanacearum reporter filamentous phage RSCqluxAB. The whole genome sequence of the obtained Ralstonia solanacearum reporter filamentous phage RSCqluxAB is shown in SEQ ID NO.1.

[0045] Table 1 Amplification Primer Sequences

[0046] Primers sequence proF CCCCTGCAGGTCGACTGCCGCAAGCACTCAGGG proR CATGCGAAACGATCCTCATCC luxF GAGGATCGTTCGCATGGAATTCCATGAAATTTGGAAACTTTTTG luxR CCGTGGCGGGGATCCTCTAGATTAGGTATATTCCATGTGGTAC XPF CTAATCTAGACCGCCACGGTTG XPM1 CATCGATGAATTGTGTCTCAAAATCTCTGATG XPM2 GATTTTGAGACACAATTCATCGATGATGGTTGAG XPR CAGCCTGCAGCCGATGTTGGC

[0047] Example 2

[0048] Application of Ralstonia solanacearum reporter filamentous phage RSCqluxAB

[0049] (1) Temperature screening: Add 3 mL of BG liquid medium, 30 μL of Ralstonia solanacearum reporter filamentous phage RSCqluxAB and 30 μL of OD to each test tube. 600nm A 0.8 g / L Ralstonia solanacearum GMI1000 bacterial suspension was co-incubated at different temperatures (28℃, 20℃, 37℃) on a shaker at 200 rpm for 12 h. Then, 100 μL of the co-incubation product was aspirated into each well of a 96-well white plate. Subsequently, 1% (v / v) of the luminescent substrate decanal (1% dissolved in anhydrous ethanol) was added, and luminescence was detected using a microplate reader. The detection effect was judged based on the magnitude of the luminescence value. The detection flowchart is shown below. Figure 4 The results are shown Figure 2 (**** indicates one-way ANOVA, P < 0.0001). From Figure 2 It can be seen that the luminescence value of the RSCqluxAB detection system for Ralstonia solanacearum reporter filamentous phage differed significantly at different temperatures (P<0.0001), indicating that it is greatly affected by temperature. The detection system for Ralstonia solanacearum reporter filamentous phage obtained the maximum luminescence value at 28℃, and the results show that 28℃ is the optimal detection temperature.

[0050] (2) Screening of culture media: 3 mL of BG liquid medium (BG), MP medium (MP) and deionized water (H2O) were added to different test tubes respectively, and 30 μL of reporter filamentous phage RSCqluxAB and 30 μL of LOD were added to each test tube. 600nm A 0.8 g / L Ralstonia solanacearum GMI1000 bacterial suspension was incubated at 28°C on a shaker at 200 rpm for 12 h. Then, 100 μL of the co-incubation product was pipetted into each well of a 96-well white plate. Subsequently, 1% (v / v) of the luminescent substrate decanal (1% dissolved in anhydrous ethanol) was added. The luminescence was detected using a microplate reader, and the detection effect was judged based on the magnitude of the luminescence value. The detection procedure is as follows: Figure 4 As shown, the results are as follows. Figure 3 (**** indicates one-way ANOVA, P < 0.0001). From Figure 3 It can be seen that the luminescence value detected by the RSCqluxAB detection system of Ralstonia solanacearum reporter filamentous phage in BG liquid medium was significantly higher than that in MP medium and H2O (P<0.0001), indicating that BG liquid medium is the optimal reaction medium.

[0051] (3) Detection limit determination: Add 3 mL of BG liquid medium, 30 μL of Ralstonia solanacearum reporter filamentous phage RSCqluxAB, and 30 μL of Ralstonia solanacearum GMI1000 bacterial suspension at different concentration gradients (concentration gradients of 1.58 × 10⁻⁶, respectively) to each test tube. 0 CFU / mL, 1.58×10 1 CFU / mL, 1.58×10 2 CFU / mL, 1.58×10 3 CFU / mL, 1.58×10 4 CFU / mL, 1.58×10 5 CFU / mL, 1.58×10 6 CFU / mL, 1.58×10 7 The culture medium (CFU / mL) was co-incubated at 28℃ and 200 rpm for 0-12 h. Only Ralstonia solanacearum filamentous phage RSCqluxAB was added to the BG liquid medium as a control (Phage Only). 100 μL of the co-incubated product was then aspirated into a 96-well white plate, and the luminescence was detected using a microplate reader after adding the luminescent substrate decanal. The detection procedure is as follows: Figure 4 As shown, the results are as follows. Figure 5 .from Figure 5 It can be seen that the background luminescence value of R. bacterialis reporter filamentous phage RSCqluxAB without R. bacterialis is 9-13 μm. Setting the positive detection limit at 10 times the background luminescence value, R. bacterialis reporter filamentous phage RSCqluxAB can detect 1.58 × 10⁻⁶ cells / μL as quickly as 3 hours. 7 Ralstonia solanacearum GMI1000 CFU / mL, detectable levels as low as 1.58 × 10⁻⁶ after 12 hours. 4 The concentration of CFU / mL of Ralstonia solanacearum GMI1000 indicates that the Ralstonia solanacearum reporter filamentous phage RSCqluxAB has high detection sensitivity and can meet the requirements for rapid disease detection.

[0052] (4) Detection of host spectrum of Ralstonia solanacearum reporter filamentous phage RSCqluxAB: Ralstonia solanacearum reporter filamentous phage RSCqluxAB was used to detect Ralstonia solanacearum in different crops in different regions of Guangxi Zhuang Autonomous Region. Fluorescent Pseudomonas fluorescens 2P24, Pseudomonas syringae DC3000, and Ralstonia solanacearum GMI1000 treated with anhydrous ethanol were used as controls. The detection procedure is as follows: Figure 4 As shown, the results are as follows. Figure 6 .from Figure 6 It can be seen that the R. spp. reporter phage RSCqluxAB can only detect live R. spp., but cannot detect Pseudomonas or R. spp. treated with ethanol. Among the 42 R. spp. strains tested, the R. spp. reporter phage RSCqluxAB could detect 36 strains, with a detection rate of 85%.

[0053] Table 2 Host spectrum information for Ralstonia solanacearum reporter filamentous phage RSCqluxAB detection

[0054] Serial Number Name of Ralstonia solanacearum strain Source crops Source region Detection status 1 GMI1000 tomato Guyana (standard strain) from France + 2 Ac01 Sheng Hongji Qiaotou Village, Sipai Township, Luzhai County, Liuzhou City + 3 Bg06 Momordica charantia Wutang Town, Xingning District, Nanning City + 4 Bg07 Momordica charantia Zhushan Village, Nameng Town, Qinzhou City + 5 Bg08 Momordica charantia Daoxi Village, Babu District, Hezhou City + 6 Cm02 chrysanthemum Guwen Village, Xiangbei Township, Yizhou City + 7 Cq01 Grafted winter melon Wutang Town, Xingning District, Nanning City + 8 Ec03 eucalyptus Qinlian Forest Farm, Qinnan District, Qinzhou City + 9 Ep07 eggplant Wutang Town, Xingning District, Nanning City + 10 Ep10 eggplant Daxu Town, Gangbei District, Guigang City + 11 Fm01 Monk fruit Guangxi University Plant Pathogen Greenhouse, Xixiangtang District, Nanning City + 12 Fm04 Monk fruit Yao Township, Rong'an County, Liuzhou City + 13 Gg14 ginger Sandu Town, Liujiang County, Liuzhou City + 14 Kb02 Green beans Wutang Town, Xingning District, Nanning City + 15 Mb05 mulberry Banwei Village, Shibie Town, Yizhou City + 16 Pn10 peanut Heping Village, Mengshan County, Wuzhou City + 17 Pn15 peanut Daxu Town, Gangbei District, Guigang City + 18 Pn23 peanut Nama Town, Liangqing District, Nanning City + 19 Pn39 peanut Qintang Town, Gangbei District, Guigang City + 20 Pp22 chili Haiyang Township, Lingchuan County, Guilin City + 21 Pt04 potato Changtang Town, Qingxiu District, Nanning City + 22 Pt05 potato Guangxi University Internship Base, Xixiangtang District, Nanning City + 23 Pt07 potato Guangxi University Internship Base, Xixiangtang District, Nanning City - 24 Sm03 Sesame Xiaoyao Village, Xiaodong County, Qinzhou City - 25 Sm04 Sesame Xiaoyao Village, Xiaodong County, Qinzhou City - 26 Tb04 tobacco Duona Village, Wuping Town, Jingxi City + 27 Tb06 tobacco Xinjingbu Village, Jingxi City + 28 Tb07 tobacco Nabu Village, Yandong Township, Debao County, Baise City + 29 Tb08 tobacco Wudong Village, Jingde Township, Debao County, Baise City + 30 Tb10 tobacco Tongshi Village, Chaodong Town, Fuchuan County, Hezhou City + 31 Tb12 tobacco Xinhua Town, Leye County, Baise City + 32 Tb16 tobacco Bawei Township, Nandan County, Hechi City + 33 Tb25 tobacco Tongde Township, Jingxi City - 34 Tg03 loofah Wutang Town, Xingning District, Nanning City + 35 Tg04 loofah Wutang Town, Xingning District, Nanning City + 36 Tm06 tomato Dumo Town, Lipu County, Guilin City - 37 Tm11 tomato Nanning City Guangxi University Internship Base + 38 Tm12 tomato Baipo Village, Toutang Town, Tianyang County, Baise City + 39 Tm13 tomato Baipo Village, Toutang Town, Tianyang County, Baise City + 40 Tm18 tomato Bagui Pastoral Area, Xixiangtang District, Nanning City - 41 Ws01 Water spinach Guangxi University Internship Base, Xixiangtang District, Nanning City + 42 Ws02 Water spinach Guangxi University Internship Base, Xixiangtang District, Nanning City +

[0055] Note: A positive result is recorded as "+" in the table above; otherwise, a negative result is recorded as "-".

[0056] (6) Storage stability test: Ralstonia solanacearum reporter filamentous phage RSCqluxAB was stored at three different temperatures: 4℃, 20℃, and room temperature. Its detection effect on Ralstonia solanacearum GMI1000 was tested after specific time intervals to evaluate its storage stability at different temperatures. The results are shown in […]. Figure 7 .from Figure 7 It can be seen that the Ralstonia solanacearum reporter phage has the best stability at 4°C and can be stably preserved for more than 6 months.

[0057] In summary, this invention constructs a reporter filamentous phage of Ralstonia solanacearum using a molecular cloning method, which can bind to a corresponding substrate to generate a bioluminescent indicator of the presence of Ralstonia solanacearum.

[0058] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.

Claims

1. A *Ralstonia solanacearum* reporter filamentous bacteriophage, characterized by: The luciferase luxAB gene was inserted into the genome of filamentous phage RSCq, and then electroporated into Ralstonia solanacearum GMI1000 to construct the Ralstonia solanacearum reporter filamentous phage RSCqluxAB; the gene sequence of the Ralstonia solanacearum reporter filamentous phage RSCqluxAB is shown in SEQ ID NO.

1.

2. The method for constructing Ralstonia solanacearum reporter filamentous phage as described in claim 1, characterized in that, The operation includes the following steps: (1) Amplify promoter DNA; (2) Amplify the luciferase luxAB gene cluster; (3) The RSCqYFP01 vector was digested with restriction endonucleases NdeI and XbaI; (4) The promoter DNA obtained in step (1) is fused in vitro with the luciferase luxAB gene cluster in step (2) and then cloned into the restriction site between NdeI and XbaI of RSCqYFP01 to generate the RSCq01kanlux plasmid. (5) The 780bp E. coli replication element in the RSCq01kanlux plasmid obtained in step (4) was removed and then electroporated into Ralstonia solanacearum GMI1000. The specific method is as follows: First, the RSCq01kanlux plasmid was digested with restriction endonucleases KpnI and PstI to obtain fragment one; then the RSCq01kanlux plasmid was digested with restriction endonucleases KpnI and XbaI to obtain fragment two; then the fragment located between the restriction sites XbaI and PstI was amplified using XPF, XPM1, XPM2 and XPR primers, and amplified by overlapping XPF and XPR primers. During amplification, the gene fragment containing the E. coli replication element was removed to form fragment three; finally, the above three gene fragments were ligated and added to the electroporation competent cells of Ralstonia solanacearum GMI1000. After ice bath, the cells were electroporated. The electroporated Ralstonia solanacearum was aspirated using BG liquid medium, and cultured again. Then it was plated on the surface of BG solid medium containing kanamycin and cultured to obtain Ralstonia solanacearum transformants. (6) The Ralstonia solanacearum transformants obtained in step (5) were cultured in BG liquid medium, and the culture supernatant was filtered to obtain Ralstonia solanacearum reporter filamentous phage RSCqluxAB.

3. The method for constructing Ralstonia solanacearum reporter filamentous phage according to claim 2, characterized in that: In step (1), the promoter DNA was amplified using proF and proR as primers and plasmid pK18mobSacB as template; in step (2), the luxAB gene cluster was amplified using luxF and luxR as primers and plasmid pMS402 as template.

4. The method for constructing Ralstonia solanacearum reporter filamentous phage according to claim 2, characterized in that: The recovery culture described in step (5) is a recovery culture at 28°C for 3 h; then it is spread onto the surface of BG solid medium containing 25 μg / ml kanamycin and cultured at 28°C for 48 h.

5. The method for constructing Ralstonia solanacearum reporter filamentous phage according to claim 2, characterized in that: In step (5), the ice bath is followed by electrical stimulation at 1.7 kV.

6. The method for constructing Ralstonia solanacearum reporter filamentous phage according to claim 2, characterized in that: The BG liquid culture medium mentioned in steps (5) and (6) is obtained by weighing 1 g of tyrosine, 1 g of yeast extract and 10 g of peptone, mixing them, adding deionized water, stirring evenly to adjust the pH to 7.0, making up to 1 L, and sterilizing at 121℃ for 20 minutes. Before use, 1 mL of filtered sterilized 50% glucose solution is added to every 100 mL of culture medium. The BG solid culture medium mentioned in step (5) is obtained by adding 1.5% agar powder to the total volume of the BG liquid culture medium.

7. The application of the Ralstonia solanacearum reporter filamentous phage as described in claim 1 or the Ralstonia solanacearum reporter filamentous phage constructed by any of the construction methods described in claims 2-6 in the detection of Ralstonia solanacearum.

8. The application according to claim 7, characterized in that: The Ralstonia solanacearum reporter filamentous phage RSCqluxAB was incubated with the test sample in BG liquid medium at 28°C for 3-12 hours, followed by the addition of decanal, and then the luminescence signal was detected under an ELISA reader to obtain the final product.

9. The application according to claim 8, characterized in that: The decanal was added at 1%.

Images