Esterase with various chiral ester hydrolytic activities as well as gene and application of esterase

Abstract

The invention belongs to the technical field of gene engineering and enzyme engineering, and particularly relates to esterase with various chiral ester hydrolytic activities as well as a gene and application of the esterase. The novel cold-adapted esterase FE2495 is obtained from an Antarctic metagenome, the enzyme reaches the maximum catalytic activity when the pH value is 8.0, and the gt is maintained within the pH value range of 6.0-9.0; according to the present invention, the Esterase has characteristics of low temperature, 80% relative enzyme activity and excellent environmental adaptability, and the temperature characteristic analysis results show that the Esterase has typical cold adaptation characteristics, the optimal reaction temperature is 30 DEG C, and the Esterase can maintain about 40% of catalytic activity at the low temperature of 0 DEG C. A substrate specificity research finds that the enzyme has high degradation efficiency on C2-C4 short-chain fatty acid methyl ester, can selectively degrade L-methyl lactate, L-methyl mandelate and D-2-methyl chloropropionate, and has important industrial application value in the field of biological catalysis of low-temperature chiral drug intermediates.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and enzyme engineering technology, specifically relating to an esterase with multiple chiral ester hydrolysis activities, its gene, and its applications. Background Technology

[0002] Esterases are a class of biocatalysts widely found in nature, used to catalyze ester bond hydrolysis and synthetic reactions, and have important applications in chemical synthesis and chiral drug preparation. Although some microbial esterases have been industrialized, existing esterases have limitations in thermal stability, such as the optimal reaction temperature generally being concentrated in the 40-60℃ range, while the catalytic efficiency drops sharply at low temperatures, forcing continuous heating to maintain the reaction temperature during production, resulting in a significant increase in energy costs. At the same time, existing esterases have insufficient selectivity for L / D configuration chiral substrates, making it difficult to meet the requirements for the synthesis of high-purity drug intermediates, and requiring complex separation and purification steps in the synthesis process.

[0003] Microorganisms adapted to extreme environments, such as those that have evolved in the harsh, low-temperature conditions of polar regions, particularly Antarctic soil microorganisms, can maintain high catalytic activity at low temperatures by adjusting enzyme molecular structures (e.g., increasing surface hydrophilic residues and optimizing flexible regions). However, currently discovered cryosensitive esterases exhibit catalytic efficiency at low temperatures less than 30% of that of mesophilic enzymes, show low activity towards short-chain ester substrates, and exhibit poor stability in alkaline environments. Furthermore, existing cryosensitive esterases generally lack precise stereoselectivity, hindering the efficient preparation of chiral compounds with high optical purity, thus limiting their widespread application in the pharmaceutical field. Summary of the Invention

[0004] The purpose of this invention is to provide an esterase with multiple chiral ester hydrolytic activities, its gene and application, thereby overcoming the shortcomings of the prior art and obtaining a novel esterase with wide temperature range adaptability (especially high activity at low temperatures) and high stereoselectivity, which has important industrial application value in the field of biocatalysis of low-temperature chiral drug intermediates.

[0005] To achieve the above objectives, the technical solution of the present invention is as follows: In a first aspect, the present invention provides an esterase, the esterase being esterase FE2495, the amino acid sequence of which is any one of (a1)-(a3): (a1) A protein consisting of the amino acid sequence shown in SEQ ID NO.1; (a2) A protein derived from (a1) by substitution and / or deletion and / or addition of one or more amino acid residues and having the same biological activity. (a3) Other genes that encode proteins that have more than 50% similarity to the amino acid sequence composition shown in SEQ ID NO.1 and have the activity of the protein shown in SEQ ID NO.1.

[0006] In a second aspect, the present invention provides a gene encoding the esterase of the first aspect, the gene being Gene 2495, having any of the nucleotide sequences described in (b1)-(b3): (b1) The nucleotide sequence shown in SEQ ID NO.2; (b2) is a nucleotide sequence complementary to (b1); (b3) is a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (b1) or (b2) and encodes the same functional protein.

[0007] Thirdly, the present invention provides a recombinant expression vector, expression cassette or recombinant cell encoding the gene of the second aspect, preferably a prokaryotic cell, preferably bacteria, and more preferably Escherichia coli; furthermore, the recombinant cell contains the Gene 2495 gene and / or a recombinant expression vector.

[0008] Fourthly, the present invention provides the use of the esterase of the first aspect in (c1) or (c2): (c1) Degradation of short-chain esters; (c2) Degradation of chiral esters.

[0009] In some other embodiments, in application (c1), the short-chain ester is a short-chain ester compound with a carbon chain length of 2-16 carbon atoms, preferably a short-chain ester compound with a carbon chain length of 2-6 carbon atoms, and more preferably a short-chain ester compound with a carbon chain length of 2 carbon atoms. (c2) In application, esterases selectively degrade L-lactic acid methyl ester, L-mandelic acid methyl ester or D-2-chloropropionate methyl ester.

[0010] Fifthly, the present invention provides a method for the degradation of short-chain esters, comprising the following steps: The short-chain ester was mixed with Tris-HCl buffer and preheated. The esterase from the first step was added to initiate the reaction, and sodium dodecyl sulfate was added to terminate the reaction.

[0011] In some other embodiments, the concentration of the short-chain ester is 5-15 mM; the concentration of the Tris-HCl buffer is 40-60 mM, and the pH of the Tris-HCl buffer is 7-9; the concentration of sodium dodecyl sulfate is 15-25 wt%. Preferably, the concentration of the short-chain ester is 10 mM; the concentration of the Tris-HCl buffer is 50 mM, and the pH of the Tris-HCl buffer is 8; the concentration of sodium dodecyl sulfate is 20 wt%. The volume ratio of short-chain ester, Tris-HCl buffer, esterase, and sodium dodecyl sulfate is (15-25):(900-1000):(15-25):(90-110); Preferably, the volume ratio of short-chain ester, Tris-HCl buffer, esterase, and sodium dodecyl sulfate is 20:960:20:100. The preheating temperature is 25-35℃ and the time is 2-5 min; preferably, the preheating temperature is 30℃ and the time is 3 min. The reaction temperature is 0-70℃ and the reaction time is 8-12 min; preferably, the reaction temperature is 10-40℃ and the reaction time is 10 min; more preferably, the reaction temperature is 30℃. The short-chain ester is a short-chain ester compound with a carbon chain length of 2-16 carbon atoms, preferably a short-chain ester compound with a carbon chain length of 2-6 carbon atoms, and more preferably a short-chain ester compound with a carbon chain length of 2 carbon atoms.

[0012] In some other embodiments, the addition of metal ions, with a concentration of 1-10 mM, is further included; preferably, the metal ions are Zn. 2+ Mn 2+ Ca 2+ Cu 2+ K + Ni 2+ Li + Mg 2+ and Co 2+ One or more of the following; more preferably, the metal ion is K. + Mg 2+ Li + Ca 2+ ; Before adding the esterase, the esterase is incubated for 0-120 min at a temperature of 20-90°C and a pH of 4.0-11.0. Preferably, the incubation temperature is 20-30°C and the pH is 6.0-9.0. More preferably, the incubation temperature is 30°C and the pH is 8.

[0013] In a sixth aspect, the present invention provides a method for the degradation of chiral esters, wherein a chiral ester and an esterase from the first aspect are added to an EPPS buffer to carry out a degradation reaction.

[0014] In some other embodiments, the concentration of EPPS buffer is 4.0-5.0 mM, the pH of EPPS buffer is 7-9; the concentration of chiral ester is 140-150 mM, the concentration of esterase is 0.2-1.0 mg / mL; and the volume ratio of EPPS buffer, chiral ester, and esterase is (180-220):(10-20):(5-15). Preferably, the concentration of EPPS buffer is 5.0 mM, the pH of EPPS buffer is 8, the concentration of chiral ester is 143 mM, the concentration of esterase is 0.5 mg / mL, and the volume ratio of EPPS buffer, chiral ester, and esterase is 200:15:10. The chiral ester is one or more of L-lactic acid methyl ester, L-mandelic acid methyl ester and D-2-chloropropionate methyl ester; The degradation reaction is carried out at a temperature of 20-30℃ for 2-4 hours; preferably, the degradation reaction is carried out at a temperature of 30℃ for 3 hours. The EPPS buffer also contains an indicator at a concentration of 0.4-0.5 mM; Preferably, the indicator is phenol red, and the concentration of phenol red is 0.455 mM.

[0015] The beneficial effects of this invention are: (1) The esterase of the present invention has typical cold-adaptive characteristics. Its optimal reaction temperature is 30°C, and it can still maintain about 40% of its catalytic activity at 0°C. The optimal pH of the enzyme is 8.0, and it maintains >80% relative enzyme activity in the pH range of 6-9, showing excellent environmental adaptability. This characteristic makes it of great industrial application value in the field of biocatalysis of low-temperature chiral drug intermediates.

[0016] (2) The esterase FE2495 in this invention has significant chiral selectivity and can specifically hydrolyze L-lactic acid methyl ester, L-mandelic acid methyl ester or D-2-chloropropionate methyl ester, while having high degradation efficiency for C2-C4 short-chain fatty acid methyl esters. Attached Figure Description

[0017] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0018] Figure 1 This is an electrophoresis image of the purified esterase FE2495 after nickel column affinity chromatography in Example 3 of the present invention. M represents the protein molecular weight marker. Figure 2 This is a bar chart showing the degradation substrate activity analysis of esterase FE2495 in Example 3 of the present invention; Figure 3This is a temperature curve of the enzyme activity of esterase derived from Antarctic soil in Example 3 of the present invention; where A represents the effect of temperature on enzyme activity and B represents the effect of temperature on enzyme stability. Figure 4 This is a pH curve of the enzyme activity of esterases derived from Antarctic soil in Example 3 of the present invention; Figure 5 This is a bar chart showing the effect of metal ions on the enzyme activity of esterases in Example 3 of the present invention; Figure 6 This experiment demonstrates the catalytic selectivity of esterase FE2495 for methyl lactate, methyl mandelate, and methyl 2-chloropropionate in Example 3. Figure 7 This is the amino acid sequence of the esterase FE2495 precursor protein in Example 1 of this experiment. Detailed Implementation

[0019] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Specific conditions not specified in the embodiments are performed under conventional conditions or conditions recommended by the manufacturer. Components whose manufacturers are not specified are all commercially available conventional products.

[0020] The culture media used include LB liquid medium and LB solid medium, with the following specific compositions: LB liquid medium: prepared with 1 wt% peptone, 0.5 wt% yeast extract, 1 wt% NaCl, and distilled water.

[0021] LB solid medium: 1 wt% peptone, 0.5 wt% yeast extract, 1 wt% NaCl, 1.5 wt% agar, prepared with distilled water.

[0022] This invention addresses the shortcomings of existing cold-tolerant esterases, which exhibit low catalytic efficiency at low temperatures, low activity for short-chain ester substrates, poor stability in alkaline environments, and a general lack of precise stereoselectivity. These limitations hinder the efficient preparation of chiral compounds with high optical purity, thus restricting their widespread application in the pharmaceutical field.

[0023] This invention provides a novel cold-adaptive esterase FE2495 derived from an Antarctic metagenomics, its encoding gene, and its applications. The gene for the Antarctic microbial esterase, Gene 2495, originates from an esterase-producing strain. Flavobacterium ardleyense A2-1. Flavobacterium ardleyenseStrain A2-1 was isolated from environmental samples on the coast of Adele Island, Antarctica. The relevant information has been published in *Flavobacterium ardleyense sp. nov., isolated from Antarctic soil*. Zhou et al., *Int J Syst Evol Microbiol* 2017;67:3996-4001. Whole-genome sequencing of this strain identified the gene fragment encoding esterase, Gene 2495, and its nucleic acid sequence. Specific primers were designed based on the Gene 2495 gene sequence, and PCR technology was used to extract the esterase from... Flavobacterium ardleyense The gene encoding Antarctic soil-derived esterase Gene 2495 was cloned from the genome of strain A2-1. An expression vector containing the Antarctic soil-derived esterase gene Gene 2495 and recombinant E. coli cells containing this expression vector were constructed.

[0024] Sequencing results showed that Gene 2495 contains a 654-nucleotide open reading frame encoding the Antarctic soil-derived esterase FE2495, with a start codon at 1 bp and a stop codon at 654 bp, encoding a protein of 217 amino acids. Experimental verification confirmed that this ORF is a gene encoding a functional esterase. Although sequence analysis revealed the existence of other potential ORFs (ORF2: 120 nt; ORF3: 90 nt), their lengths were significantly shorter than their homologous genes, and no related activity was detected. Therefore, this invention focuses on ORF1 and its encoded product.

[0025] Example 1 Acquisition and sequence analysis of the gene encoding the Antarctic soil-derived esterase FE2495. Source of strain: Flavobacterium ardleyense Strain A2-1 was isolated from soil found on the coast of Adelaide Island, Antarctica. The specific steps are as follows: (1) Determination of ester hydrolase gene sequences according to Flavobacterium ardleyense The results of whole-genome sequencing and gene annotation analysis of strain A2-1, from... Flavobacterium ardleyenseGene fragments labeled as esterases or lipases were searched in the genome of strain A2-1. Sequence similarity analysis was performed on these fragments using Esther and the BLAST function in the NCBI database, further screening revealed the gene fragment encoding the esterase, Gene 2495. Gene 2495 is 654 bp in length, containing a 654 bp open reading frame that encodes the Antarctic soil-derived esterase FE2495. The start codon is located at 1 bp, and the stop codon is located at 654 bp, encoding a protein of 217 amino acids. The nucleotide sequence of the gene encoding the Antarctic soil esterase FE2495 is as follows: (The sequence is not provided in the original text.) ggttttagccaaggttctat cttgagttatgcgattggat tgtcgtatcc agagcgcatt cgccgcattg ttgcgatgagtggctatcta aataccgact tgattgttga tggtttccga gaaaagaatt tcgataattt caaggttttctgctctcacg gaagtcagga tcaggtagtg cccgtagaat ggggacgtat ggcaaagcct gttttggaatcaatgaagat cgatgttaca tataaagaat atcctattgg ccacggcgtt tctcctcaaa attttagagaattttctgggc tggctactac ttacaaaaaaa gtag (as SEQ ID Shown in NO.2). The amino acid sequence of the precursor protein of the Antarctic soil-derived esterase FE2495 is shown in SEQ ID NO.1 (specifically as follows). Figure 7 (As shown).

[0026] (2) Sequence analysis of esterases from Antarctic soil In GenBank, the sequence most similar to the Antarctic soil esterase FE2495 is derived from... Flavobacterium ardleyense The hydrolase (WP_318640675.1) showed 100.00% sequence similarity. Meanwhile, the BLAST sequence showed 61.50%-100.00% similarity to the Antarctic soil-derived esterase FE2495. Both are genes predicted based on gene sequences, and their biochemical properties have not yet been studied.

[0027] Example 2 Cloning, heterologous expression, and purification of FE2495 esterase (1) Amplification of gene sequences using PCR Two specific primers, 2495F and 2495R, were designed based on the Gene 2495 sequence (primers were synthesized by Jinan Platinum Biotechnology Co., Ltd.). The specific amino acid sequences are shown below: 2495F:AAGAAGGAGATATACATATGACAACATCACTATATCATTTGGT (SEQ ID NO. 3); 2495R:TCGAGTGCGGCCGCAAGCTTCTTTTTTGTAAGTAGTAGCCAGC (SEQ ID NO. 4); Using primers 2495F and 2495R, and the fosmid containing the gene 2495 as a template, the target gene fragment was amplified using FastPfu DNA polymerase (purchased from Transgen). The PCR reaction conditions were as follows: 95℃ pre-denaturation for 2 min; then 95℃ denaturation for 20 sec, 50℃ annealing for 20 sec, 72℃ extension for 1 min, 30 cycles; and finally 72℃ extension for 10 min.

[0028] The PCR amplification products were subjected to 1 wt% agarose gel electrophoresis, which yielded a DNA fragment of approximately 650 bp. The amplified DNA fragment was then recovered using an Omega DNA recovery kit according to the kit's instructions.

[0029] The recovered Gene 2495 gene fragment was ligated into the pET22b vector using a seamless cloning kit (purchased from Nearshore Protein Technology Co., Ltd.). The amplified DNA fragment was then recovered using an Omega DNA Recovery Kit following its instructions.

[0030] Escherichia coli DH5α competent cells were prepared according to the method for preparing competent cells in Molecular Cloning: A Laboratory Manual.

[0031] The ligated recombinant pET22b vector was transferred into Escherichia coli DH5α competent cells using the heat shock transformation method described in Molecular Cloning: A Laboratory Manual.

[0032] Transformed Escherichia coli DH5α was plated on LB solid medium containing 100 μg / ml ampicillin and cultured overnight at 37°C. Positive clones were selected, transferred to LB liquid medium, and plasmids were extracted. The LB solid culture medium used was prepared with the following components: 1 wt% peptone, 0.5 wt% yeast extract, 1 wt% NaCl, 1.5 wt% agar, and distilled water. The LB liquid culture medium used was prepared with the following components: 1 wt% peptone, 0.5 wt% yeast extract, 1 wt% NaCl, and distilled water.

[0033] (2) The recombinant expression vector pET22b-Gene 2495 was transformed into... E. coli BL21 (DE3) specifically includes the following steps: Prepare Escherichia coli BL21 competent cells according to the method for preparing competent Escherichia coli in Molecular Cloning: A Laboratory Manual; The correctly sequenced recombinant vector pET22b-Gene2495 was transformed into E. coli BL21 competent cells using the heat shock transformation method described in Molecular Cloning: A Laboratory Manual. Transformed Escherichia coli BL21 was plated on LB medium containing 100 μg / ml ampicillin and cultured overnight at 37°C.

[0034] (3) The gene Gene 2495 was induced to be expressed and purified in Antarctic soil microorganisms, specifically including the following steps: Scrape bacterial growth from a plate and inoculate it into 100 ml of LB liquid medium containing 100 μg / ml ampicillin, and incubate at 37°C for 2-3 h. At 1% ( v / v The inoculum was transferred to 1,000 ml of LB liquid medium containing 100 μg / ml ampicillin and incubated at 37°C until OD500. 600 The concentration was 0.6-0.8, and IPTG was added to a final concentration of 0.1 mM. The mixture was then incubated in a shaker at 15°C for 24 h. Collect LB culture medium induced by IPTG expression, centrifuge at 11,000 rpm for 5 min at 4℃, and collect bacterial cells; The bacterial cells were suspended in 50 mM Tris-HCl buffer (pH 8.0) containing 100 mM NaCl; The resuspended bacterial solution was then ultrasonically disrupted. Centrifuge the disrupted bacterial culture at 4°C and 11,000 rpm for 30 min, and collect the supernatant. Collect the supernatant, centrifuge at 11,000 rpm for 20 min at 4℃, and filter the supernatant through a 22 μm filter membrane.

[0035] Perform nickel column affinity chromatography on the supernatant according to the instructions; The purity of the samples collected after chromatography was determined by SDS-PAGE, confirming that electrophoretically purified Antarctic esterase FE2495 had been obtained (e.g., Figure 1 Imidazole was removed by dialysis and then stored at -20°C for later use.

[0036] Example 3 Properties of Antarctic esterase FE2495 3.1 Substrate Specificity Analysis p NP ester substrates: Preparing substrates with different carbon chain lengths using isopropanol. p NP ester substrates C2, C4, C8, C10, C12, and C14 (purchased from Sigma).

[0037] (1) The standard reaction was as follows: 20 μl of 10 mM substrate was preheated with 960 μl of 50 mM Tris-HCl (pH 8.0) at 30℃ for 3 min, then 20 μl of enzyme solution was added, and the reaction was continued at 30℃ for 10 min. 100 μl of 20 wt% SDS (sodium dodecyl sulfate) was added to terminate the reaction, and the OD value at 405 nm was measured. The reaction without enzyme solution was used as a blank control. The standard curve was prepared using different concentrations of... p NP (purchased from Sigma) is used for drawing.

[0038] Enzyme activity is defined as: the amount of energy a enzyme can catalyze per minute at a given temperature. p NP ester substrate hydrolysis produces 1 μM p The amount of enzyme required for NP is one unit of enzyme activity (U).

[0039] The results showed that esterase FE2495 could efficiently degrade short-chain esterases. p NP ester substrates (C2, C4, C6) show the strongest degradation ability for C2 substrates, while the degradation ability for long-chain ester substrates (C8, C10, C12, and C16) is poor (e.g., ...). Figure 2 ).

[0040] (2) Optimal temperature and temperature stability analysis Determination of optimal reaction temperature: Using C2 as substrate, the enzyme activity of Antarctic esterase FE2495 was measured at 0℃, 10℃, 20℃, 30℃, 40℃, 50℃, 60℃, and 70℃ in 50mM Tris-HCl (pH 8.0) buffer. The highest enzyme activity was defined as 100%.

[0041] The results showed that the optimal enzyme activity temperature was 30℃, and it retained more than 50% of its high activity in the 10-40℃ range, and still had 40% of its enzyme activity at 0℃ (e.g., Figure 3 A).

[0042] Temperature stability analysis: The enzyme solution was incubated at 20℃, 30℃, 70℃, and 90℃. Every 15 minutes over 2 hours, the same amount of enzyme was taken out to measure the residual activity of Antarctic esterase FE2495 in 50 mM Tris-HCl (pH 8.0) buffer at 30℃. Enzyme activity at 0℃ was defined as 100%.

[0043] The results showed that, except for 20℃ and 30℃, the enzyme activity dropped below 50% after 15 min of incubation at other temperatures. However, the enzyme activity did not change significantly with prolonged incubation time. After 2 h of incubation, the enzymes at 20℃ and 30℃ still retained more than 50% of their activity. Although the activity was lower at 70℃, it was not completely inactivated, retaining about 30% of its activity (e.g., ...). Figure 3 B).

[0044] (3) Optimal reaction pH of esterase FE2495 Determination of optimal reaction pH: Prepare Britton-Robinson buffer solutions with pH values ​​ranging from 4.0 to 11.0, spaced at 1 or 0.5 pH units. Determine the enzyme activity of Antarctic esterase FE2495 under different pH conditions; the highest enzyme activity is defined as 100%.

[0045] The results showed that esterase FE2495 is an alkaline esterase with an optimal pH of 8.0, and it is stable within a pH range of 6-9, exhibiting a wide tolerance range (e.g., ...). Figure 4 ).

[0046] (4) Effects of metal ions on enzyme activity Using C2 as a substrate, at 30°C, in 50 mM Tris-HCl (pH 8.0) buffer, the esterase FE2495 derived from Antarctic soil was detected in 10 mM Zn2. 2+ Mn 2+ Ca 2+ Cu 2+ K +Ni 2+ Li + Mg 2+ Co 2+ Enzyme activity under certain conditions. The highest enzyme activity is defined as 100%.

[0047] Zn 2+ Ni 2+ Cu 2+ Both showed significant inhibitory effects, Zn 2+ At a concentration of 1 mM, the enzyme is almost completely inactivated, Co 2+ and Ni 2+ At a concentration of 10 mM, the enzyme activity dropped below 30%, while the enzyme's activity against K... + Mg 2+ Li + Ca 2+ It has good tolerance, when K + When the concentration of [agent name] is increased to 10 mM, the enzyme activity increases significantly (e.g., [other enzyme name]). Figure 5 ).

[0048] 3.2 Activity analysis of chiral ester substrates Various chiral ester substrates were prepared using acetonitrile (purchased from Sigma).

[0049] The standard reaction was as follows: 15 μl of 143 mM chiral ester was added to 200 μl of 5 mM EPPS buffer (pH 8.0) containing 0.455 mM Phenol Red, followed by 10 μl of 0.5 mg / ml purified enzyme. The reaction was carried out at 30°C for 3 h. A control group was prepared by adding 10 μl of Tris-HCl buffer instead of the enzyme solution. Activity was determined by the absorbance at 550 nm or the difference in color before and after incubation.

[0050] The results showed that esterase FE2495 could selectively degrade L-lactate methyl ester, L-mandelic acid methyl ester, and D-2-chloropropionate methyl ester, but had no activity against D-lactate methyl ester, D-mandelic acid methyl ester, and L-2-chloropropionate methyl ester. Therefore, esterase FE2495 has the potential for industrial applications in the synthesis of important chiral compounds (such as...). Figure 6 ).

[0051] In summary, this invention, through its application to... Flavobacterium ardleyense Analysis of the whole genome sequencing and gene annotation results of strain A2-1, from Flavobacterium ardleyense The gene encoding an esterase, Gene2495, was identified in the genome of strain A2-1, and its nucleic acid sequence and encoded protein sequence were determined. Specific primers were designed based on the Gene2495 gene sequence, and PCR technology was used to extract the esterase from the gene. Flavobacterium ardleyenseA gene fragment encoding the Antarctic soil-derived esterase FE24955 was cloned from the whole genome of strain A2-1. An expression vector containing the Antarctic soil-derived esterase gene Gene2495 and recombinant E. coli cells containing this expression vector were constructed. Gene2495 contains a 654 bp open reading frame encoding the novel esterase FE2495, with a start codon at 1 bp and a stop codon at 654 bp, encoding a 217-amino acid precursor protein. Gene2495 was heterologously expressed and purified in E. coli to obtain mature and active esterase FE2495.

[0052] The purified esterase FE2495 was subjected to enzymatic property determination. The results showed that this enzyme exhibited strong degradation activity against short-chain esters with carbon chain lengths of 2-6 carbon atoms. Figure 2 It retains over 50% of its high activity at 10-30℃, and still retains 40% of its enzyme activity at 0℃. Figure 3 The optimal pH is 8.0, and it is stable within the pH range of 6-9. Figure 4 Zn 2+ Ni 2 + Cu 2+ Zn showed significant inhibitory effects on all enzymes. 2+ At a concentration of 1 mM, the enzyme is almost completely inactivated, Co 2+ and Ni 2+ At a concentration of 10 mM, the enzyme activity dropped below 30%, while the enzyme's activity against K... + Mg 2+ Li + Ca 2+ It has good tolerance, when K + When the concentration of [agent name] is increased to 10 mM, the enzyme activity increases significantly. Figure 5 Activity analysis on various chiral ester substrates showed that esterase FE2495 exhibited excellent chiral selectivity for important industrial chiral precursors: methyl L-lactate, methyl L-mandelate, and methyl D-2-chloropropionate. This indicates that esterase FE2495 has the potential for industrial applications in the synthesis of important chiral compounds. Figure 6 ).

[0053] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An esterase, characterized in that, The esterase is esterase FE2495, and its amino acid sequence is any one of (a1)-(a3): (a1) A protein consisting of the amino acid sequence shown in SEQ ID NO.1; (a2) A protein derived from (a1) by substitution and / or deletion and / or addition of one or more amino acid residues and having the same biological activity. (a3) Other genes that encode proteins that have more than 50% similarity to the amino acid sequence composition shown in SEQ ID NO.1 and have the activity of the protein shown in SEQ ID NO.

1.

2. A gene encoding the esterase according to claim 1, characterized in that, The encoding gene is Gene 2495, which has any of the nucleotide sequences described in (b1)-(b3): (b1) The nucleotide sequence shown in SEQ ID NO.2; (b2) is a nucleotide sequence complementary to (b1); (b3) is a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (b1) or (b2) and encodes the same functional protein.

3. A recombinant expression vector, expression cassette, or recombinant cell containing the encoding gene of claim 2, preferably, the recombinant cell is a prokaryotic cell, preferably bacteria, and more preferably Escherichia coli; further, the recombinant cell contains the Gene 2495 gene and / or a recombinant expression vector.

4. The use of the esterase according to claim 1 in (c1) or (c2): (c1) Degradation of short-chain esters; (c2) Degradation of chiral esters.

5. The application according to claim 4, characterized in that, In the application described in (c1), the short-chain ester is a short-chain ester compound with a carbon chain length of 2-16 carbon atoms, preferably a short-chain ester compound with a carbon chain length of 2-6 carbon atoms, and more preferably a short-chain ester compound with a carbon chain length of 2 carbon atoms. In the application described in (c2), the esterase selectively degrades L-lactic acid methyl ester, L-mandelic acid methyl ester, or D-2-chloropropionate methyl ester.

6. A method for degrading short-chain esters, characterized in that, Includes the following steps: The short-chain ester was mixed with Tris-HCl buffer and preheated, and the esterase described in claim 1 was added to carry out the reaction. Sodium dodecyl sulfate was added to terminate the reaction.

7. The method for short-chain ester degradation according to claim 6, characterized in that, The concentration of the short-chain ester is 5-15 mM; the concentration of the Tris-HCl buffer is 40-60 mM, and the pH of the Tris-HCl buffer is 7-9; the concentration of sodium dodecyl sulfate is 15-25 wt%. Preferably, the concentration of the short-chain ester is 10 mM; the concentration of the Tris-HCl buffer is 50 mM, the pH of the Tris-HCl buffer is 8; and the concentration of sodium dodecyl sulfate is 20 wt%. The volume ratio of the short-chain ester, Tris-HCl buffer, esterase, and sodium dodecyl sulfate is (15-25):(900-1000):(15-25):(90-110); Preferably, the volume ratio of short-chain ester, Tris-HCl buffer, esterase, and sodium dodecyl sulfate is 20:960:20:

100. The preheating temperature is 25-35℃ and the time is 2-5 min; preferably, the preheating temperature is 30℃ and the time is 3 min. The reaction temperature is 0-70℃ and the reaction time is 8-12 min; preferably, the reaction temperature is 10-40℃ and the reaction time is 10 min; more preferably, the reaction temperature is 30℃. The short-chain ester is a short-chain ester compound with a carbon chain length of 2-16 carbon atoms, preferably a short-chain ester compound with a carbon chain length of 2-6 carbon atoms, and more preferably a short-chain ester compound with a carbon chain length of 2 carbon atoms.

8. The method for short-chain ester degradation according to claim 6, characterized in that, It also includes the addition of metal ions, with a concentration of 1-10 mM; preferably, the metal ion is Zn. 2+ Mn 2+ Ca 2+ Cu 2+ K + Ni 2+ Li + Mg 2+ and Co 2 + One or more of the following; more preferably, the metal ion is K. + Mg 2+ Li + Ca 2+ ; Before adding the esterase, the esterase is incubated for 0-120 min at a temperature of 20-90°C and a pH of 4.0-11.

0. Preferably, the incubation temperature is 20-30°C and the pH is 6.0-9.

0. More preferably, the incubation temperature is 30°C and the pH is 8.

9. A method for chiral ester degradation, characterized in that, A chiral ester and the esterase described in claim 1 are added to EPPS buffer to carry out a degradation reaction.

10. The method for chiral ester degradation according to claim 9, characterized in that, The concentration of the EPPS buffer is 4.0-5.0 mM, and the pH of the EPPS buffer is 7-9; the concentration of the chiral ester is 140-150 mM, and the concentration of the esterase is 0.2-1.0 mg / mL; the volume ratio of the EPPS buffer, chiral ester, and esterase is (180-220):(10-20):(5-15). Preferably, the concentration of the EPPS buffer is 5.0 mM, the pH of the EPPS buffer is 8, the concentration of the chiral ester is 143 mM, the concentration of the esterase is 0.5 mg / mL, and the volume ratio of the EPPS buffer, chiral ester, and esterase is 200:15:

10. The chiral ester is one or more of L-lactic acid methyl ester, L-mandelic acid methyl ester and D-2-chloropropionate methyl ester; The degradation reaction is carried out at a temperature of 20-30°C for 2-4 hours; preferably, the degradation reaction is carried out at a temperature of 30°C for 3 hours. The EPPS buffer also contains an indicator at a concentration of 0.4-0.5 mM; Preferably, the indicator is phenol red, and the concentration of phenol red is 0.455 mM.

Images