Cell models for ocular diseases and therapies for ocular diseases

Abstract

The invention relates to a cell model for ocular diseases and a therapy for ocular diseases. Cell models of eye diseases, methods and compositions for treating eye diseases are provided.

Description

[0001] This application is a divisional application of patent application "Cellular Models of and Therapies for Ocular Diseases" having an application date of July 31, 2018, application number 201880064626.5 (international application number PCT / IB2018 / 055755).

[0002] Cross Reference to Related Applications

[0003] This application claims priority under 35 U.S.C. § 119(e) to U.S. Application No. 62 / 539,473, filed July 31, 2017, entitled "CELLULAR MODELS OF AND THERAPIES FOR OCULAR DISEASES." The entire contents of the above application are hereby incorporated by reference. BACKGROUND INVENTION

[0005] Crystalline Retinal Dystrophy (also known as Crystalline Retinal Degeneration, or Bietti's Crystalline Dystrophy, BCD)

[0006] Bietti's Crystalline Dystrophy (BCD, also known as Bietti Crystalline Corneoretinal Dystrophy, Bietti Crystalline Retinopathy, Bietti's Retinal Dystrophy (OMIM 210370)) is a rare autosomal recessive and blinding retinal dystrophy characterized by numerous tiny yellow-white crystalline deposits in the posterior pole of the retina associated with atrophy of the retinal pigment epithelium (RPE), pigment clumps, and choroidal sclerosis. It was first described by Dr. G.B. Bietti in 1937. Fundus photographs and SD-OCT images of BCD patients show that the crystalline deposits are mainly on the retinal side of the retinal pigment epithelium (RPE). (H. Kojima, A. Otani, K. Ogino, et al., "Outer retinal circular structures in patients with Bietti crystalline retinopathy", British Journal of Ophthalmology, vol. 96, pp. 390-393, 2012). Crystalline deposits in the corneal limbus are estimated to occur in one quarter to one third of people with BCD (Kaiser-Kupfer et al. Clinical biochemical and pathologic correlations in Bietti's crystalline dystrophy, Am J Ophthalmol., 1994, 118:569-82). In some cases, crystalline deposits are also observed in the lens (Chung et al., J Ophthalmol. 57:447-450, 2013). In the advanced stage, BCD patients have advanced choroidal sclerosis, with a reduction or absence of crystalline deposits, and thinning of the retinal vessels (Wada et al. Am J Ophthalmol 2005; 139:894-9). There is also abnormal ERG and retinal thinning in BCD.

[0007] Clinically, BCD is progressive and associated with degeneration and deterioration of the RPE. Significant asymmetry between the eyes of the same patient is common. Age of disease onset and progression vary among BCD patients, even within the same family. Most patients develop night blindness, constriction of visual field, poor color vision, macular degeneration, and a decline in vision during the second and fourth decades of life, and progress to legal blindness during the third and sixth decades of life.

[0008] The RPE is located between the vascular and photoreceptor outer segments of the choriocapillary layer, and is a monolayer of pigmented cells that interact closely with photoreceptors (cones and rods) to maintain visual function. The main function of the RPE is to supply nutrients and remove waste products from the photoreceptors, which are the sensory neurons of the retina. Other functions of the RPE include, but are not limited to, light absorption, epithelial transport, spatial ion buffering, visual cycle, phagocytosis, secretion, and immune modulation (Strauss, 2005, The retinal pigment epithelium in visual function. Physiol Rev 85:845-81). Thus, dysfunction and degeneration of the RPE leads to dysfunction and degeneration of the photoreceptors, which results in loss of vision. Given that BCD is associated with progressive degeneration and deterioration of the RPE, the RPE is critical for the study and treatment of BCD.

[0009] BCD is a rare disease. One source estimates the incidence of BCD to be 1 in 67,000 (g h r. n l n. g o v / c o n d i t i o n / B i e t t i - C r y s t a l l i n e - D y s t r o p h y # s t a t i s t i c s on the World Wide Web). Another source estimates the prevalence of BCD to be 2.5% of all RP patients (3 of 121 RP index patients were BCD index patients, see Mataftsi et al., Retina. 24:416-426, 2004). Based on this estimate and considering that the incidence of RP is estimated to be 1 in 4000 (Hartong et al., Lancet. 368: 1795-1809, 2006), the incidence of BCD is estimated to be 1 in 160,000. Because the symptoms of BCD are similar to those of other eye disorders that progressively destroy the retina, it is sometimes diagnosed generally as retinitis pigmentosa (RP) (Mataftsi A et al. Bietti's crystalline corneoretinal dystrophy: a cross-sectional study. Retina. 2004; 24:416-426). Although BCD patients have been reported in different regions of the world, including Asia, Africa, Europe, the Middle East, North America, and South America, BCD is reported to be more common in people of East Asian ancestry, especially in the Chinese and Japanese populations (Hu 1983, Ophthalmic genetics in China. Ophthal Paed Genet 2:39-45; Li et al., Am J Hum Genet. 2004 May; 74(5):817-826).

[0010] There are currently no approved treatments for BCD, and patients eventually go blind. There is a strong unmet medical need for developing life-changing treatment options for patients with this rare disease.

[0011] CYP4V2

[0012] CYP4V2 (Cytochrome P450, Family 4, Subfamily V, Polypeptide 2, (OMIM 608614), synonym: CYP4AH1) is one of the proteins in the cytochrome P450 superfamily and a member of the heme-thiolate cytochrome P450 subfamily 4 (CYP4). Cytochrome P450s (CYPs) are important heme-containing proteins known for their monooxygenase reactions. They are involved in the metabolism of xenobiotics and endogenous compounds such as steroids and fatty acids. Human CYPs are major membrane-associated proteins located in the inner membrane of mitochondria or in the endoplasmic reticulum of cells. P450 proteins can be identified by their signature sequence element FxxGxxxCxG (SEQ ID NO: 30), where the underlined cysteine is an axial ligand to the heme iron. Another signature sequence element of P450 proteins is ExxR (SEQ ID NO: 31). The Human Genome Project has set the number of human P450 genes to 57. For comparison, there are 103 mouse P450 genes and 89 rat P450 genes. (Guengerich & Cheng, Pharmacological Reviews, September 2011, 63(3) 684-699).

[0013] The human CYP4 family consists of 12 genes and 10 pseudogenes. The human CYP4V2 gene (HGNC:23198) is located at 4q35 and has 11 exons. Mutations in the CYP4V2 gene cause BCD (Li et al., Am J Hum Genet. 74:817-826, 2004). While CYP4V2 is expressed in almost all tissues, it is expressed at high levels in the retina and RPE and at slightly lower levels in the cornea, the tissues that show the major clinical findings of BCD (Li et al., Am J Hum Genet. 74:817-826, 2004; Nakano M, Kelly EJ, Rettie AE: Expression and Characterization of CYP4V2 as a Fatty Acid omega-Hydroxylase. Drug Metab Dispos 2009; Nakano M, Kelly EJ, Wiek C, Hanenberg H, Rettie AE: CYP4V2 in Bietti's crystalline dystrophy: ocular localization, metabolism of omega-3-polyunsaturated fatty acids, and functional deficit of the p.H331P variant. Mol Pharmacol 2012; 82:679-686).

[0014] Because CYP4V2 is a relatively new member of the P450 family and BCD is a rare disease, the function of CYP4V2 has not been extensively studied. Previous studies have shown that CYP4V2 protein is mainly active in fatty acid metabolism. Abnormalities in fatty acids and their metabolism have been demonstrated in serum, lymphocytes, and skin fibroblasts of BCD patients (Lee J, Jiao X, Hejtmancik JF, et al. : The metabolism of fatty acids in human Bietti crystalline dystrophy. Invest Ophthalmol Vis Sci 2001; 42: 1707-1714; Lai T, Chu KO, Chan KP, et al. : Alterations in serum fatty acid concentrations and desaturase activities in Bietti crystalline dystrophy unaffected by CYP4V2 genotypes. Invest Ophthalmol Vis Sci 2010; 51 : 1092-1097). Another study showed that CYP4V2 is an omega-3-polyunsaturated fatty acid (PUFA) hydroxylase and is highly expressed P450 in the transformed human RPE cell line ARPE-19 (Nakano M, Kelly EJ, Wiek C, Hanenberg H, Rettie AE: CYP4V2 in Bietti's crystalline dystrophy: ocular localization, metabolism of omega-3-polyunsaturated fatty acids, and functional deficit of the p.H331P variant. Molecular pharmacology 2012; 82: 679-686).

[0015] A number of mutations have been identified in the CYP4V2 gene and these mutations cause BCD, with at least one mutation in each of the 11 exons of the gene. The most common CYP4V2 mutation in BCD patients is c.802-8_810del17insGC (referring to a 17 base deletion and two base (GC) insertion at a position 8 bases from the end of intron 6 of the CYP4V2 gene, also referred to as IVS6-8del / insGC, see SEQ ID NO: 46, which shows the sequence of a human CYP4V2 genomic DNA region comprising the c.802-8_810del17insGC mutation; and SEQ ID NO: 47, which shows the corresponding wild type sequence). The c.802-8_810del17insGC mutation is shown in the sequence below showing the human CYP4V2 intron 6-exon 7 junction. The intron 6 sequence is shown in lower case letters and the exon 7 sequence is shown in upper case letters. The 17 bp deletion and GC insertion are in brackets: caa aca gaa gca tgt gat tat cat tca aa(tca tac agG TCA TCG CT)(GC)GAA CGGGCC AAT GAA ATG AAC GCC AAT GA (SEQ ID NO: 46), resulting in skipping of exon 7. (Xiao et al., Biochem Biophys Res Commun. 409: 181-6, 2011; Meng et al., 2014, Mol. Vis., 20: 1806-14; Wada et al., Am J Ophthalmol. 139: 894-9, 2005; Jiao et al., European Journal of Human Genetics (2017) 25, 461-471). A recent study estimated the age of the c.802-8_810del17insGC mutation to be 1,040 to 8,200 generations in the Chinese population and 300 to 1100 generations in the Japanese population. See Jiao et al., European Journal of Human Genetics (2017) 25, 461-471.

[0016] A variety of types of CYP4V2 mutations are found to be associated with BCD, including but not limited to missense, repeat, splice site, frameshift, deletion, insertion, indel, nonsense, polymorphism (e.g., single nucleotide polymorphism), and premature termination, as well as entire deletion of the CYP4V2 gene. A summary of CYP4V2 mutations picked out in human BCD patients is provided in Table 1 herein and can be found in various publications and online databases, such as LOVD (databases.lovd.nl / shared / genes / CYP4V2), OMIM (omim.org / allelicVariant / 608614), and ClinVar (ncbi.nlm.nih.gov / clinvar?term=608614 [MIM]).

[0017] Table 1: CYP4V2 mutations picked out in BCD patients

[0018]

[0019]

[0020]

[0021] This is just a list of options and can not include all pathological CYP4V2 mutations / variants in BCD patients identified and reported to date. Mutations are relative to reference sequences (NM_207352.3) and (NP_997235.3). New CYP4V2 pathological mutations in BCD patients are continuously being identified. All identified and future identified pathological CYP4V2 mutations / variants associated with BCD are incorporated herein by reference.

[0022] Inherited Retinal Degeneration (IRD)

[0023] Hereditary retinal degeneration (IRD) is a leading cause of blindness. Over 200 genes are currently known to be involved in IRD and related disorders. In humans, retinitis pigmentosa (RP) is the leading form of IRD. RP has three general inheritance patterns (autosomal dominant, autosomal recessive, and X-linked). The worldwide prevalence of RP is estimated to be 1 in 4,000, with autosomal recessive RP accounting for 50-60% of RP (Hartong DT, Berson EL, Dryja TP. Retinitis pigmentosa. Lancet. 2006; 368: 1795-809). A study in Europe estimated that BCD prevalence is 2.5% of all RP patients and about 10% of people with non-syndromic autosomal recessive RP (Mataftsi A, Zografos L, Millá E, Secrétan M, Munier FL. Bietti's crystalline corneoretinal dystrophy: a cross-sectional study. Retina. 2004; 24: 416-26). The same study also noted that BCD is often diagnosed universally as RP. Thus, BCD can have been under-diagnosed. BCD is a worldwide disease, but it is most common in East Asia, especially in the Chinese and Japanese populations (Li et al., Am J Hum Genet. 2004 May; 74(5): 817-826).

[0024] References for mutations in Table 1 :

[0025] Li A, Jiao X, Munier FL, Schorderet DF, Yao W, et al. (2004) Bietti crystalline corneoretinal dystrophy is caused by mutations in the novel gene CYP4V2. Am J Hum Genet 74: 817-826.

[0026] Xiao X, Mai G, Li S, Guo X, Zhang Q (2011) Identification of CYP4V2 mutation in 21 families and overview of mutation spectrum in Bietticrystalline corneoretinal dystrophy. Biochem Biophys Res Commun 409: 181-186.

[0027] Shan M, Dong B, Zhao X, Wang J, Li G, et al. (2005) Novel mutations in the CYP4V2 gene associated with Bietti crystalline corneoretinal dystrophy. Mol Vis 11: 738-743.

[0028] Rossi S, Testa F, Li A, Yaylacioglu F, Gesualdo C, et al. (2013) Clinical and genetic features in Italian Bietti crystalline dystrophy patients. Br J Ophthalmol 97: 174-179.

[0029] Lin J, Nishiguchi KM, Nakamura M, Dryja TP, Berson EL, et al. (2005) Recessive mutations in the CYP4V2 gene in East Asian and Middle Eastern patients with Bietti crystalline corneoretinal dystrophy. J Med Genet 42: e38.

[0030] Manzouri B, Sergouniotis PI, Robson AG, Webster AR, Moore A (2012) Bietti crystalline retinopathy: report of retinal crystal deposition in male adolescent siblings. ARCH OPHTHALMOL 130: 1470-1473.

[0031] Lai TY, Ng TK, Tam PO, Yam GH, Ngai JW, et al. (2007) Genotype phenotype analysis of Bietti's crystalline dystrophy in patients with CYP4V2 mutations. Invest Ophthalmol Vis Sci 48:5212-5220.

[0032] Parravano M, Sciamanna M, Giorno P, Boninfante A, Varano M (2012) Bietti crystalline dystrophy: a morpho-functional evaluation. Doc Ophthalmol 124:73-77.

[0033] Wada Y, Itabashi T, Sato H, Kawamura M, Tada A, et al. (2005) Screening for mutations in CYP4V2 gene in Japanese patients with Bietti's crystalline corneoretinal dystrophy. Am J Ophthalmol 139:894-899.

[0034] Zenteno JC, Ayala-Ramirez R, Graue-Wiechers F (2008) Novel CYP4V2 gene mutation in a Mexican patient with Bietti's crystalline corneoretinal dystrophy. Curr Eye Res 33:313-318.

[0035] Lee KY, Koh AH, Aung T, Yong VH, Yeung K, et al. (2005) Characterization of Bietti crystalline dystrophy patients with CYP4V2 mutations. Invest Ophthalmol Vis Sci 46: 3812-3816.

[0036] Yokoi Y, Sato K, Aoyagi H, Takahashi Y, Yamagami M, et al. (2011) A Novel Compound Heterozygous Mutation in the CYP4V2 Gene in a Japanese Patient with Bietti's Crystalline Corneoretinal Dystrophy. Case Rep Ophthalmol 2: 296-301.

[0037] Haddad NM, Waked N, Bejjani R, Khoueir Z, Chouery E, et al. (2012) Clinical and molecular findings in three Lebanese families with Bietti crystalline dystrophy: report on a novel mutation. Mol Vis 18: 1182-1188.

[0038] Fu Q, Wang F, Wang H, Xu F, Zaneveld JE, et al. (2013) Next-generation sequencing-based molecular diagnosis of a Chinese patient cohort with autosomal recessive retinitis pigmentosa. Invest Ophthalmol Vis Sci 54: 4158-4166.

[0039] Song Y, Mo G, Yin G (2013) A novel mutation in the CYP4V2 gene in a Chinese patient with Bietti's crystalline dystrophy. Int Ophthalmol 33:269-276.

[0040] Jin ZB, Ito S, Saito Y, Inoue Y, Yanagi Y, et al. (2006) Clinical and molecular findings in three Japanese patients with crystalline retinopathy. Jpn J Ophthalmol 50:426-431.

[0041] Halford S, Liew G, Mackay DS, Sergouniotis PI, Holt R, Broadgate S, Volpi EV, Ocaka L, Robson AG, Holder GE, Moore AT, Michaelides M, Webster AR. Detailed phenotypic and genotypic characterization of bietti crystalline dystrophy. Ophthalmology. 2014;121:1174-84

[0042] Houfa Yin, Chongfei Jin, Xiaoyun Fang, Qi Miao, Yingying Zhao, Zhiqing Chen, Zhaoan Su, Panpan Ye, Yao Wang and Jinfu Yin, Molecular Analysis and Phenotypic Study in 14 Chinese Families With Bietti Crystalline Dystrophy. PLoS One 9(4), e94960. 2014 Apr 16.

[0043] Xiao Hong Meng, Hong Guo, Hai Wei Xu, Qi You Li, Xin Jin, Yun Bai, Shi Ying Li, Zheng Qin Yin, Identification of novel CYP4V2 gene mutations in 92 Chinese families with Bietti’s crystalline corneoretinal dystrophy, Molecular Vision (2014); 20: 1806-1814

[0044] Galuh D N Astuti, Vincent Sun, Miriam Bauwens, Ditta Zobor, Bart P Leroy, Amer Omar, Bernhard Jurklies, Irma Lopez, Huanan Ren, Volkan Yazar, Christian Hamel, Ulrich Kellner, Bernd Wissinger, Susanne Kohl, Elfride De Baere, Rob W J Collin, and Robert K Koenekoop, Novel insights into the molecular pathogenesis of CYP4V2-associated Bietti’s retinal dystrophy, Mol Genet Genomic Med. 2015 January; 3(1): 14-29.

[0045] Xiaodong Jiao, Anren Li, Zi-Bing Jin, Xinjing Wang, Alessandro Iannaccone, Elias I Traboulsi, Michael B Gorin, Francesca Simonelli and J Fielding Hejtmancik, Identification and Population History of CYP4V2 mutations in Patients with Bietti Crystalline Corneoretinal Dystrophy, European Journal of Human Genetics (2017) 25, 461-471. SUMMARY

[0046] SUMMARY

[0047] Cell line claim

[0048] Cell line and disease model claim

[0049] Cell line composition

[0050] In one aspect, a cellular disease model is provided, comprising a cell line. Such disease models include (a) a stem cell provided by a subject or a stem cell reprogrammed from a cell provided by a subject, or (2) a cell derived from a stem cell provided by a subject or derived from a stem cell reprogrammed from a cell provided by a subject, which comprises one or more mutations in a target gene.

[0051] In some embodiments, the stem cell is an induced pluripotent stem (iPS) cell. In some embodiments, the stem cell is an embryonic stem (ES) cell, a somatic (or adult) stem cell, or a mesenchymal stem cell (MSC). In some embodiments, the cell provided by a subject is of any cell type and / or from any tissue of the subject. In some embodiments, the cell provided by a subject is a skin cell, a fibroblast, or a blood cell. In some embodiments, wherein the cell provided by a subject is a skin fibroblast or a peripheral blood mononuclear cell (PBMC). In some embodiments, the cell provided by a subject is a urinary cell, a kidney epithelial cell, a hair follicle or dermal papilla cell.

[0052] In some embodiments, the cell derived from a stem cell is an ocular cell. In some embodiments, the ocular cell is a retinal pigment epithelial (RPE) cell, a photoreceptor cell (PRC, including rod cells, cone cells, and photoreceptor progenitor cells), a retinal cell, a corneal cell, a corneal epithelial cell (CEC), an optic nerve cell, a lens cell, a choroidal endothelial (CE) cell, an optic nerve cell, or a choroidal cell. In some embodiments, the cell derived from a stem cell is a neuronal cell.

[0053] In some embodiments, the mutation is endogenous to the subject. In some embodiments, the mutation is exogenous to the subject. In some embodiments, the mutation is artificially introduced via genetic editing or genetic manipulation. In some embodiments, the cell line comprises a plurality of mutations that are endogenous and / or exogenous to the subject.

[0054] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0055] In some embodiments, the target gene comprises a gene set forth in Table 4. In some embodiments, the target gene comprises a mutated or defective CYP4V2, CYP1B1, MY07A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A gene, or a CYP4V2, CYP1B1, MY07A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A gene encoding a protein having a defective or partial function or activity. In some embodiments, the target gene is CYP4V2.

[0056] In some embodiments, the cell line comprises iPS cells. In some embodiments, the cell line comprises iPS-RPE cells. In some embodiments, the cell line comprises iPS- photoreceptor (iPS-PRC) cells, iPS-corneal epithelial (iPS-CEC) cells, iPS- choroidal endothelial (CE) cells, iPS-corneal cells, iPS-choroidal cells, iPS- optic nerve cells, iPS-ocular cells, or iPS-neuronal cells. In some embodiments, the CYP4V2 mutation in the cell line is endogenous to the subject. In some embodiments, the subject has a pathogenic mutation in the CYP4V2 gene or in an ortholog of the CYP4V2 gene.

[0057] In some embodiments, the subject has at least one mutation set forth in Table 1. In some embodiments, the subject has inherited retinal degeneration (IRD) or retinitis pigmentosa (RP). In some embodiments, the subject has crystalline retinitis pigmentosa (BCD, also known as Bietti's crystalline corneal dystrophy, Bietti's crystalline retinal dystrophy, Bietti's crystalline retinopathy) or is at risk of developing BCD.

[0058] In some embodiments, the cell line comprises a CYP4V2 mutation that is exogenous to the subject and artificially introduced via gene editing or genetic manipulation.

[0059] In some embodiments, the cell line comprises iPS cells, ES cells, MSCs, or adult stem cells, or RPE cells, photoreceptor cells, corneal epithelial cells, choroidal endothelial (CE) cells, or choroidal cells derived from iPS cells, ES cells, MSCs, or adult stem cells. In some embodiments, the iPS cells or other types of stem cells are characterized by one or more of the following: a. unique morphology of iPS, ES, or MSCs; b. one or more pluripotency markers such as Oct-4, Sox-2, SSEA4, TRA-1-60, TRA-1-81, NANOG, and AP; c. ability to differentiate into a desired cell type (e.g., RPE); and / or d. terotoma assay.

[0060] In some embodiments, the iPS-RPE cells or RPE cells derived from other types of stem cells are characterized by: a. morphology: pigmented and hexagonal, and / or b. one or more of the following biomarkers: retinaldehyde-binding protein 1 (RLBP1, also known as CRALBP), RPE65, BESTROPHIN-1, MITF, LRAT, RDH5, PAX6, MERTK, TYR, ZO-1, and / or VINCULIN.

[0061] In another aspect, a BCD human cell model or CYP4V2 functional cell model is provided. Such models include iPS cells or iPS cell lines comprising cells or cell lines derived from a BCD patient or iPS cells or iPS cell lines or iPS-RPE cells or iPS-RPE cell lines derived from cells or cell lines with artificially introduced CYP4V2 mutations.

[0062] In some embodiments, the cell line has an abnormal biochemical profile in one or more of the following groups of compounds compared to a corresponding cell line of a healthy control group: (i) fatty acids, (ii) ceramides, (iii) sphingomyelin, (iv) sphingosine, (v) dihydrosphingosine, or (vi) hydroxy-fatty acids. In some embodiments, the cell line has an abnormal biochemical profile in one or more of the compounds set forth in Table 2 compared to a corresponding cell line of a healthy control group.

[0063] Methods of making cell disease models:

[0064] In another aspect, a method of making a BCD disease model derived from iPS is provided. Such methods include: obtaining cells from a subject having an endogenous mutation in the CYP4V2 gene, or are obtained without an endogenous mutation in the CYP4V2 gene but with an exogenous CYP4V2 mutation artificially introduced via gene editing or genetic manipulation at any of this stage or below; inducing pluripotency in the cells or reprogramming the cells to generate iPSCs; culturing the iPSCs under conditions that cause the iPSCs to differentiate into a desired ocular cell, thereby generating an ocular cell line derived from iPS.

[0065] In some embodiments, the cells obtained from the subject are somatic cells. In some embodiments, the cells obtained from the subject are skin cells, fibroblasts, blood cells, peripheral blood mononuclear cells (PBMCs), or ocular cells. In some embodiments, the cells obtained from the subject are urological cells, kidney epithelial cells, hair follicle or dermal papilla cells. In some embodiments, the ocular cells are retinal pigment epithelial (RPE) cells, corneal epithelial cells (CECs), photoreceptor cells (PRCs), choroidal endothelial (CE) cells, optic nerve cells, retinal cells, corneal cells, or choroidal cells. In some embodiments, the cells are induced to pluripotency or reprogrammed using one or more of OCT4, SOX2, KLF4, and c-MYC transcription factors.

[0066] In some embodiments, the mutation is pathological. In some embodiments, the cell line comprises one or more of the mutations set forth in Table 1. In some embodiments, the cell line is heterozygous for the mutation. In some embodiments, the cell line is homozygous for the mutation.

[0067] In some embodiments, the cellular disease model displays an abnormal level of one or more compounds from the group of (i) fatty acids, (ii) ceramides, (iii) sphingomyelin, (iv) sphingosine, (v) dihydrosphingosine, or (vi) hydroxy-fatty acids, as compared to the level in a relevant cell line of a healthy control group. In some embodiments, the cellular disease model displays an abnormal level of one or more compounds set forth in Table 2, as compared to the level in a relevant cell line of a healthy control group.

[0068] Biochemical analysis methods:

[0069] In one aspect, a method of discovering an abnormality or phenotype in a disease cell model is provided. Such a method generally comprises assessing and comparing the level of one or more compounds between a patient cell line (or a cell line genetically edited or manipulated to comprise in the gene an exogenous mutation that causes the disease) and a cell line of a healthy control group, wherein the one or more compounds are selected from the group consisting of (i) fatty acids, (ii) ceramides, (iii) sphingomyelin, (iv) sphingosine, (v) dihydrosphingosine, and / or (vi) hydroxy-fatty acids.

[0070] In some embodiments, one or more of the compounds evaluated are set forth in Table 2. In some embodiments, identification and / or evaluation of compound levels is performed using LC-MS, LC-MS / MS, GC-MS, GC-MS / MS, and / or FIA-MS / MS. In some embodiments, the disease cell model comprises a mutated or defective gene set forth in Table 4. In some embodiments, the disease cell model comprises a mutated or defective gene in the following genes: CYP4V2, CYP1B1, MY07A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPAl, OP A3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A gene.

[0071] Methods using a bcd cell model (drug, dose, and device screening)

[0072] In another aspect, a method of screening a test agent for therapeutic efficacy against BCD is provided. Such a method generally comprises: contacting cells from an iPS-RPE cell line derived from a BCD patient or from an iPS-RPE cell line comprising a mutated or defective CYP4V2 gene because of artificial genetic editing or manipulation with a test agent; and evaluating the cells for: a normalization of the level of one or more compounds set forth in Table 2 compared to before contacting the test agent; an increase in a non-defective CYP4V2 nucleic acid sequence in the cells; an increase in the amount of CYP4V2 polypeptide in the cells; and / or an improved cellular structure, morphology, or function; wherein a normalization of the level of one or more compounds set forth in Table 2 compared to before treatment with the test agent; an increase in a non-defective CYP4V2 nucleic acid sequence in the cells; an increase in the amount of CYP4V2 polypeptide in the cells; and / or an improved cellular structure, morphology, or function, indicates that the test agent exhibits therapeutic efficacy against BCD.

[0073] In some embodiments, the test agent is selected from the group consisting of a nucleic acid or analog thereof, a vector containing a nucleic acid sequence or encoding a polypeptide, a polypeptide or analog thereof, an antibody, a chemical, a small molecule, and / or any combination thereof. In some embodiments, the cells are evaluated using PCR techniques, immunoassays, sequencing, biochemical assays, functional assays, microscopy, or a combination thereof.

[0074] In another aspect, a method of screening formulations, vehicles, or constructs comprising a test agent for BCD for efficacy or efficiency is provided. Such a method generally comprises: contacting a plurality of cell samples from an iPS-RPE cell line derived from a BCD patient or from an iPS-RPE cell line comprising a mutated or defective CYP4V2 gene as a result of artificial genetic editing or manipulation with a test agent formulated or packaged in various formulations, vehicles, or constructs; and evaluating the cell samples for: standardization of the levels of one or more compounds set forth in Table 2 as compared to before treatment with the test agent and / or as compared to cell samples treated with the same test agent but formulated or packaged in different formulations, vehicles, or constructs; increase in a non-defective CYP4V2 nucleic acid sequence in the cells; increase in the amount of CYP4V2 polypeptide in the cells; improved cellular structure, morphology, or function; and / or cell tolerance or death, to determine and compare the efficiency or efficacy of the formulations, vehicles, or constructs; wherein the cells are evaluated using PCR techniques, immunoassays, sequencing, biochemical assays, cell viability assays, microscopy, or a combination thereof.

[0075] In one aspect, a method of screening test agents for BCD for effective and safe dosage ranges is provided. Such a method generally comprises: contacting a plurality of cell samples from an iPS-RPE cell line derived from a BCD patient or from an iPS-RPE cell line comprising a mutated or defective CYP4V2 gene as a result of artificial genetic editing or manipulation with a test agent at different dosages for each cell sample; evaluating the cell samples for: standardization of the levels of one or more compounds set forth in Table 2 as compared to before treatment with the test agent and / or as compared to cell samples treated with the same test agent but at different dosages; increase in a non-defective CYP4V2 nucleic acid sequence in the cells; increase in the amount of CYP4V2 polypeptide in the cells; improved cellular structure, morphology, or function; and / or cell tolerance or death, to determine and compare the effectiveness and safety of different dosages, thereby determining the appropriate dosage range; wherein the cells are evaluated using PCR techniques, immunoassays, sequencing, biochemical assays, cell viability assays, functional assays, microscopy, or a combination thereof.

[0076] In another aspect, a method of screening a delivery device or method for delivering a therapeutic agent to the retina or retinal cells or assessing its efficacy or efficiency is provided. Such a method generally comprises: (i) contacting a cell sample from an iPS-RPE cell line derived from a BCD patient or from an iPS-RPE cell line that comprises a mutated or defective CYP4V2 gene as a result of artificial genetic editing or manipulation with a test agent without employing the delivery device or method; (ii) contacting another cell sample from an iPS-RPE cell line derived from a BCD patient or from an iPS-RPE cell line that comprises a mutated or defective CYP4V2 gene as a result of artificial genetic editing or manipulation with the same dose of the test agent as in (i) employing the delivery device or method; (iii) assessing and comparing the cell samples from (i) and (ii) for: standardization of the level of one or more compounds set forth in Table 2 as compared to before treatment with the test agent and / or treatment with the same test agent but without employing the delivery device or method, but with the same dose; increase in the number of defective CYP4V2 nucleic acid sequences in the cells; increase in the amount of CYP4V2 polypeptide in the cells; improved cellular structure, morphology, or function; cell tolerance or death; and / or level of the test agent in the cells, to determine the efficacy or efficiency of the delivery device or technology; wherein the cells are assessed using PCR techniques, immunoassays, sequencing, biochemical assays, functional assays, microscopy, or a combination thereof.

[0077] In some embodiments, the retinal cell is an RPE cell.

[0078] CRISPR gene editing therapy

[0079] In one aspect, a composition is provided comprising: (a) a CRISPR guide RNA targeting a nucleic acid sequence within 100 bp or 100 bp of the CYP4V2 gene ("target sequence"), and (b) a functional CRISPR-associated protein (Cas). In some embodiments, such a composition can further comprise (c) a donor nucleic acid sequence comprising all or a portion of a wild-type sequence or functional sequence of the CYP4V2 gene for correcting, disrupting, or replacing the CYP4V2 gene or a portion thereof.

[0080] In some embodiments, one or more components thereof are provided as a DNA molecule encoding the component, an mRNA molecule encoding the component, an RNA molecule, a polypeptide, and / or a ribonucleoprotein (RNP) or protein-RNA complex. In some embodiments, two or more components thereof are in separate molecules or combined in one molecule or one complex, in separate vectors or combined in one vector, in one or more nucleic acid complexes, in one or more RNP complexes. In some embodiments, the donor nucleic acid sequence is provided as a single-stranded donor oligonucleotide (ssODN) or in a vector. In some embodiments, the vector is a plasmid, a recombinant AAV vector, a recombinant lentivirus vector, and / or combinations thereof.

[0081] In some aspects, a composition comprising a cell having a pathogenic CYP4V2 mutation is provided, comprising any of the compositions described herein. In some embodiments, (a) the CRISPR guide RNA comprises (i) a CRISPR RNA (crRNA) comprising a protospacer element sequence complementary to a target sequence within 100 bp or 100 bp of a target gene ("target gene") and a sequence corresponding to a complementarity region of a trans-activating crRNA (tracrRNA), and (ii) a tracrRNA comprising a region complementary to a corresponding region of the crRNA and a sequence that interacts with CRISPR-associated protein 9 (Cas9), and (b) the functional CRISPR-associated protein comprises Cas9.

[0082] In some embodiments, the protospacer element is about 20 bases, about 19 bases, about 21 bases, about 19-21 bases, about 18-22 bases, or about 16-24 bases. In some embodiments, the crRNA and the tracrRNA are in separate molecules. In some embodiments, the crRNA and the tracrRNA are combined into a single guide RNA (sgRNA). In some embodiments, the sgRNA is about 88-150 bp.

[0083] In some embodiments, the Cas9 comprises a Cas9 ortholog or mutant Cas9 selected from the group consisting of: Streptococcus pyogenes (SpCas9), SpCas9 nickase (Cas9n D10A), SpCas9 (D1135E), eSpCas9, SpCas9-HFl, SpCas9 VRER, SpCas9 VQR, SpCas9 EQR, Staphylococcus aureus (SaCas9), Neisseria Meningitidis, Streptococcus thermophilus, Streptococcus pneumnoniae, Campylobacter coli, Campylobacter jejuni, Streptococcus mutans, Pasteurella multocida, Bifidobacterium longum, Bacillus smithii, Treponema denticola, mycoplasma canis, and enterococcus faecalis. In some embodiments, the CRISPR-associated protein Cas9 or Cpf1 further comprises one, two, three or more nuclear localization sequences (NLS) at the N-terminus and / or C-terminus, and / or a selection marker, including but not limited to GFP or EGFP.

[0084] In some embodiments, (a) the CRISPR guide RNA comprises a crRNA comprising a protospacer element sequence complementary to a target sequence within 100 bp or 100 bp of a target gene, and (b) the functional CRISPR-associated protein comprises Cpf1. In some embodiments, the protospacer element is about 20 bases, about 21 bases, about 22 bases, about 23 bases, about 24 bases, about 19-25 bases, about 18-26 bases, or about 16-28 bases.

[0085] In some embodiments, the protospacer element sequence is selected from the group consisting of SEQ ID NOs: 48-52, or shares at least 85% sequence identity with one of SEQ ID NOs: 48-52, for use with a Cas protein having NGG as a protospacer adjacent motif (PAM) to target the c.802-8_810del17insGC mutation of the CYP4V2 gene. In some embodiments, the donor nucleic acid sequence is selected from SEQ ID NOs: 56 and 57 (which are two donor template sequences) or shares at least 90% sequence identity with one of SEQ ID NOs: 56 and 57, or the complement thereof, for correcting, disrupting, or replacing the c.802-8_810del17insGC mutation of the CYP4V2 gene.

[0086] Method claims for CRISPR gene therapy

[0087] In another aspect, a method of treating or preventing BCD in a subject or cell having a mutated CYP4V2 gene is provided. Such a method comprises (i) identifying a pathogenic mutation in the subject or the cell via sequencing; (ii) finding Cas-related PAM sites within a region spanning from about 100 bp upstream of the first nucleotide involved in the mutation to about 100 bp downstream of the last nucleotide involved in the mutation; (iii) identifying various protospacer element sequences targeting the CYP4V2 sequence associated with each PAM site identified in (ii); (iv) assessing the level of activity and off-target editing profile of each CRISPR guide RNA comprising the protospacer element sequences identified in (iii) based on the protospacer element sequence and PAM; (v) selecting one or more CRISPR guide RNA designs based on (iv); (vi) designing one or more donor nucleic acid sequences for correcting, disrupting, or replacing the targeted CYP4V2 mutation based on homology-directed repair (HDR); (vii) constructing the CRISPR guide RNA, Cas, and donor nucleic acid sequence as provided in the composition claims 1-18; (viii) optionally verifying and further selecting the components of (vii) in a cell isolated from the subject, or an iPS cell derived from the subject or a cell differentiated from a stem cell derived from the subject, or a genomic DNA isolated from the subject or a cell isolated or derived therefrom, to assess the level of activity and / or off-target editing profile; and (ix) administering the components in (viii) to the subject or the cell via a delivery system selected from the group consisting of ribonucleoprotein or protein-RNA complex, vector, protein, nucleic acid molecule, nanoparticle, liposome, micelle, virosome, nucleic acid complex, and / or combinations thereof, wherein the delivery is by electroporation or via lipid-mediated transfection or nucleofection or viral transduction or injection or combinations thereof; (x) wherein, with respect to treatment in a cell in vitro, optionally adding or adding up a selection marker in the components in (viii), including but not limited to GFP, EGFP, or puromycin resistance.

[0088] In one aspect, a gene editing composition is provided for correcting or replacing a c.802-8_810del17insGC mutation in the CYP4V2 gene in a subject in vivo or in a cell in vitro. Such compositions generally include: (i) a CRISPR guide RNA comprising a protospacer element sequence selected from one of SEQ ID NOs: 48-52 or sharing at least 80% sequence identity with one of the sequences in SEQ ID 48-52; (ii) a donor nucleic acid sequence selected from one of SEQ ID NOs: 56 and 57, or sharing at least 90% sequence identity with one of SEQ ID NOs: 56 and 57 or the complement thereof; and (iii) a Cas9 protein (an exemplary sequence is shown in SEQ ID NO: 58) optionally containing 1, 2, 3 or more NLS, and / or a selection marker including but not limited to GFP or EGFP.

[0089] In some embodiments, an optional nucleotide G is added before the protospacer element sequence. In some embodiments, the CRISPR guide RNA comprises a crRNA (an exemplary sequence (not including the 5' protospacer element sequence) is shown in SEQ ID NO: 53) and a tracrRNA (an exemplary sequence is shown in SEQ ID NO: 54); and the protospacer element sequence is included in the crRNA. In some embodiments, the CRISPR guide RNA comprises a single guide RNA (sgRNA) containing the protospacer element sequence (an exemplary sgRNA sequence (not including the 5' protospacer element sequence) is shown in SEQ ID NO: 55).

[0090] In some embodiments, one or more components of (i), (ii), and (iii) are provided in the form of a DNA molecule encoding the component, an mRNA molecule encoding the component, a nucleic acid molecule, a vector, an RNA molecule, a polypeptide, a ribonucleoprotein (RNP), or a protein-RNA complex, and / or combinations thereof.

[0091] Therapeutic claims for BCD cell therapy, ocular disease autologous cell therapy, and combinations

[0092] BCD cell therapy

[0093] Allogenic or autologous cell therapy for BCD with gene correction

[0094] In some aspects, a method of treating or preventing an ocular disease in a subject is provided, wherein the disease is associated with a pathological genetic or epigenetic alteration in the CYP4V2 gene. Such methods generally include administering to the subject a cell composition, wherein the cell composition comprises: retinal pigment epithelial (RPE) cells, photoreceptors or photoreceptor progenitor cells (PRCs), corneal epithelial cells (CECs), choroidal endothelial (CE) cells, and / or other ocular cells derived from stem cells.

[0095] In some embodiments, the stem cell is an embryonic stem (ES) cell, an iPC cell, a MSC, an adult stem cell, or a tissue-specific stem cell. In some embodiments, the stem cell is from or derived from one or more subjects that do not have BCD or do not have a pathological CYP4V2 gene. In some embodiments, the stem cell is from or derived from one or more subjects that have a pathological mutation in the CYP4V2 gene. In some embodiments, the subject is a human individual.

[0096] Autologous cell therapy for gene repair of BCD

[0097] In another aspect, a cell composition is provided that comprises (a) a stem cell reprogrammed from a cell isolated from a subject having BCD or a pathological mutation in the CYP4V2 gene or a stem cell isolated from the subject, or (b) a cell differentiated from a stem cell isolated from a subject having BCD or a pathological mutation in the CYP4V2 gene or reprogrammed from a cell isolated from the subject.

[0098] In some embodiments, the stem cell reprogrammed from a cell isolated from the subject is an iPC cell. In some embodiments, the iPS cell is reprogrammed from any cell of any tissue of the subject. In some embodiments, the iPS cell is reprogrammed from a skin cell, a blood cell, a urinary tract cell, a hair cell, a fibroblast, a peripheral blood mononuclear cell (PBMC), a kidney epithelial cell, a hair follicle or dermal papilla cell. In some embodiments, the stem cell isolated from the subject is a MSC, an adult stem cell, or a tissue-specific stem cell. In some embodiments, the cell differentiated from the stem cell is an ocular cell. In some embodiments, the cell differentiated from the stem cell is an RPE cell, a PRC, a retinal cell, a corneal cell, a choroidal cell, a CEC, or a CE cell. In some embodiments, the cell differentiated from the stem cell is an iPS-RPE, an iPS-PRC, an iPS-CEC, or an iPS-CE cell.

[0099] In some embodiments, the cells are genetically repaired to improve the effects of a mutated CYP4V2 gene: (i) cells isolated from a subject having BCD or having a pathologic mutation in the CYP4V2 gene for reprogramming into iPSCs; (ii) stem cells isolated from a subject having BCD or having a pathologic mutation in the CYP4V2 gene or iPSCs reprogrammed from cells isolated from the subject; or (iii) cells differentiated from stem cells isolated from a subject having BCD or having a pathologic mutation in the CYP4V2 gene or cells differentiated from iPSCs reprogrammed from cells isolated from the subject. In some embodiments, the genetic repair is performed prior to reprogramming into iPSCs. In some embodiments, the genetic repair is performed after reprogramming into iPSCs. In some embodiments, the genetic repair is performed prior to differentiation of the stem cells or iPSCs. In some embodiments, the genetic repair is performed after differentiation of the stem cells or iPSCs. In some embodiments, the genetic repair is via gene transfer therapy. In some embodiments, the genetic repair is via gene transfer therapy by using any of the compositions or methods of any of the gene therapy claims. In some embodiments, the genetic repair is via gene editing. In some embodiments, the genetic repair is via gene editing by using any of the compositions or methods of any of the CRiSPR gene therapy claims.

[0100] In another aspect, a method of treating or preventing an ocular disease in a subject having BCD or having a pathologic genetic or epigenetic alteration in the CYP4V2 gene is provided. Such methods generally include administering to the subject any of the CYP4V2 autologous cell compositions described herein, wherein the cell composition includes: retinal pigment epithelial (RPE) cells, photoreceptors or photoreceptor progenitor cells (PRCs), corneal epithelial cells (CECs), choroidal endothelial (CE) cells, and / or other ocular cells derived from stem cells of the subject.

[0101] In some embodiments, the stem cells are iPC cells, MSCs, adult stem cells, or tissue-specific stem cells. In some embodiments, the iPSCs are reprogrammed using one or more of the OCT4, SOX2, KLF4, and c-MYC transcription factors. In some embodiments, the genetically repaired cells exhibit one or more of the following as compared to prior to the genetic repair: a normalization of the level of one or more of the compounds set forth in Table 2; an increase in the number of non-defective CYP4V2 nucleic acid sequences in the cells; an increase in the amount of functional CYP4V2 polypeptide in the cells; and / or improved cellular structure, morphology, or function.

[0102] In some embodiments, the amount of cells administered in a single administration is about 1,000 to about 100 million cells. In some embodiments, administration is via injection. In some embodiments, administration is via subretinal injection. In some embodiments, administration is via intravitreal injection. In some embodiments, administration is via direct retinal injection. In some embodiments, administration is via corneal injection. In some embodiments, administration is by any other method of administration effective to deliver the cells to a subretinal location, posterior segment, or cornea of the eye of the subject. In some embodiments, cells are administered via injection of a cell suspension. In some embodiments, cells are administered as a sheet, matrix, scaffold, or part of a tissue.

[0103] In some embodiments, the subject is a human subject.

[0104] Autologous cell therapy for gene repair for ocular disease

[0105] In another aspect, a cell composition is provided comprising (a) a stem cell reprogrammed from a cell isolated from a subject affected by a disease caused by a mutated or defective gene or a gene encoding a protein having defective or partial function or activity, or a stem cell isolated from the subject, or (b) a cell differentiated from a stem cell isolated from a subject affected by a disease caused by a mutated or defective gene or a gene encoding a protein having defective or partial function or activity, or a stem cell reprogrammed from a cell isolated from the subject.

[0106] In some embodiments, the stem cell reprogrammed from a cell isolated from the subject is an iPS cell. In some embodiments, the iPS cell is reprogrammed from any cell of any tissue of the subject. In some embodiments, the iPS cell is reprogrammed from a skin cell, a blood cell, a urinary tract cell, a hair cell, a fibroblast, a peripheral blood mononuclear cell (PBMC), a kidney epithelial cell, a hair follicle or dermal papilla cell. In some embodiments, the stem cell isolated from the subject is a MSC, an adult stem cell, or a tissue-specific stem cell.

[0107] In some embodiments, the gene is involved in the development or function of the eye that causes or is a risk factor for an ocular disease and / or a mutation thereof. In some embodiments, the gene is involved in the development or function of neurons that causes or is a risk factor for a neurodegenerative disease and / or a mutation thereof. In some embodiments, the gene is a cytochrome P450 gene. In some embodiments, the gene is a gene set forth in Table 4.

[0108] In some embodiments, the gene comprises a mutated or defective CYP4V2, CYP1B1, MY07A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A gene, or a CYP4V2, CYP1B1, MY07A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A gene that encodes a protein with defective or partial function or activity.

[0109] In some embodiments, the cell differentiated from the stem cell is any type of cell. In some embodiments, the cell differentiated from the stem cell is an ocular cell. In some embodiments, the cell differentiated from the stem cell is an RPE cell, a PRC, a retinal cell, a corneal cell, a choroidal cell, a CEC, a CE cell, or an optic nerve cell. In some embodiments, the cell differentiated from the stem cell is an iPS-RPE, an iPS-PRC, an iPS-CEC, or an iPS-CE cell. In some embodiments, the cell differentiated from the stem cell is a neuron.

[0110] In some embodiments, the gene repair is performed on (i) a cell isolated from a subject affected by a disease caused by a mutated or defective gene or a gene encoding a protein having defective or partial function or activity for reprogramming into an iPSC, (ii) a stem cell isolated from a subject affected by a disease caused by a mutated or defective gene or a gene encoding a protein having defective or partial function or activity or an iPS cell reprogrammed from a cell isolated from the subject, or (iii) a cell differentiated from a stem cell isolated from a subject affected by a disease caused by a mutated or defective gene or a gene encoding a protein having defective or partial function or activity or a cell differentiated from an iPS cell reprogrammed from a cell isolated from the subject.

[0111] In some embodiments, the gene repair is performed prior to reprogramming into an iPS cell. In some embodiments, the gene repair is performed after reprogramming into an iPS cell. In some embodiments, the gene repair is performed prior to differentiation of the stem cell or iPS cell. In some embodiments, the gene repair is performed after differentiation of the stem cell or iPS cell. In some embodiments, the gene repair is via gene transfer therapy. In some embodiments, the gene repair is via gene transfer therapy by using any of the compositions or methods of any of the claims related to gene therapy. In some embodiments, the gene repair is via gene editing therapy. In some embodiments, the gene repair is via gene editing therapy by using any of the compositions or methods of any of the claims related to CRiSPR gene therapy.

[0112] In another aspect, a method of treating or preventing a disease in a subject affected by a disease caused by a mutated or defective gene set forth in Table 4 or a gene encoding a protein having defective or partial function or activity is provided. Such methods generally include administering to the subject an autologous cell composition as described herein, wherein the cell composition comprises: retinal pigment epithelial (RPE) cells, photoreceptors or photoreceptor progenitor cells (PRCs), corneal epithelial cells (CECs), neurons, choroidal endothelial (CE) cells, and / or other ocular cells derived from stem cells of the subject, and wherein the mutated or defective gene in the cell composition has been genetically repaired.

[0113] In another aspect, a method of autologously treating a subject is provided. Such methods generally include (i) providing cells from a subject having an ocular disease; (ii) inducing pluripotency in the cells from the subject to generate iPSCs; (iii) genetically repairing one or more mutations in a mutated or defective gene set forth in Table 4 in iPSCs derived from the subject; (iv) differentiating the iPSCs into ocular cells; (v) as an alternative to step (iii), genetically repairing the iPS-ocular cells via gene transfer therapy; and (vi) introducing the iPS-ocular cells into the subject, thereby autologously treating a subject having an ocular disease.

[0114] In some embodiments, the stem cells are iPC cells, MSCs, adult stem cells, or tissue-specific stem cells. In some embodiments, the iPS cells are reprogrammed using one or more of OCT4, SOX2, KLF4, and c-MYC transcription factors. In some embodiments, the genetically repaired cells exhibit one or more of: an increase in the number of non-defective target gene nucleic acid sequences in the cells; an increase in the amount of functional polypeptides encoded by the target gene in the cells; improved cellular structure, morphology, or function; and / or improved or standardized biochemical function in the cells, as compared to prior to the genetic repair. In some embodiments, the amount of cells administered in a single administration is about 1,000 to about 100 million cells.

[0115] In some embodiments, administration is via injection. In some embodiments, administration is via subretinal injection. In some embodiments, administration is via intravitreal injection. In some embodiments, administration is via direct retinal injection. In some embodiments, administration is via corneal injection. In some embodiments, administration is via any other method of administration that effectively delivers the cells to a subretinal location, posterior segment, or cornea of the eye of the subject. In some embodiments, the cells are administered via injection of a cell suspension. In some embodiments, the cells are administered as part of a patch, matrix, scaffold, or tissue. In some embodiments, a natural and / or synthetic scaffold is used to administer the RPE cells to generate a functional RPE monolayer. In some embodiments, the subject is a human subject.

[0116] In some embodiments, the disease is associated with a genetic or epigenetic alteration or risk factor in the subject. In some embodiments, the disease is photoreceptor degeneration, retinal pigment epithelial cell degeneration, retinal degeneration, corneal degeneration, and / or a chorioretinal disorder. In some embodiments, the disease is inherited retinal degeneration (IRD). In some embodiments, the disease is retinitis pigmentosa (RP). In some embodiments, the disease is Crystalline Retinal Dystrophy (also known as Crystalline Corneal Retinal Dystrophy; BCD). In some embodiments, the disease is associated with neurodegeneration. In some embodiments, the disease is corneal dystrophy. In some embodiments, the subject has BCD or is at risk of developing BCD.

[0117] In some embodiments, the cells are fibroblasts, blood cells, or ocular cells. In some embodiments, the cells are obtained from urine or from hair or hair follicles. In some embodiments, the ocular cells are retinal pigment epithelial (RPE) cells, corneal epithelial cells (CECs), chorioretinal endothelial (CE) cells, or photoreceptor cells (PRCs).

[0118] In some embodiments, the genetic or epigenetic alteration is selected from the group consisting of a mutation, an insertion, a single nucleotide polymorphism, improper methylation, improper demethylation, and combinations thereof. In some embodiments, the genetic or epigenetic alteration is a mutation. In some embodiments, the genetic or epigenetic alteration in the iPS-ocular cells of the subject has been genetically repaired using gene editing. In some embodiments, the gene editing method utilizes zinc finger nucleases, TALEN technology, or CRISPR technology. In some embodiments, the genetic or epigenetic alteration in the iPSC-ocular cells of the subject has been genetically repaired using gene transfer. In some embodiments, the gene transfer method utilizes a recombinant AAV vector or another viral vector or non-viral vector to deliver a healthy copy of the target gene (e.g., a cDNA) to the cells to be transplanted.

[0119] In some embodiments, the administering step occurs before the onset of symptoms of the disease or after the onset of symptoms of the disease. In some embodiments, the administering is to the eye or to another organ or tissue comprising neurons. In some embodiments, the administering is by injection. In some embodiments, the administering is by subretinal or intravitreal injection. In some embodiments, the administering is by direct retinal injection. In some embodiments, the administering is by corneal injection. In some embodiments, the administering is by any other method of administration effective to deliver the cells to a subretinal location, posterior segment, or cornea of the eye of the subject.

[0120] In some embodiments, the method further comprises, prior to administering or transplanting, performing a genotypic analysis of the cells to identify the presence or absence of a genetic or epigenetic alteration in one or more genes set forth in Table 4. In some embodiments, the genetic or epigenetic alteration is a mutation. In some embodiments, the mutation is in a CYP4V2 nucleic acid molecule. In some embodiments, the method further comprises, prior to administering, evaluating the eye of the subject to identify the area and extent of damaged or remaining photoreceptors, retinal cells, or corneal cells.

[0121] In some embodiments, the method further comprises monitoring the subject after administering. In some embodiments, the monitoring comprises performing non-invasive retinal imaging, corneal testing, perimetry, ERG, OCT, visual acuity testing, and / or functional studies. In some embodiments, the monitoring comprises assessing the immune response of the subject. In some embodiments, the method further comprises, after administering, evaluating the eye of the subject to identify the area and extent of damaged or remaining photoreceptors, retinal cells, or corneal cells.

[0122] Cell therapy - RNP claims

[0123] RNP claims

[0124] In another aspect, a composition is provided comprising, in a ribonucleoprotein (RNP) or protein-RNA complex: (a) a CRISPR guide RNA targeting a nucleic acid sequence ("target sequence") within 100 base pairs or 100 base pairs of a target gene ("target gene"), and (b) a functional CRISPR-associated protein.

[0125] In some embodiments, the composition further comprises (c) a donor nucleic acid sequence comprising all or a portion of a wild-type sequence or a functional sequence of a target gene for correcting or replacing the target gene or a portion thereof. In some embodiments, the target gene is involved in eye development or function and / or a mutation thereof causes or is a risk factor for an eye disease. In some embodiments, the target gene is involved in neuronal development or function and / or a mutation thereof causes or is a risk factor for a neurodegenerative disease.

[0126] In some embodiments, the target gene is a cytochrome P450 gene. In some embodiments, the target gene comprises a gene set forth in Table 4 that is mutated or defective, or encodes a protein having defective or partial function or activity. In some embodiments, the donor nucleic acid sequence is provided as a single-stranded donor oligonucleotide (ssODN) or in a vector.

[0127] In some embodiments, (a) the CRISPR guide RNA comprises (i) a CRISPR RNA (crRNA) comprising a protospacer element sequence complementary to a target sequence within 100 bp or 100 bp of a target gene and a sequence corresponding to a complementarity region of a trans-activating crRNA (tracrRNA), and (ii) a tracrRNA comprising a region complementary to a corresponding region of the crRNA and a sequence that interacts with CRISPR-associated protein 9 (Cas9), and (b) the functional CRISPR-associated protein comprises Cas9.

[0128] In some embodiments, the protospacer element is about 20 bases, about 19 bases, about 21 bases, about 19-21 bases, about 18-22 bases, or about 16-24 bases. In some embodiments, the crRNA and the tracrRNA are in different nucleic acid molecules. In some embodiments, the crRNA and the tracrRNA are combined into a single guide RNA (sgRNA). In some embodiments, the sgRNA is about 88-150 bp.

[0129] In some embodiments, the Cas9 comprises a Cas9 ortholog or mutant Cas9 selected from the group consisting of: S. pyogenes (SpCas9), SpCas9 nickase (Cas9n D10A), SpCas9 (D1135E), eSpCas9, SpCas9-HFl, SpCas9 VRER, SpCas9 VQR, SpCas9 EQR, S. aureus (SaCas9), N. meningitidis, S. thermophilus, S. pneumoniae, C. difficile, C. jejuni, S. mutans, B. brochiseptica, B. longum, B. smithii, T. denticola, M. canis, and E. faecalis.

[0130] In some embodiments, (a) the CRISPR guide RNA comprises a crRNA comprising a protospacer element sequence complementary to a target sequence within 100 bp or 100 bp of a target gene, and (b) the functional CRISPR-associated protein comprises Cpf1. In some embodiments, the protospacer element is about 20 bases, about 21 bases, about 22 bases, about 23 bases, about 24 bases, about 19-25 bases, about 18-26 bases, or about 16-28 bases. In some embodiments, the CRISPR-associated protein Cas9 or Cpf1 further comprises one, two, three or more nuclear localization sequences (NLS) at the N-terminus and / or C-terminus, and / or a selectable marker, including but not limited to GFP or EGFP.

[0131] In some embodiments, the protospacer element is 100% complementary to the target sequence or contains 1, 2, 3, 4, or 5 nucleotide mismatches corresponding to the target sequence. In some embodiments, the crRNA sequence further comprises a G nucleotide, which is optionally added to the crRNA sequence immediately preceding the protospacer element. In some embodiments, the CRISPR guide RNA, crRNA, and / or tracrRNA or sgRNA is chemically modified.

[0132] In some embodiments, for a donor nucleic acid sequence provided as an ssODN, the donor nucleic acid sequence is no more than about 1 kb, 800 bp, 600 bp, 500 bp, 400 bp, 300 bp, 280 bp, 260 bp, 240 bp, 220 bp, or 200 bp; and for a donor nucleic acid sequence provided as a vector, the donor nucleic acid sequence is no more than about 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, 9 kb, 8 kb, 7 kb, 6 kb, 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 0.5 kb, 0.2 kb, or 0.1 kb. In some embodiments, the wild-type form of the target gene encodes an enzyme.

[0133] In some embodiments, the target gene comprises a mutated or defective CYP4V2, CYP1B1, MY07A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A gene, or a CYP4V2, CYP1B1, MY07A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A gene encoding a protein having a defective or partial function or activity.

[0134] In some embodiments, any one or more components thereof, including the CRISPR guide RNA, the CRISPR-associated protein, and / or the donor nucleic acid sequence, is provided individually and / or additionally in a vector, DNA, and / or mRNA capable of being transcribed and / or translated into the component. In one aspect, a pharmaceutical formulation comprising any of the compositions described herein is provided.

[0135] In another aspect, a method of treating a disease in a subject caused by a mutated or defective gene or a gene encoding a protein having defective or partial function or activity is provided. Such a method comprises disrupting, correcting, or replacing the gene by administering to the subject any of the compositions described herein.

[0136] In another aspect, a method of treating an ocular disease in a subject caused by a mutated or defective gene or a gene encoding a protein having defective or partial function or activity or improving a risk factor associated therewith is provided. Such a method comprises disrupting, correcting, or replacing the gene by administering to the subject any of the compositions described herein.

[0137] In another aspect, a method of treating a neurodegenerative disease in a subject caused by a mutated or defective gene or a gene encoding a protein having defective or partial function or activity or improving a risk factor associated therewith is provided. Such a method comprises disrupting, correcting, or replacing the gene by administering to the subject any of the compositions described herein.

[0138] In another aspect, a method of treating a disease in a subject caused by a mutated or defective cytochrome P450 gene or a gene encoding a protein having defective or partial function or activity or improving a risk factor associated therewith is provided. Such a method comprises disrupting, correcting, or replacing the gene by administering to the subject any of the compositions described herein.

[0139] In some embodiments, the mutated or defective gene or gene encoding a protein having defective or partial function or activity that is disrupted, corrected, or replaced is a mutated or defective form of a gene set forth in Table 4 or a form of a gene set forth in Table 4 encoding a protein having defective or partial function or activity. In some embodiments, the mutated or defective gene or gene encoding a protein having defective or partial function or activity is present in a fibroblast cell, a blood cell, an RPE cell, a photoreceptor cell, a retinal cell, a corneal cell, a choroidal cell, an ocular cell, an optic nerve cell, a neuronal cell, or a stem cell or any type of cell derived from a stem cell.

[0140] In some embodiments, the composition therein is delivered to a fibroblast cell, a blood cell, an RPE cell, a photoreceptor cell, a retinal cell, a corneal cell, a choroid cell, an ocular cell, an optic nerve cell, a neuronal cell, or a stem cell or any type of cell derived from a stem cell. In some embodiments, the delivery is by electroporation or via lipid-mediated transfection or nucleofection or viral transduction or injection or a combination thereof. In some embodiments, any one or more components thereof, including a CRISPR guide RNA, a CRISPR-associated protein, and / or a donor nucleic acid sequence, is administered to the subject or to the cells via a delivery system selected from the group consisting of a ribonucleoprotein or protein-RNA complex, a nanoparticle, a liposome, a micelle, a virion, a nucleic acid complex, and / or a combination thereof.

[0141] In some embodiments, the treatment is performed in vivo in a subject. In some embodiments, the treatment is performed in vitro in a fibroblast cell, a blood cell, an RPE cell, a photoreceptor cell, a retinal cell, a corneal cell, a choroid cell, an ocular cell, an optic nerve cell, a neuronal cell, or a stem cell or any type of cell derived from a stem cell. In some embodiments, the treated cell is transplanted in vivo into a subject, or if the treated cell is a stem cell, the stem cell is differentiated into a desired type of cell for transplantation, and then the differentiated cell is transplanted in vivo into a subject.

[0142] In some embodiments, the mutated or defective gene or gene encoding a protein having defective or partial function or activity is replaced. In some embodiments, one or more mutations in the mutated or defective gene or gene encoding a protein having defective or partial function or activity are corrected or replaced. In some embodiments, the mutated or defective gene or gene encoding a protein having defective or partial function or activity is disrupted.

[0143] In some embodiments, 1-20, 21-40, 41-60, 61-80, 81-100, 101-1000, 1001-10000 base pairs of nucleotides or mutations in the mutated or defective gene or gene encoding a protein having defective or partial function or activity are disrupted, corrected, or replaced. In some embodiments, a region of the mutated or defective gene or gene encoding a protein having defective or partial function or activity is disrupted, corrected, or replaced. In some embodiments, a region of less than about 10, 8, 6, 4, 2, or 1 kb of the mutated or defective gene or gene encoding a protein having defective or partial function or activity is disrupted, corrected, or replaced.

[0144] In some embodiments, the mutated or defective gene or gene encoding a protein having defective or partial function or activity is disrupted, corrected, or replaced via insertion and / or deletion of nucleotides. In some embodiments, the mutated or defective gene or gene encoding a protein having defective or partial function or activity is disrupted, corrected, or replaced in one allele or in two alleles. In some embodiments, two or more different CRISPR guide RNAs, CRISPR-associated proteins, and / or donor nucleic acid sequences are used to disrupt, correct, or replace one or more mutations or defects in the mutated or defective gene or gene encoding a protein having defective or partial function.

[0145] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the method improves development or function of the eye, or prevents degeneration of the eye, retina, or cornea. In some embodiments, the method improves development or function of the nerve, or prevents degeneration of the nerve. In some embodiments, the method improves expression or function of a P450 enzyme.

[0146] In some embodiments, the homology-directed repair based on the donor nucleic acid sequence results in an intron and / or exon of the target gene. In some embodiments, the homology-directed repair based on the donor nucleic acid sequence results in a splice acceptor of the target gene. Such methods can further comprise (c) a donor nucleic acid sequence comprising all or a portion of the target gene set forth in Table 4, having a mutation or alteration for producing a mutated or altered target gene or portion thereof.

[0147] In some aspects, a method of generating a cellular disease model of a disease caused by a mutated or defective gene or gene encoding a protein having defective or partial function or activity is provided by generating a mutation in the gene. Such methods comprise delivering such gene to a healthy form of a cell via any of the compositions described herein. In some embodiments, the delivery is by electroporation or via lipid-mediated transfection or nucleofection or viral transduction or microinjection or a combination thereof. In some embodiments, the cells are fibroblast cells, blood cells, RPE cells, photoreceptor cells, retinal cells, corneal cells, choroid cells, ocular cells, optic nerve cells, neuronal cells, or stem cells or any type of cell derived from stem cells.

[0148] In another aspect, a composition comprising a cell containing a mutated or defective gene set forth in Table 4 is provided.

[0149] In another aspect, a composition is provided comprising a cell comprising a mutated or defective CYP4V2, CYP1B1, MY07A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPAl, OP A3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A gene, the composition comprising the composition of any of the claims herein.

[0150] In some embodiments, the vector is an AAV vector. In some embodiments, the protospacer element sequence is selected from the group consisting of SEQ ID NOs: 48-52, or shares at least 80% sequence identity with one of SEQ ID NOs: 48-52, for use with a Cas protein having NGG as a protospacer adjacent motif (PAM) to target the c.802-8_810del17insGC mutation of the CYP4V2 gene. In some embodiments, the donor nucleic acid sequence is selected from SEQ ID NOs: 56 and 57, or shares at least 90% sequence identity with one of SEQ ID NOs: 56 and 57, or a complement thereof, for correcting, disrupting, or replacing the c.802-8_810del17insGC mutation of the CYP4V2 gene.

[0151] Gene therapy claim

[0152] Codon-optimized sequence-related claim:

[0153] In one aspect, a nucleic acid molecule is provided comprising the nucleic acid sequence of SEQ ID NO: 2 encoding a human CYP4V2 protein or a nucleic acid sequence sharing at least 90% sequence identity with the nucleic acid sequence of SEQ ID NO: 2.

[0154] In another aspect, there is provided an expression cassette comprising a nucleic acid molecule as described herein and one or more regulatory sequences operably linked to the nucleic acid sequence. In another aspect, there is provided a vector comprising a nucleic acid molecule as described herein or an expression cassette as described herein.

[0155] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is selected from the group consisting of a recombinant adenoviral vector, a recombinant lentiviral vector, a recombinant herpes simplex virus vector, a recombinant sendai virus vector, and a recombinant retroviral vector. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector or a plasmid. In some embodiments, the vector is a plasmid or a non-viral vector. In some embodiments, the non-viral vector is selected from the group consisting of naked nucleic acid, a liposome, a dendrimer, and a nanoparticle.

[0156] In some embodiments, the host cell comprises any of the nucleic acid molecules described herein and / or any of the compositions described herein. In some embodiments, the host cell is a bacterial cell, an E. Coli cell, a plant cell, an insect cell, or a mammalian cell. In some embodiments, the host cell is a HEK293, HeLa, Vero, V27, A549, K562, B50, WI38, Hep G2, or BHK cell.

[0157] In another aspect, any of the nucleic acid molecules described herein, any of the expression cassettes described herein, or any of the vectors described herein are used to express a product encoded by such nucleic acid molecule in a bacterial cell, an insect cell, a plant cell, a mammalian cell, an RPE cell, a photoreceptor or photoreceptor progenitor cell (PRC), a retinal cell, a corneal cell, an ocular cell, a neuron, a neuronal cell, a blood cell, an epithelial cell, a somatic cell, an iPS cell, an ES cell, an MSC, an adult stem cell, a stem cell, or any cell derived from a stem cell.

[0158] EFS and / or SPA related claims

[0159] In another aspect, a self-complementary adeno-associated virus (scAAV) vector is provided, comprising an elongation factor 1 alpha short (EFS) promoter and / or a small polyadenylation (polyA) signal (SPA) operably linked to a nucleic acid molecule, an interfering RNA molecule, or an oligonucleotide encoding a polypeptide. In some embodiments, the EFS promoter consists of a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 35 and the SPA consists of a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 36.

[0160] In some embodiments, the scAAV vector is delivered to a cell such that a product encoded by the nucleic acid molecule is expressed in the cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a retinal cell, a corneal cell, a choroidal cell, an ocular cell, a brain cell, a neuron, a neuronal cell, an iPS cell, an ES cell, an MSC, a stem cell, or any cell derived from a stem cell.

[0161] In one aspect, a method is provided to reduce immune response to viral vectors and maintain transduction efficiency in gene therapy and / or maximize therapeutic effect in different patients with the same genetic disease. Such a method includes (a) establishing a library of more than one recombinant viral vector (e.g., rAAV) that has sufficient transduction efficiency in the target cell type for which the gene therapy is intended. The library of viral vectors can be expanded by generating variants with mutations in the antigenic region or other mutations or variants on the capsid of the viral vectors, and the mutations or variants are confirmed to have sufficient transduction efficiency in the target cells related to the disease (e.g., in iPS-RPE cell lines for CYP4V2 gene therapy for BCD); (b) detecting pre-existing neutralizing anti-viral vector antibodies (NAb) in a subject in need of the gene therapy against different viral vector serotypes and / or capsid mutations or variants, and / or testing and comparing different viral vectors in patient-specific cells (e.g., iPS-RPE cells) derived from the subject; (c) selecting a viral vector from the library of viral vectors that has sufficient transduction efficiency and least cross-reactivity with pre-existing NAb in the subject and / or has the best phenotypic rescue results in patient-specific cells of the subject, the library of viral vectors comprising different serotypes and capsid-modified viral vectors (e.g., including but not limited to capsid mutant AAV and / or capsid protein variant AAV); (d) administering the viral vector selected from (c) to the subject; and (e) repeating (b) to (d) above whenever the subject needs to be administered the gene therapy (only the portion related to pre-existing NAb is repeated), including but not limited to subsequent administration to the same eye or administration to the contralateral eye or to other organs.

[0162] In another aspect, a composition for treating or preventing a disease in a subject is provided, comprising an effective amount of a vector and a pharmaceutically acceptable carrier. The vector typically includes a nucleic acid molecule encoding a non-mutant or functional CYP4V2 protein or a non-pathogenic variant thereof operably linked to a regulatory sequence.

[0163] In some embodiments, the disease is crystalline retinal dystrophy (also known as crystalline corneo-retinal dystrophy; BCD). In some embodiments, the disease is associated with a genetic or epigenetic alteration in the subject. In some embodiments, the disease is photoreceptor degeneration, retinal pigment epithelial cell degeneration, retinal degeneration, corneal degeneration, or choroidal degeneration. In some embodiments, the retinal degeneration is retinitis pigmentosa (RP). In some embodiments, the retinal degeneration is inherited retinal degeneration (IRD). In some embodiments, the disease is BCD. In some embodiments, the disease is corneal dystrophy. In some embodiments, the subject has or is at risk of developing BCD.

[0164] In one aspect, a vector is provided, comprising a nucleic acid molecule encoding a non-mutant or functional CYP4V2 protein, or a non-pathogenic variant thereof, operably linked to a regulatory sequence.

[0165] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is selected from the group consisting of an adeno-associated virus (AAV) vector, an adenovirus vector, a lentivirus vector, a herpes simplex virus vector, a Sendai virus vector, and a retrovirus vector. In some embodiments, the AAV is a recombinant AAV (rAAV). In some embodiments, the rAAV comprises an AAV genome or a derivative thereof, and / or an AAV capsid protein or a derivative thereof. In some embodiments, the rAAV is a chimeric AAV, a shuffled AAV, or a capsid-modified AAV.

[0166] In some embodiments, the AAV genome or the AAV capsid protein is from any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or another naturally derived serotype or isolate or branch (Glade) of AAV, or any derivative or hybrid thereof. In some embodiments, the rAAV is a pseudotyped AAV (e.g., AAV2 / 5, AAV2 / 8, AAV2 / 1, AAV2 / 4, AAV2 / 6, AAV2 / 7, AAV2 / 12, AAV2 / 10, and AAV2 / 9). In some embodiments, the rAAV is a hybrid AAV (e.g., AAV-DJ, AAV-DJ / 8, or AAV-DJ / 9). In some embodiments, the rAAV is developed via directed evolution and / or rational design (e.g., AAV 7m8 or AAV-PHP.B).

[0167] In some embodiments, the rAAV comprises one or more capsid mutations (e.g., Y-F, K-R, T-A, S-A, and / or T-V mutations (e.g., AAV2 with one or more of Y444F, Y500F, Y730F, Y252F, Y272F, Y700F, Y704F, and T491V, or corresponding mutations for different AAV serotypes (e.g., AAV2 / 8 (Y733F), AAV2 (Y444F+Y500F+Y730F), and AAV2 (quad Y-F+T-V))). In some embodiments, the serotype of the rAAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Anc80, rh10, and ShH10. In some embodiments, the rAAV vector is selected from the group consisting of AAV2 / 5, AAV2 / 8, AAV2 / 8 (Y733F), AAV2 (Y444F+Y500F+Y730F), AAV2 / 1, AAV2 / 4, AAV2 / 9, AAV2 / 6, AAV2 / 7, AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, Anc80, AAV 7m8, AAV-DJ, ShH10, AAV-PHP.B, or a hybrid, derivative, or variant thereof.

[0168] In some embodiments, the rAAV vector is a single-stranded AAV vector or a self-complementary AAV (scAAV) vector. In some embodiments, the vector is a plasmid or a non-viral vector (e.g., naked nucleic acid, liposome, dendrimer, and nanoparticle).

[0169] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises: (i) a human CYP4V2 protein (SEQ ID NO: 4); (ii) a variant of a human CYP4V2 protein or a functional CYP4V2 protein (e.g., an altered amino acid and / or a splice variant) (e.g., SEQ ID NO: 5); (iii) one or more fragments of a functional CYP4V2 protein (e.g., SEQ ID NO: 6); (iv) all or a portion of the sequence of one or more of CYP4V2 orthologs from other species; (v) all or a portion of the sequence from one or more other P450 proteins, including but not limited to other CYP4 proteins and CYP46A1; (vi) a polypeptide capable of ameliorating, treating, or suppressing one or more biochemical abnormalities in one or more of the genes listed in Table 4 in patient cells (e.g., iPS-RPE cells of a BCD patient); and / or (vii) a combination of the above.

[0170] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or a portion of the amino acid sequence set forth in SEQ ID NO: 4, 5, or 6. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or a portion of an amino acid sequence selected from the group consisting of CYP4V2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, and CYP46A1 (SEQ ID NOs: 4-18) and derivatives, hybrids, variants, and / or fragments thereof. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or a portion of an amino acid sequence selected from the group consisting of CYP4V2 (or CYP4V2 orthologs) of chimpanzee, rhesus monkey, dog, cow, mouse, rat, chicken, frog, horse, rabbit, and fruit fly (SEQ ID NOs: 19-29) and derivatives, hybrids, variants, and / or fragments thereof.

[0171] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises a polypeptide having at least 80% amino acid sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to any of the sequences selected from the group consisting of SEQ ID NOs: 4-29. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises sequence elements of FxxGxxxCxG and ExxR (SEQ ID NOs: 30 and 31). In some embodiments, the non-mutant or functional CYP4V2 protein is a compound or agent capable of ameliorating, treating, or suppressing one or more biochemical abnormalities in one or more of the genes listed in Table 4 in a patient's cell (e.g., iPS-RPE cells of a BCD patient).

[0172] In some embodiments, the nucleic acid molecule encodes a non-mutant or functional CYP4V2 protein according to any one of claims 43-50. In some embodiments, the nucleic acid molecule encodes a non-mutant or functional CYP4V2 protein comprising the amino acid sequence set forth in SEQ ID NO: 4, 5, or 6, or an amino acid sequence having at least 80% sequence identity to any of SEQ ID NO: 4, 5, or 6. In some embodiments, the nucleic acid molecule has at least 60% sequence identity to any of the sequences in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule has at least 70% sequence identity to any of the sequences in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule has at least 75% sequence identity to any of the sequences in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule has at least 76% sequence identity to any of the sequences in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule comprises the sequence set forth in SEQ ID NO: 1, 2, or 3.

[0173] In some embodiments, the regulatory sequence comprises a promoter. In some embodiments, the promoter is an RPE cell-specific promoter, a retinal cell-specific promoter, a corneal cell-specific promoter, an ocular cell-specific promoter, or a constitutive promoter. In some embodiments, the promoter is a mammalian beta-actin promoter or a viral promoter.

[0174] In some embodiments, the promoter is selected from the group consisting of a CAG promoter (hybrid CMV early enhancer / chicken beta actin promoter, also known as CAGGS promoter, CB promoter, or CBA promoter), a chicken beta actin promoter, a small CBA (smCBA) promoter, CB SB a CAG promoter (hybrid CMV early enhancer / chicken beta actin promoter, also known as CAGGS promoter, CB promoter, or CBA promoter), a chicken beta actin promoter, a small CBA (smCBA) promoter, CB

[0175] In some embodiments, the promoter is a CAG promoter (hybrid CMV early enhancer / chicken beta actin promoter, also known as CAGGS promoter, CB promoter, or CBA promoter), an elongation factor 1 alpha short (EFS) promoter, an elongation factor 1 alpha short (EF-1 alpha) promoter, or a CMV promoter, or a derivative or hybrid thereof. In some embodiments, the regulatory sequence comprises an enhancer.

[0176] In some embodiments, the enhancer is a viral enhancer, including but not limited to a WPRE enhancer, a HPRE enhancer, a CTE enhancer, or a derivative or hybrid thereof. In some embodiments, the regulatory sequence comprises a polyadenylation (polyA) signal. In some embodiments, the polyA signal is a bovine growth hormone polyadenylation signal (bGH polyA), a small polyA signal (SPA), a human growth hormone polyadenylation signal (hGH polyA), an SV40 polyA signal, an SV40 late polyA signal, or a derivative or hybrid thereof. In some embodiments, the regulatory sequence comprises a Kozak sequence (SEQ ID NO: 37 or 38).

[0177] In some embodiments, the composition is formulated with a carrier and additional components suitable for the particular route of administration.

[0178] In another aspect, a host cell comprising any of the vectors described herein is provided.

[0179] In another aspect, a method of treating or preventing an eye disease in a subject is provided, the method comprising administering to the subject a vector, wherein the vector comprises a nucleic acid molecule encoding a human CYP4V2 protein or a functional CYP4V2 protein, or a non-pathogenic variant thereof, operably linked to a regulatory sequence.

[0180] In one aspect, a method of preventing, arresting or slowing progression or improving dysfunction, degeneration, disorder, deterioration and / or death of ocular cells is provided, the method comprising delivering to the ocular cells a vector, wherein the vector comprises a nucleic acid molecule encoding a human CYP4V2 protein or a functional CYP4V2 protein, or a non-pathogenic variant thereof, operably linked to a regulatory sequence.

[0181] In some embodiments, the disease is crystalline retinal pigment degeneration (also known as Bietti's crystalline corneoretinal dystrophy; Bietti's crystalline dystrophy; BCD). In some embodiments, the subject has other ophthalmic clinically defined conditions caused by mutations in the CYP4V2 gene (e.g., inherited retinal degeneration (IRD), retinitis pigmentosa (RP), or corneal dystrophy). In some embodiments, the ocular disease is photoreceptor degeneration, retinal pigment epithelium degeneration, retinal degeneration, corneal dystrophy, or BCD.

[0182] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is selected from the group consisting of a recombinant adeno-associated viral (rAAV) vector, a recombinant adenoviral vector, a recombinant lentiviral vector, a recombinant herpes simplex viral vector, a recombinant Sendai viral vector, and a recombinant retroviral vector. In some embodiments, the viral vector is a rAAV vector. In some embodiments, the rAAV vector comprises a VP1, VP2, or VP3 capsid protein selected from any of the serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or another naturally derived serotype or isolate or branch of AAV, or a hybrid, variant, or derivative thereof.

[0183] In some embodiments, the rAAV vector 5' AAV ITR is selected from any one of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or another naturally derived serotype or isolate or branch of AAV, or a mutation, chimera, variant, or fusion thereof. In some embodiments, the rAAV vector 3' AAV ITR is selected from any one of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or another naturally derived serotype or isolate or branch of AAV, or a mutation, chimera, variant, or fusion thereof. In some embodiments, the rAAV is a chimeric AAV, a rearranged AAV, or a capsid-modified AAV. In some embodiments, the rAAV is a pseudotyped AAV (e.g., AAV2 / 5, AAV2 / 8, AAV2 / 1, AAV2 / 4, AAV2 / 6, AAV2 / 7, AAV2 / 12, AAV2 / 10, and AAV2 / 9). In some embodiments, the rAAV is a hybrid AAV (e.g., AAV-DJ, AAV-DJ / 8, or AAV-DJ / 9). In some embodiments, the rAAV is developed via directed evolution and / or rational design (e.g., AAV 7m8 or AAV-PHP.B).

[0184] In some embodiments, the rAAV comprises one or more capsid mutations (e.g., Y-F, K-R, T-A, S-A, and / or T-V mutations (e.g., AAV2 with one or more of Y444F, Y500F, Y730F, Y252F, Y272F, Y700F, Y704F, and T491V, or corresponding mutations for different AAV serotypes (e.g., AAV2 / 8 (Y733F), AAV2 (Y444F+Y500F+Y730F), and AAV2 (four Y-F+T-V))). In some embodiments, the serotype of the rAAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Anc80, rh10, and ShH10. In some embodiments, the rAAV vector is selected from the group consisting of AAV2 / 5, AAV2 / 8, AAV2 / 8 (Y733F), AAV2 (Y444F+Y500F+Y730F), AAV2 / 1, AAV2 / 4, AAV2 / 9, AAV2 / 6, AAV2 / 7, AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, Anc80, AAV 7m8, AAV-DJ, ShH10, AAV-PHP.B, or a hybrid, derivative, or variant thereof.

[0185] In some embodiments, the rAAV vector is a single-stranded AAV vector or a self-complementary AAV (scAAV) vector. In some embodiments, the vector is a plasmid or a non-viral vector. In some embodiments, the non-viral vector is selected from the group consisting of naked nucleic acid, liposome, dendrimer, and nanoparticle.

[0186] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises: (i) a human CYP4V2 protein (SEQ ID NO: 4); (ii) a variant of a human CYP4V2 protein or a functional CYP4V2 protein (e.g., an altered amino acid and / or a splice variant) (e.g., SEQ ID NO: 5); (iii) one or more fragments of a functional CYP4V2 protein (e.g., SEQ ID NO: 6); (iv) all or a portion of the sequence of one or more of CYP4V2 orthologs from other species; (v) all or a portion of the sequence from one or more other P450 proteins, including but not limited to other CYP4 proteins and CYP46A1; (vi) a polypeptide capable of ameliorating, treating, or suppressing one or more biochemical abnormalities in one or more genes listed in Table 4 in patient cells (e.g., iPS-RPE cells of a BCD patient); and / or (vii) a combination of the above.

[0187] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or a portion of the amino acid sequence set forth in SEQ ID NO: 4, 5, or 6. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or a portion of an amino acid sequence selected from the group consisting of CYP4V2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, and CYP46A1 (SEQ ID NOs: 4-18) and derivatives, hybrids, variants, and / or fragments thereof.

[0188] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or a portion of the amino acid sequence in a CYP4V2 (or CYP4V2 ortholog) of chimpanzee, rhesus monkey, dog, cow, mouse, rat, chicken, frog, horse, rabbit, and fruit fly (SEQ ID NOs: 19-29), and derivatives, hybrids, variants, and / or fragments thereof. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises a polypeptide having at least 80% amino acid sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to any of the sequences selected from the group consisting of SEQ ID NOs: 4-29.

[0189] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises sequence elements of FxxGxxxCxG and ExxR (SEQ ID NOs: 30 and 31). In some embodiments, the non-mutant or functional CYP4V2 protein is a compound or agent capable of ameliorating, treating, or suppressing one or more biochemical abnormalities in one or more of the genes listed in Table 4 in a patient's cell (e.g., iPS-RPE cells of a BCD patient). In some embodiments, the nucleic acid molecule encodes a non-mutant or functional CYP4V2 protein according to any one of claims 91-97. In some embodiments, the nucleic acid molecule encodes a non-mutant or functional CYP4V2 protein comprising the amino acid sequence set forth in SEQ ID NO: 4, 5, or 6, or an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 4, 5, or 6. In some embodiments, the nucleic acid molecule encoding a functional CYP4V2 protein has the nucleic acid sequence set forth in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule encoding a functional CYP4V2 protein has at least 60% sequence identity to any one of SEQ ID NOs: 1, 2, or 3.

[0190] In some embodiments, the regulatory sequence comprises a promoter. In some embodiments, the promoter is an RPE cell-specific promoter, a retinal cell-specific promoter, a corneal cell-specific promoter, or an ocular cell-specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a mammalian beta-actin promoter or a viral promoter.

[0191] In some embodiments, the promoter is selected from the group consisting of: a CAG promoter (hybrid CMV early enhancer / chicken beta actin promoter, also known as CAGGS promoter, CB promoter, or CBA promoter), a chicken beta actin promoter, a small CBA (smCBA) promoter, a CB SBThe promoter is a CAG promoter (hybrid CMV early enhancer / chicken beta actin promoter, also known as CAGGS promoter, CB promoter, or CBA promoter), an elongation factor 1 alpha short (EFS) promoter, an elongation factor 1 alpha short (EF-1 alpha) promoter, or a CMV promoter, or a derivative or hybrid thereof. In some embodiments, the promoter is a CAG promoter (hybrid CMV early enhancer / chicken beta actin promoter, also known as CAGGS promoter, CB promoter, or CBA promoter), an elongation factor 1 alpha short (EFS) promoter, an elongation factor 1 alpha short (EF-1 alpha) promoter, or a CMV promoter, or a derivative or hybrid thereof.

[0192] In some embodiments, the regulatory sequence comprises an enhancer. In some embodiments, the enhancer is a viral enhancer, including but not limited to a WPRE enhancer, a HPRE enhancer, a CTE enhancer, or a derivative or hybrid thereof. In some embodiments, the regulatory sequence comprises a polyadenylation (polyA) signal. In some embodiments, the polyA signal is a bovine growth hormone polyadenylation signal (bGH polyA), a small polyA signal (SPA), a SV40 polyA signal, a human growth hormone polyadenylation signal (hGH polyA), a SV40 late polyA signal, or a derivative or hybrid thereof. In some embodiments, the regulatory sequence comprises a Kozak sequence (SEQ ID NO: 37 or 38).

[0193] In some embodiments, for in vitro treatment, the target cells are infected with a dose (MOI) of about 1 x 10 3 GC / cell to about 1 x 10 6 GC / cell to about 1 x 10 6 GC / cell to about 1 x 10 13 GC / cell to about 1 x 10 11 GC / cell to about 1 x 10 12 GC / cell to about 1 x 10 10 GC / cell to about 1 x 10 11 GC / cell to about 1 x 10 9 GC / cell to about 1 x 10 10 GC / cell to about 1 x 10 6 GC / cell to about 1 x 10 9extremely low dose range of GC and about 1 x 10 12 GC to about 2 x 10 13 extremely high dose range of GC, or any dose within these ranges sufficient to provide the desired effect.

[0194] In some embodiments, the administering step occurs before the onset of disease symptoms or after the onset of disease symptoms. In some embodiments, the administration is to the eye. In some embodiments, the administration is by subretinal injection. In some embodiments, the administration is by intravitreal injection. In some embodiments, the administration is by direct retinal injection. In some embodiments, the administration is by any other method of administration effective to deliver the vector to a subretinal location, the back of the eye, the cornea, or RPE cells, photoreceptor cells, or corneal epithelial cells of the subject.

[0195] In some embodiments, the administration is by corneal delivery. In some embodiments, the administration to the eye is achieved by delivery via the bloodstream. In some embodiments, the administration is via eye drops. In some embodiments, the administration is by delivery to the lens. In some embodiments, the administration is to the subretinal space, the cornea, the lens, or to the vitreous. In some embodiments, the ocular cell is selected from the group consisting of retinal pigment epithelial (RPE) cells, photoreceptor cells (PRC), corneal epithelial cells (CEC), choroidal endothelial (CE) cells, retinal cells, corneal cells, lens cells, ganglion cells, optic nerve cells, and / or choroidal cells, and these types of cells derived from stem cells, including but not limited to iPSCs, ES cells, MSCs, adult stem cells, and / or tissue-specific stem cells.

[0196] In some embodiments, the methods described herein can further comprise identifying a subject having or at risk of developing BCD.

[0197] EFS and / or SPA in rAAV vectors comprising nucleic acid sequences encoding Cas

[0198] In one aspect, a composition is provided comprising a recombinant adeno-associated viral (rAAV) vector comprising an elongation factor 1 alpha short (EFS) promoter and / or a small polyadenylation (polyA) signal (SPA) operably linked to a nucleic acid molecule encoding a CRISPR-associated protein (Cas).

[0199] In some embodiments, the EFS promoter consists of a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 35, and the SPA consists of a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 36. In some embodiments, the Cas encoded by the nucleic acid sequence operably linked to the EFS promoter and / or the SPA is Cas9 or Cpfl.

[0200] A host cell comprising the rAAV as described herein is provided. In some embodiments, the host cell is a bacterial cell, an E. coli cell, a plant cell, an insect cell, or a mammalian cell. In some embodiments, the cell is a somatic cell or a stem cell. In some embodiments, the host cell is a retinal cell, a corneal cell, a choroidal cell, an ocular cell, a brain cell, a neuron, a neuronal cell, an iPS cell, an ES cell, an MSC, an adult stem cell, a tissue specific cell, a stem cell, or any cell derived from a stem cell. In some embodiments, the rAAV vector is delivered to the host cell such that the Cas encoded by the nucleic acid molecule is expressed in the cell. In some embodiments, the host cell comprises any cell according to any one of claims 131-134.

[0201] Other features and advantages of the present application will become apparent from the embodiments, drawings, descriptions and examples, and claims. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. BRIEF DESCRIPTION OF DRAWINGS

[0202] The present application is further illustrated in the following figures and drawings, which do not limit the scope of the application described in the claims.

[0203] Cell line patents:

[0204] Figure 1: iPS cell lines derived from BCD patients

[0205] (a) iPS cells generated from fibroblasts of skin biopsy samples of BCD patients:

[0206] (i) Patient 1 (P1) iPS cells

[0207] (ii) Patient 2 (P2) iPS cells

[0208] (iii) P1 and P2 iPS cell lines characterized with Oct-4, Sox-2, and SSEA-4 markers

[0209] (iv) P1 and P2 iPS cell lines characterized with Nanog and Tra-1-60 markers

[0210] (b) iPS cells from peripheral blood mononuclear cells (PBMC) generated from blood samples from BCD patients and healthy controls:

[0211] (i) Phase contrast image of iPS cell line

[0212] (ii) AP staining results of iPS cell line

[0213] (c) Karyotype image of iPS cell derived from BCD patient, showing apparently normal human karyotype.

[0214] Figure 2: iPS-RPE cell lines derived from BCD patients:

[0215] (a) Light field photograph of iPS-RPE cell line derived from BCD patient, showing RPE unique morphology - hexagonal, pigmentation and monolayer:

[0216] (i) P1 iPS-RPE cells

[0217] (ii) P2 iPS-RPE cells

[0218] (b) RPE marker results of iPS-RPE cells from BCD patient, showing the presence of RPE specific markers RPE65, CRALBP and MITF.

[0219] Figure 3 : qRT-PCR results of CYP4V2 expression in iPS-RPE samples. WT (control). WT AVG (average of control). P1 (BCD patient 1). P1-AAV8 (P1 sample treated with AAV8.CYP4V2fv at MOI = 1.5 x 10e4 GC / cell).

[0220] Figure 4 : qRT-PCR results of CYP4V2op expression in iPS-RPE samples. WT (control). WT AVG (average of control). P1 and P2 (BCD patient 1 and patient 2). P1-AAV2 (P1 sample treated with AAV2.CYP4V2op at MOI of 2 x 10e4 GC / cell). P2-AAV2 (P2 sample treated with AAV2.CYP4V2op at MOI of 2 x 10e4 GC / cell). P2-scAAV1 (P2 sample treated with scAAV1.CYP4V2op at MOI of 2 x 10e4 GC / cell).

[0221] Figure 5: Cell viability images of iPS-RPE samples not exposed to blue light. WT (control). PI and P2 (BCD patient 1 and patient 2). Red (dead / diseased cells); green (live / healthy cells). Figure 5(a): only red. Figure 5(b): red and green.

[0222] Figure 6: Cell viability images of iPS-RPE samples after 1 hour of exposure to blue light. WT (control). PI and P2 (BCD patient 1 and patient 2). Red (dead / diseased cells); green (live / healthy cells). Figure 6(a): only red. Figure 6(b): red and green.

[0223] Gene therapy:

[0224] Figure 7: Schematic representation of exemplary CYP4V2 expression cassettes and recombinant AAV (rAAV) vectors and annotations thereof.

[0225] (a) CYP4V2 expression cassette (with enhancer) packaged in a single-stranded AAV (ssAAV) vector

[0226] (b) CYP4V2 expression cassette (without enhancer) packaged in a single-stranded AAV (ssAAV) vector

[0227] (c) CYP4V2 expression cassette packaged in a self-complementary AAV (scAAV) or ssAAV vector.

[0228] Note: The CYP4V2 expression cassette (as shown, flanked by AAV ITRs) can be packaged in an rAAV vector with a capsid from any AAV serotype or hybrid or variant thereof. ITR: Inverted terminal repeats (may be AAV2 ITRs or ITRs from other AAV serotypes). Exemplary AAV2 ITR sequences are shown in SEQ ID NOs: 42 and 43. CYP4V2: cDNA encoding human CYP4V2 protein or functional variant thereof, e.g., CYP4V2st (SEQ ID NO: 1) or CYP4V2op (SEQ ID NO: 2) encoding human CYP4V2 protein (SEQ ID NO: 4), or CYP4V2fv (SEQ ID NO: 3) encoding functional CYP4V2 protein (SEQ ID NO: 5). Kozak sequence is inserted immediately before the CYP4V2 cDNA sequence (sequences shown in SEQ ID NOs: 37 or 38). CAG: hybrid CAG promoter (exemplary sequence shown in SEQ ID NO: 32). Other promoters discussed herein can also be used, including but not limited to CMV promoter (exemplary sequence shown in SEQ ID NO: 40) or EF-1 alpha promoter (exemplary sequence shown in SEQ ID NO: 41). WPRE: woodchuck hepatitis virus post-transcriptional regulatory element (exemplary sequence shown in SEQ ID NO: 33). bGH polyA: bovine growth hormone polyadenylation signal (exemplary sequence shown in SEQ ID NO: 34). Alternative polyA signals can be used, e.g., SV40 late poly A signal (exemplary sequence shown in SEQ ID NO: 39). EFS: elongation factor 1 alpha short (EFS) core promoter. Exemplary sequence shown in SEQ ID NO: 35. SPA: small polyA signal. Exemplary sequence shown in SEQ ID NO: 36. Mutant / truncated ITR: one of the two ITRs used in the scAAV vector is a mutant / truncated ITR (shown as ITR*). Exemplary sequence shown in SEQ ID NO: 44. Enhancer is optional in the CYP4V2 expression cassette.

[0229] Figure 8: Cell viability images of BCD patient-derived iPS-RPE samples after 1 hour of exposure to blue light (no AAV.CYP4V2 treatment vs. treatment with AAV2.CYP4V2op or scAAVl.CYP4V2op at a MOI of 1 x 10e5 GC / cell). PI and P2 (BCD patient 1 and patient 2). Red (dead / sick cells); green (live / healthy cells). Figure 8(a): only red. Figure 8(b): red and green.

[0230] Figure 9: Cell viability images of BCD patient-derived iPS-RPE samples after 1 hour of blue light exposure (no AAV.CYP4V2 treatment versus treatment with AAV5.CYP4V2op, AAV5.CYP4V2st, or AAV8.CYP4V2fv at a MOI of 1 x 10e5 GC / cell). PI (BCD patient 1). Red (dead / diseased cells); green (live / healthy cells). Figure 9(a): only red. Figure 9(b): red and green.

[0231] Figure 10: Cell viability images of BCD patient-derived iPS-RPE samples after 1 hour of blue light exposure (no AAV.CYP4V2 treatment versus treatment with AAV5.CYP4V2op, scAAV1.CYP4V2op, or scAAV5.CYP4V2op at a MOI of 1 x 10e4 GC / cell). P2 (BCD patient 2). Red (dead / diseased cells); green (live / healthy cells). Figure 10(a): only red. Figure 10(b): red and green.

[0232] Figure 11: Cell viability images of BCD patient-derived iPS-RPE samples after 1 hour of blue light exposure (no AAV.CYP4V2 treatment versus treatment with scAAV9.CYP4V2op at a MOI of 1 x 10e5 GC / cell). PI (BCD patient 1). Red (dead / diseased cells); green (live / healthy cells). Figure 11(a): only red. Figure 11(b): red and green.

[0233] Cell therapy:

[0234] Figure 12 Regions of CYP4V2 sequence and positions of guide RNA (gRNA) design relative to the c.802-8_810del17insGC mutation and primers used for gRNA activity analysis (orange arrows) are shown

[0235] Figure 13 Surveyor assay in vitro is shown. Lane 1: amplicon + Cas9; Lane 2: amplicon + g1 + Cas9; Lane 3: amplicon + g2 + Cas9; Lane 4: amplicon + g3 + Cas9; Lane 5: amplicon + g4 + Cas9; Lane 6: amplicon + g5 + Cas9; Lane 7: amplicon only; Lane M: 1 kb DNA ladder.

[0236] Figure 14For sequence comparison, the DNA source used in the surveyor analysis was confirmed. Top: amplicon without treatment; middle: fragments from the amplicon treated with g2; bottom: CYP4V2 locus, with the mutation site indicated.

[0237] Figure 15 Illustration for gRNA vector construction.

[0238] Figure 16 Vector map for gRNA (e.g., g1), Cas9, and PuroR co-expression plasmid pX459-hSpCas9-2A-Puro.

[0239] Figure 17 Illustration showing the location of gRNA (e.g., g1) relative to the U6 promoter in the pX459-hSpCas9-2A-Puro plasmid. The “G” nucleotide between the U6 promoter and the gRNA is used to enhance the transcription efficiency driven by the U6 promoter. It is optional, not required, when a different promoter is used or when the gRNA starts with a “G” nucleotide.

[0240] Definitions

[0241] It should be understood that “a” or “an” as used in the specification and in claims means one or more, depending upon the context in which it is used. Thus, for example, reference to “a cell” means “at least one cell” or “more than one cell.”

[0242] The term “about” or “approximately” or the symbol “~” means within ±10% (including the end points) of a given value or state. Unless the context clearly indicates otherwise, all numerical values provided herein are modified by the term about.

[0243] The term “AAV.CYP4V2” refers to a recombinant adeno-associated virus (AAV) vector comprising a polynucleotide encoding a functional CYP4V2 protein.

[0244] The term “CYP4V2 gene therapy” refers to the introduction of a functional CYP4V2 protein or a polynucleotide encoding a functional CYP4V2 protein into a cell and / or a subject. See the detailed discussion herein.

[0245] The term "effective amount" or "effective dose" or "therapeutically effective dose" refers to the amount of a compound (e.g., a vector) and / or cells that, when administered to a subject in need of treatment, is sufficient to effect and / or appropriate for effecting such treatment. The effective amount will vary depending upon the particular activity of the therapeutic agent employed, the severity of the disease condition in the patient, and the age, body weight, physical condition, the presence of other disease conditions, and nutritional status of the subject. In addition, the effective amount of the therapeutic agent to be administered will also be influenced by the presence of other drugs and / or treatments being administered to the patient. For a more detailed discussion, see the description herein.

[0246] The term "treatment" or "treating" refers to administration of a composition as disclosed herein (e.g., an AAV comprising a transgene and / or cells) to a subject for the purpose of: 1) preventing a disease or condition or providing protection against developing the disease or condition, i.e., causing the clinical symptoms not to develop; 2) inhibiting the disease or condition, i.e., arresting, slowing, ameliorating, or stopping the development of clinical symptoms; 3) relieving the disease or condition, i.e., causing the regression of clinical symptoms; and / or 4) replacing a cell, tissue, and / or organ affected by the disease and / or restoring its lost function. In some embodiments, the term "treatment" or "treating" refers to the alleviation of a disease or condition; i.e., causing the regression of clinical symptoms. In some embodiments, the term "treatment" or "treating" alternatively or additionally refers to the prophylactic treatment of a subject in need thereof. Prophylactic treatment can be achieved by providing an appropriate dose of a therapeutic agent to a subject at risk of being affected by a malady, thereby substantially avoiding the onset of the malady. One of skill will understand that it is not always possible to distinguish between "preventing" and "arresting" because the most important inducing event can be unknown or latent, or the patient can not be diagnosed until long after the event has occurred. Thus, the term "prophylaxis" as used herein is intended as an element of "treatment" to encompass both "prevention" and "arresting" as defined herein.

[0247] The term "subject" refers to an animal, such as a mammal, for example, a human. The methods described herein can be applicable to human treatment, preclinical, and veterinary applications. In some embodiments, the subject is a mammal, and in some embodiments, the subject is a human.

[0248] A "variant" is a protein that has sequence homology to a reference biologically active protein that retains at least a portion of the therapeutic and / or biological activity of the biologically active protein. For example, a variant protein can have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity compared to a reference biologically active protein. The term "biologically active protein" includes proteins that have been intentionally modified, such as by site-directed mutagenesis, insertion, or by chance via mutation. A "variant" includes a "fragment," which is a truncated form of a naturally or non-naturally occurring biologically active protein that retains at least a portion of the therapeutic and / or biological activity.

[0249] The term "nucleic acid" is used herein to refer to all forms of nucleic acids, polynucleotides, and oligonucleotides, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids include genomic DNA, cDNA, and RNA. Polynucleotides include naturally occurring, synthetic, and intentionally modified or altered polynucleotides. Polynucleotides can be single-stranded, double-stranded, or triple-stranded, linear or circular, and can be of any length. The sequence or structure of a particular polynucleotide can be described herein according to the convention of providing the sequence in the 5' to 3' direction.

[0250] The term "sequence variant" means a gene or polypeptide that has been modified from its native or original sequence by one or more nucleotide or amino acid insertions, deletions, and / or substitutions. Insertions can be at either or both ends of the gene or protein, and / or can be located within an internal region of the nucleotide sequence or amino acid sequence. In deletion variants, one or more nucleotide or amino acid residues in the gene or polypeptide as described herein are removed. In substitution variants, one or more nucleotide or amino acid residues of the gene or polypeptide are removed and replaced with alternative residues. In one aspect, substitutions are conservative in nature, and this type of conservative substitution is well known in the art.

[0251] The term "therapy" or "treatment" as used herein can be administered in vivo to a subject or in vitro to a cell.

[0252] A plasmid as used herein is a type of vector.

[0253] The term "genetically repaired" or "genetic repair" as used herein refers to a cell that originally carries a genetic defect (e.g., a mutation or a pathological alteration) in a gene, but whose genetic defect has been repaired via gene correction or disruption of the genomic DNA or mRNA of the cell (defined herein as "gene editing," "gene editing therapy," or "gene correction"), or via gene transfer of an exogenous nucleic acid molecule expressing a functional protein corresponding to the defective gene to the cell or supplementing the cell with the exogenous nucleic acid molecule (defined herein as "gene transfer therapy" or "gene therapy").

[0254] The term "percent sequence identity" or "sequence identity" as used herein shall be determined and calculated as follows. In calculating percent sequence identity, two sequences are aligned and the number of identical matches between the two sequences is determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of nucleotides or amino acid residues which are aligned) and multiplied by 100 to yield the percent sequence identity value (and rounded to the next higher integer (e.g., 65.01% would be rounded to 66% and is considered 66% for purposes herein)). It will be appreciated that the length of the aligned region can be a portion of one or both sequences to the entire net length of the shorter sequence (no gap size applied). In order to determine identical matches between two protein-encoding nucleotide sequences and to calculate sequence identity, any non-coding nucleotide sequences (such as, but not limited to, introns, UTRs, Kozak sequences, promoters, enhancers, or other regulatory sequences) should be removed prior to submitting the two sequences for alignment and calculation of sequence identity. Alignment of two sequences for determining the number of identical matches of nucleotides or amino acid residues between the two sequences can be performed by using Pairwise Sequence Alignment EMBOSS Needle using the Needleman-Wunsch algorithm (available at the European Bioinformatics Institute (EMBL-EBI) and at the World Wide Web: ebi.ac.uk / Tools / psa / emboss_needle / nucleotide.html for nucleotide alignments and ebi.ac.uk / Tools / psa / emboss_needle / for protein alignments) and using the default parameters (for nucleotide sequences, use: Matrix: EDNAFULL. Gap Open Penalty: 10. Gap Extend Penalty: 0.5. Output format: Pairwise. End Gap Penalty: False. End Gap Open Penalty: 10. End Gap Extend Penalty: 0.5. For protein sequences, use: Matrix: EBLOSUM62. Gap Open Penalty: 10. Gap Extend Penalty: 0.5. Output format: Pairwise. End Gap Penalty: False. End Gap Open Penalty: 10. End Gap Extend Penalty: 0.5) to create the best global alignment of the two sequences.

[0255] The term "adeno-associated virus vector" refers to a nucleic acid derived from any AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 serotype, or any other virus or serotype that shares homology in its capsid protein sequence with the capsid proteins of an AAV serotype. The term "recombinant adeno-associated virus" or "rAAV" refers to an infectious, replication-defective virus composed of an outer shell of AAV proteins that encapsidates a nucleic acid molecule of interest flanked on one or both sides by AAV ITRs. As used herein, reference to a particular AAV serotype means an AAV having at least one capsid protein of that AAV serotype. For example, the term "AAV2" refers to an AAV having at least one AAV serotype 2 capsid protein.

[0256] The term "CYP4V2" refers to cytochrome P450 4V2 or cytochrome P450 family 4 subfamily V polypeptide 2 (sometimes referred to as CYP4AH1), and its orthologues in other species. Mutations in CYP4V2 are associated with BCD (see, e.g., Li et al., Am J Hum Genet. 74:817-826, 2004) and retinitis pigmentosa (see, e.g., Wang et al., PLOS ONE 7: e33673, 2012). The full-length genomic human CYP4V2 gene is about 22,053 bp in length and can be found, for example, at the World Wide Web genecards.org / cgi-bin / carddisp.pl?gene=CYP4V2&keywords=CYP4V2. The term "hCYP4V2" as used herein refers to the human CYP4V2 gene or protein. It is understood that hCYP4V2 and CYP4V2 can refer to a gene or protein containing genetic or epigenetic alterations or a gene or protein not containing genetic or epigenetic alterations.

[0257] The term "functional CYP4V2" as used herein refers to a protein or a nucleotide molecule that when expressed produces the protein that is capable of effectively providing a therapeutic benefit to an individual (e.g., an individual having a genetic or epigenetic alteration in a CYP4V2 molecule) (e.g., ameliorating or rescuing abnormal fatty acid levels (e.g., DHA levels) in a target cell). A functional CYP4V2 molecule can correspond to a wild-type hCYP4V2 sequence or a naturally occurring variant thereof (e.g., a polymorphic variant; e.g., a variant that does not contain a pathological alteration) or an optimized sequence. In some embodiments, a functional CYP4V2 molecule is a CYP4V2 molecule from another species (e.g., another mammal, such as a rodent, a rabbit, a dog, a pig, or a non-human primate) that shares similar orthology to human CYP4V2. For example, an ortholog of a human CYP4V2 sequence is a murine mCyp4v3 sequence. In some embodiments, a functional CYP4V2 molecule is another P450 molecule (e.g., a CYP4 protein).

[0258] The term "ocular cell" refers to any cell in the eye or associated with eye function, including, but not limited to, a retinal cell, a retinal bipolar cell, a photoreceptor cell or photoreceptor progenitor cell (including rods and / or cones, collectively "PRCs"), a ganglion cell, a retinal pigment epithelium (RPE) cell, a choroidal epithelium (CE) cell, a corneal epithelium (CEC), a choroidal cell or a corneal cell, or a retinal cell.

[0259] The term "loss of function" or "dysfunction" refers to a decrease or loss of cell function (e.g., photoreceptor function, photoreceptor cell function, retinal pigment epithelium cell function, lens function, choroid function, or cornea function) compared to a normal, non-disease affected cell or compared to the other eye or to the same eye at an earlier time point. "Degeneration," "atrophy," "disorder," "disease," and / or "dystrophy" as used herein can be used synonymously in terms of loss of function. The term "increased function" means improved function (e.g., function of a photoreceptor, photoreceptor cell, retinal pigment epithelium cell, choroidal cell, or corneal cell) or an increased number or percentage of functional photoreceptors or cells (e.g., photoreceptor cells, retinal pigment epithelium cells, choroidal cells, or corneal cells) compared to a disease affected eye (having the same ocular disease), the same eye at an earlier time point, an untreated portion of the same eye, or the contralateral eye of the same patient.

[0260] The term "transgene" refers to a donor nucleic acid intended to be or that has been introduced into a cell or organism. A transgene includes any gene, such as the genes or cDNAs set forth in Table 4.

[0261] The terms "pharmaceutically acceptable formulation" and "physiologically acceptable formulation" and "pharmaceutically acceptable carrier" mean a biologically acceptable formulation, gas, liquid, or solid, or mixture thereof, which is suitable for one or more routes of administration, in vivo delivery, in vitro delivery, or contact, and can include formulations or carriers used in therapies for other diseases, such as gene therapy or cell therapy for other ocular diseases. A "pharmaceutically acceptable" or "physiologically acceptable" composition is one that does not include an agent that causes an undesirable biological effect in the individual, e.g., the material can be administered to an individual without causing substantial undesirable biological effects. Thus, such a pharmaceutical composition can be used, for example, to administer a protein, polynucleotide, plasmid, viral vector, or nanoparticle to a cell or subject. These compositions include, but are not limited to, solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e.g., oil-in-water or water-in-oil), suspensions, syrups, elixirs, dispersion and suspension media, coatings, isotonic and absorption promoters or delaying agents that are compatible with pharmaceutical administration or in vivo or in vitro contact or delivery. Aqueous and non-aqueous solvents, solutions, and suspensions can include suspending agents, lubricating agents, and thickening agents. These pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powders, granules, and crystals. Supplementary active compounds (e.g., preservatives, antibacterial agents, antiviral agents, and antifungal agents, and immunosuppressants) can also be incorporated into the compositions. The pharmaceutical compositions can be formulated to be compatible with a particular route of administration or delivery as described herein or known to one of skill in the art. Thus, the pharmaceutical compositions include carriers, diluents, or excipients suitable for administration by various routes.

[0262] The term "crRNA" refers to CRISPR RNA, which contains both a protospacer element and additional nucleotides that are complementary to tracrRNA.

[0263] The term "tracrRNA" refers to transactivating crRNA, which hybridizes with crRNA and binds to the Cas9 protein, activating the complex to create a double-stranded break at a specific site within a genomic sequence.

[0264] The term "sgRNA" refers to single-guide RNA, which combines crRNA and tracrRNA into a single RNA construct, the crRNA and tracrRNA being separate molecules in the native CRISPR / Cas9 system in S. pyogenes.

[0265] The term "PAM" refers to "protospacer adjacent motif," which is a short sequence in either strand of the genome recognized by a CRISPR nuclease as a cleavage site. PAM varies with the nuclease (e.g., Cas9, Cpfl, etc.). The protospacer element sequence is typically immediately upstream of the PAM site.

[0266] The term "protospacer element" (also referred to as "guide RNA" or "CRISPR gRNA" or "gRNA" or gl, g2, g3, g4, g5, etc.) refers to the portion of the crRNA (or sgRNA) that is complementary to the genomic DNA target sequence.

[0267] DHA: Docosahexaenoic Acid, a polyunsaturated omega-3 fatty acid, also known as 22:6 (omega-3) or C22:6 n3.

[0268] AA: Arachidonic Acid, a polyunsaturated omega-6 fatty acid, also known as 20:4 (omega-6) or C20:4 n6 or ARA.

[0269] PBS (+): phosphate buffered saline (PBS) containing calcium and magnesium.

[0270] PBS (-): phosphate buffered saline (PBS) without calcium or magnesium. DETAILED DESCRIPTION

[0271] Detailed description of preferred embodiments

[0272] Methods and compositions for bcd cell disease models

[0273] Developing appropriate BCD disease models and determining the molecular level phenotype of BCD is critical for BCD related research, development and testing of drugs and treatment options for BCD, and research into CYP4V2 function. As outlined in the background section herein, the clinical phenotype of BCD has been characterized, established and studied since the 80s, and the identification of genetic mutations leading to BCD has been over a decade. However, there is still a gap between the clinical phenotype (e.g., crystalline-like deposits in the retina of BCD patients) and the underlying CYP4V2 mutations.

[0274] Previous studies on BCD found abnormalities in fatty acid levels in BCD patients, including in fibroblasts, lymphocytes, and serum. For example, in Lee et al., The Metabolism of Fatty Acids in Human Bietti Crystalline Dystrophy, Invest Ophthalmol Vis Sci. 2001 Jul;42(8): 1707-14, researchers used a pulse-chase method to study abnormalities in fibroblasts and lymphocytes of BCD patients. Fibroblasts and lymphocytes from BCD patients and normal controls were incubated with [(14)C]18:3n-3 or [(14)C]18:2n-6. Fibroblasts from patients with BCD showed decreased conversion of 18:3n-3 to polyunsaturated fatty acids (PUFAs) compared to normal subjects, but conversion of 18:2n-6 was not decreased. In another study (Lai et al., Alterations in Serum Fatty Acid Concentrations and Desaturase Activities in Bietti Crystalline Dystrophy Unaffected by CYP4V2 Genotypes, Invest Ophthalmol Vis Sci 2010;51: 1092-7), researchers used GC-MS to analyze serum fatty acid concentrations in serum samples of BCD patients and controls. This study found that the concentration of octadecanoic acid (18:0) was higher in serum of BCD patients than in control subjects, and the concentration of octadecadienoic acid (18:ln-9) was lower in BCD patients than in control subjects. In addition, total monounsaturated fatty acid concentrations were significantly lower in BCD than in controls. However, in another study (Nakano et al., CYP4V2 in Bietti’s Crystalline Dystrophy: Ocular Localization, Metabolism of omega-3-Polyunsaturated Fatty Acids, and Functional Deficit of the p.H331P Variant, Mol Pharmacol 82:679-686, 2012) that did not use BCD patient samples as research subjects, results indicated that the CYP4V2 enzyme has ω-hydroxylase activity on ω-3-PUFAs.

[0275] It is important to confirm whether the abnormal fatty acid levels found in fibroblasts and serum of BCD patients are actually present in RPE cells of BCD patients, which are the pathogenic cells of BCD. Therefore, a BCD disease model that allows direct study of RPE cells of BCD patients is needed to gain more insight into the BCD disease pathology and CYP4V2 function, as well as to assess the efficacy of potential treatment options. However, given the location of the RPE and the rarity of BCD, it is not practical to obtain native RPE cells from BCD patients.

[0276] The present disclosure provides BCD cell models and methods for generating BCD cell models. A BCD cell model is comprised of patient-specific stem cells of a BCD patient (including but not limited to induced pluripotent stem cells (iPSCs), embryonic stem (ES) cells, somatic (or adult) stem cells, mesenchymal stem cells (MSCs)) and ocular cells (including but not limited to RPE cells, photoreceptor (rods or cones) cells, photoreceptor progenitor cells, corneal epithelial cells, lens cells, and / or choroidal cells) derived from any stem cell of a BCD patient. In addition to patient-specific stem cells, a BCD cell model can also be generated by creating artificial CYP4V2 mutations in cells of a subject without BCD, and these cells can be ES cells, iPS cells or other stem cells or any cell that can be reprogrammed to a stem cell or any ocular cell (whether or not derived from a stem cell).

[0277] Induced pluripotent stem cell technology provides another option for disease modeling of animal models. However, not all diseases can be successfully modeled using iPSCs. (Urbach, A., Bar-Nur, O., Daley, G. Q. & Benvenisty, N. Differential Modeling of Fragile X Syndrome by Human Embryonic Stem Cells and Induced Pluripotent Stem Cells. Cell Stem Cell 6, 407-411 (2010)). Furthermore, given the reported fatty acid anabolism associated with BCD, it is not clear whether BCD patient-specific iPS or patient-specific iPS-RPE cells can be generated by iPS technology.

[0278] A. Inducing pluripotency

[0279] Methods of making induced pluripotent stem cells (iPSCs) are known in the art. Almost all types of somatic cells can be used as the source cells for reprogramming of iPSCs. Briefly, iPSCs can be made by introducing a specific set of proteins (e.g., nucleic acids encoding a specific set of proteins or by direct delivery of proteins) into a cell. Those skilled in the art will appreciate that one exemplary, non-limiting method is by introducing one or more transgenes encoding one or more of OCT4, SOX2, KLF4, and / or c-MYC (e.g., the “Yamanaka factors”). In some embodiments, reprogramming uses all four transcription factors. In some embodiments, one, two, or three transcription factors can be used. Li et al., Stem Cells, 2009; 27:2992-3000. Zhu et al., Cell Stem Cell 2010; 7:651-655. In some embodiments, iPSCs can be generated by direct delivery of reprogramming proteins. Kim et al., Cell Stem Cell. 2009; 4(6):472-6. The Examples section provides methods for generating iPSCs using non-integrating methods, e.g., by Sendai virus (Example 1) or by episomal methods (Example 2). However, any method of generating iPSCs is contemplated within the scope of the present disclosure.

[0280] iPSCs can be generated using various methods (e.g., Sendai virus, episomal methods, with or without small molecules), see the Examples section, see also, e.g., Hubbard et al., J. Vis. Exp., 2014, 92:52009. Furthermore, methods of making iPSCs from a variety of different cell types are known in the art. See, e.g., Hayashi et al., 2012, PLoS One, 7(9):e45435; Poon et al. 2015, PLoS One, 10(7):e0131288; Lamba et al. 2010, PLoS One, 5(1):e8763. iPSCs typically express detectable levels of at least one marker, including but not limited to Oct-4, Sox-2, SSEA4, TRA-1-60, TRA-1-81, AP, and / or NANOG.

[0281] Any type of stem cell can be used to generate the BCD cell models described herein, including but not limited to induced pluripotent stem cells (iPSCs), hematopoetic stem cells (HSCs), embryonic stem (ES) cells, mesenchymal stem cells, adult stem cells, or tissue-specific stem cells. The stem cells used in the methods described herein can be pluripotent, multipotent, or totipotent stem cells.

[0282] The term "pluripotent" as used herein refers to a cell that is capable of developing into at least one of ectoderm, endoderm, and mesoderm cells. In one embodiment, the term "pluripotent" refers to a cell that is totipotent and multipotent. The term "totipotent" cell as used herein refers to a cell that is capable of developing into cells of all lineages. The term "multipotent" as used herein refers to a cell that is not terminally differentiated. The pluripotent cells of the disclosure can be any stem cell, or generated from a non-pluripotent cell such as a fibroblast using induction, dedifferentiation, and nuclear transfer methods known in the art. The pluripotent cells described herein, whether stem cells or generated from non-pluripotent cells, can be from a subject having BCD or having a CYP4V2 mutation, or from a healthy subject that does not have BCD to serve as a control or for creating artificial CYP4V2 mutations.

[0283] Nearly any type of cell can be reprogrammed to an iPS cell. See the discussion in the section entitled "Cell Origin" herein.

[0284] B. Differentiation of iPSCs

[0285] BCD patient iPS cells are differentiated into iPS-RPE cells (or another type of ocular cell (e.g., iPS-CEC, iPS-CE cell, or iPS-PRC). Methods of differentiating iPSCs into RPE cells or another type of ocular cell (e.g., CEC and PRC) are known. See, e.g., the Examples section; Hayashi et al., 2012, PLoS One, 7(9):e45435; Songstad et al., Investigative Ophthalmology & Visual Science December 2015, Volume 56, 8258-8267; and Lamba et al., PLoS One. 2010 Jan 20; 5(1): e8763. For example, induced pluripotent stem cells (iPSCs) can be generated from cell reprogramming and these cells can be further differentiated into, e.g., RPE cells (referred to herein as "iPS-RPE"), corneal epithelial cells (referred to herein as "iPS-CEC"), photoreceptor cells (or photoreceptor progenitor cells; referred to herein as "iPS-PRC"), or iPS-chorioidal endothelial (CE) cells (referred to as "iPS-CE").

[0286] The differentiated cells (e.g., iPS-RPE cells) are tested for biochemical function (as described herein and in the Examples section) to assess their biochemical deficiencies / abnormalities as compared to iPS-RPE cells of a healthy control group.

[0287] iPS-RPE cell lines generated as described herein exhibit a morphology (e.g., pigmentation and hexagonal shape) and / or express one or more biomarkers indicative of RPE cells. Biomarkers of RPE cells (and iPS-RPE cells) are known and include, but are not limited to, one or more of RLBP1 (also known as CRALBP), RPE65, Bestrophin-1, MITF, VINCULIN, LRAT, RDH5, PAX6, MERTK, TYR, and / or ZO-1, and can be used to determine or confirm that RPE differentiation has occurred. Likewise, biomarkers of CEC (and iPS-CEC) and PRC (and iPS-PRC) are known and include, e.g., cytokeratin 12 and cytokeratin 3 for corneal epithelial cells; Crx for photoreceptors; recoverin for rod and cone; and Nrl for rod.

[0288] BCD patient-specific iPS and iPS-RPE cells can be successfully generated via the iPS reprogramming and RPE differentiation methods as described in the Examples section.

[0289] Biochemical analysis to identify biochemical defects / abnormalities in iPS-RPE cells of BCD patients and cell viability analysis to assess RPE atrophy

[0290] A set of biochemical analyses was developed and used to assess and determine the phenotype in BCD patient-specific iPS-RPE cells.

[0291] First, a more complete list of fatty acids was included in our biochemical analysis. In a previous study, abnormal serum fatty acid levels in BCD patients were identified, and the following fatty acids were tested in the test samples: 16:0, 16:1, 18:0, 18:1n-9, 18:2n-6, 18:3n-3, 20:3n-6, 20:4n-6, 22:5n-3, 22:6n-3, 24:0, and 24:1. This study found that the concentration of octadecanoic acid (18:0) was higher in the serum of BCD patients than in control individuals, and the concentration of octadecadienoic acid (18:1n-9) was lower than in control individuals. To determine whether the same fatty acid abnormalities and whether there were more other fatty acid abnormalities existed in BCD patient-specific iPS-RPE cells, a biochemical analysis covering more fatty acids was developed using LC-MS (see Table 2).

[0292] In addition, to determine whether BCD patient-specific iPS-RPE cells carried other abnormalities in addition to fatty acids, other lipid species were included in the analysis, including ceramide (Cer), sphingomyelin (SM), and sphingosine and sphingosine dihydro (SOSA), in order to analyze the phenotype in the BCD disease model and determine the biochemical function of the CYP4V2 protein. See Table 2 for a list of different species and compounds included in the biochemical analysis to test BCD patient-specific iPS-RPE cells.

[0293] Surprisingly, the test results (see the Examples section) showed that BCD patient-specific iPS-RPE cells had a fatty acid abnormality profile that was different from that found in the serum of BCD patients.

[0294] The eye is the light-sensing organ of the human body. BCD begins with RPE atrophy, which in turn causes photoreceptor death and vision loss. A key function of the RPE is light absorption (Strauss, 2005, The retinal pigment epithelium in visual function. Physiol Rev 85:845-81). Exposure to ambient light can affect the development and progression of human retinal degeneration, such as age-related macular degeneration (AMD) and retinitis pigmentosa (RP). The use of exposure to light in models of ocular disease is a suitable model system to study retinal degeneration. Exposure to light, including exposure to blue light, has been widely used in retinal studies (Dual roles of polyunsaturated fatty acids in retinal physiology and pathophysiology associated with retinal degeneration, Masaki Tanito & Robert Anderson (2009) Clinical Lipidology, 4:6, 821-827. Seko et al., Graefes Arch Clin Exp Ophthalmol. 2001 Jan; 239(1): 47-52. Blue light-induced apoptosis in cultured retinal pigment epithelium cells of the rat. Narimatsu et al., Exp Eye Res. 2015 Mar; 132: 48-51. Blue light-induced inflammatory marker expression in the retinal pigment epithelium-choroid of mice and the protective effect of a yellow intraocular lens material in vivo).Blue light is present in ambient light, such as sunlight and artificial lighting (e.g., office lighting), as well as from electronic display devices, such as TVs, monitors, smartphones, laptops, and tablets (Moon et al., Blue light effect on retinal pigment epithelial cells by display devices, Integr Biol (Camb). 2017, 22; 9(5):436-443. doi: 10.1039 / c7ib00032d).

[0295] In this study, cell viability analysis found RPE atrophy in the BCD cell model. Cell death induced by exposure to (blue) light was significantly higher in iPS-RPE samples from BCD patients than in control samples. The clinical phenotype of BCD, i.e., RPE atrophy, was evident in the BCD cell model. AAV.CYP4V2 exhibited efficacy in rescuing RPE atrophy in the BCD cell model.

[0296] D. Applications of the BCD cell model

[0297] In addition to assessing cell-level phenotypes associated with BCD, the BCD cell model can also be used for other applications of the disease model, including but not limited to drug screening, developing therapeutic agents or devices, determining dosage ranges, safety and toxicity testing, testing different formulations for BCD or other CYP4V2-associated conditions, or studying CYP4V2 function and uses, including but not limited to developing and screening drugs that include or express CYP4V2 protein, e.g., CYP4V2 gene therapy. Furthermore, BCD patient-specific iPS-RPE (and other ocular cells derived from BCD patient-specific stem cells, including but not limited to iPS-photoreceptor cells, iPS-corneal cells) can be used as cell therapy, either in unmodified form or after gene repair (e.g., by gene transfer or gene editing as described herein). The Examples section provides examples of non-limiting examples of applications of the BCD cell model.

[0298] E. Methods of screening compounds

[0299] Notably, the iPSC-RPE cell lines described herein can provide a human cell disease model (e.g., BCD, retinitis pigmentosa, IRD). These iPSC-RPE cells, iPSC-CEC cells, or iPSC-PRC cells, which can be collectively referred to as "iPSC-ocular cells," can be used for diagnosis, prognosis, predicting the onset, severity, and rate of progression of BCD patients or retinitis pigmentosa patients or patients with another type of inherited retinal disease. For example, these iPSC-ocular cell lines can also be used to screen for test compounds that can have therapeutic efficacy in treating or preventing diseases associated with genetic or epigenetic alterations in CYP4V2 nucleic acids (e.g., BCD).

[0300] The pluripotent cells described herein, particularly those generated from a subject having a genetic or epigenetic alteration in CYP4V2 or a subject having an ocular disease (e.g., BCD), can be used as research tools in methods for identifying compounds that can serve as therapeutic candidates for treating, diagnosing, prognosing, or preventing an ocular disease (e.g., BCD). It should be understood that the test compounds can be any type of compound. They can have a natural source or can be produced by chemical synthesis. They can be a library of structurally defined compounds, uncharacterized compounds or substances, or mixtures of compounds. Those skilled in the art will appreciate that the test compounds can be, but are not limited to, nucleic acids or analogs thereof, polypeptides or analogs thereof, antibodies, chemicals, and small molecules.

[0301] The growth capacity of the cells described herein and their function in animal models (e.g., in the eyes of animal models) and their propensity to form tumors or lack of such propensity can be assessed in the presence or absence of test compounds. Various methods can be used to assess the cells, including but not limited to PCR techniques, immunoassays, and / or lipid / fatty acid metabolism assays.

[0302] Methods and compositions for cell therapy

[0303] As discussed herein, CYP4V2 gene therapy demonstrates efficacy in correcting the biochemical abnormalities in BCD patient-specific iPS-RPE cells. However, gene therapy works in vivo on the premise that the subject still has some RPE and photoreceptor cells left in the eye being treated. For advanced BCD patients who have only a small amount or no RPE cells or photoreceptor cells left in the eye, cell therapy can be used as an alternative or in combination with gene therapy as a treatment option.

[0304] Cell therapy involves the transplantation of new cells to replace dead or degenerating cells. For BCD, the new cells can be RPE cells, photoreceptor cells (rods and / or cones), photoreceptor progenitor cells, choroidal cells, corneal epithelial cells, lens cells, or other types of ocular cells, depending on which type of cells in the subject show degeneration and need to be replaced. The following description and examples herein use iPS-RPE cells to illustrate these methods and processes. They can be applied to other types of ocular cells.

[0305] Cell therapy for BCD and other types of ocular diseases, including but not limited to inherited retinal diseases (IRD), retinitis pigmentosa (RP), macular degeneration (including age-related macular degeneration (AMD)), can be classified as follows.

[0306] (1) Allogeneic transplantation:

[0307] In one embodiment, RPE cells, PRCs, CECs, CE cells, and other ocular cells derived from embryonic stem cells (ESCs) or iPSCs from healthy donors can be used in allogeneic transplantation as cell therapy for BCD. It involves differentiating healthy ESCs or iPSCs from healthy individuals (i.e., not harboring CYP4V2 mutations) into RPE cells and transplanting the ESC-RPE cells into the eyes of BCD patients. Methods of reprogramming iPSCs and differentiating ESCs or iPSCs into RPEs are provided herein in the Examples section. In previous studies, embryonic stem cell (ESC)-derived RPE cells have been used to treat age-related macular degeneration (AMD), see Schwartz et al., Investigative Ophthalmology & Visual Science 2016 Apr, vol. 57, ORS Fc1-ORS Fc9. The advantage of an allograft or allogeneic transplantation is that it is less expensive than an autologous transplantation because a common source can be used to treat multiple patients. However, it also has significant disadvantages, such as the immune rejection by the host subject can significantly affect its efficacy and duration. In addition, it requires long-term immunosuppressants, which can cause serious systemic side effects. Finally, the use of ESCs can raise ethical issues.

[0308] (2) Autologous transplantation without gene repair:

[0309] In one embodiment, autologous cells can be used in cell therapy against BCD. One such autologous source is iPS cells and iPS-RPE cells derived from a BCD patient that can be transplanted into the eye of that BCD patient. BCD is a relatively late onset disease. Symptoms of BCD patients typically arise in the 2nd, 3rd, or even 4th decade of life. Furthermore, the iPS reprogramming process has a certain degree of "reset the clock" effect on iPS cells and cells derived from iPS cells. Thus, iPS-RPE cells and other iPS-ocular cells derived from a BCD patient can be transplanted into the BCD patient as a cell therapy even without any genetic repair of the CYP4V2 mutation in the iPS-RPE cells. iPS reprogramming and RPE differentiation methods are provided in the Examples section herein. As a precaution, whole genome sequencing can be performed to compare the genomic DNA in the iPS or iPS-RPE cells to the genomic DNA in the source cells (e.g., fibroblasts or blood cells) regardless of whether any pathogenic mutations arise during the iPS reprogramming and RPE differentiation process.

[0310] (3) Genetically repaired patient autologous cells for cell therapy against BCD and other types of IRD and RP

[0311] The disclosure herein provides methods and compositions for generating genetically repaired autologous cells for use in cell therapy. As used herein, "genetically repaired" or "genetic repair" refers to correction of the CYP4V2 mutation by either editing the patient's genome (e.g., directly on the chromosome using, e.g., CRISPR / Cas9, CRISPR / Cpfl, zinc fingers, TALENs) or by gene transfer of a healthy copy of the CYP4V2 gene (cDNA, RNA, or other form) that typically does not integrate into the genome into the patient cells (e.g., CYP4V2 gene therapy as described in the text) or correction or compensation of the defective mRNA in the patient cells.

[0312] As to diseases caused by genetic mutations, autologous cells for use in cell therapy against BCD or another IRD or RP should ideally have their genetic defect (i.e., CYP4V2 mutation) and / or their functionally abnormal CYP4V2 protein repaired prior to transplantation. In one embodiment, the genetic repair can be achieved by gene transfer therapy as discussed herein, including but not limited to AAV-mediated gene therapy transfer of a nucleic acid sequence encoding and expressing a functional CYP4V2 protein. Compositions and methods of CYP4V2 gene transfer therapy are provided herein, see the detailed description and examples section herein. BCD patient-specific source cell iPS or iPS-RPE cells can be treated with AAV.CYP4V2 (as provided herein), followed by iPS reprogramming and / or RPE differentiation (if applicable) and verification of improved biochemical function (as provided herein), and then transplanted into the eye of the original patient. In another embodiment, the genetic repair can be achieved by gene editing, for example, correction of CYP4V2 mutations in the genome or RNA in BCD patient cells. In addition to administration in vitro as part of a cell therapy, the gene editing can also be administered directly in vivo as a gene therapy. The gene editing can be performed on patient source cells (e.g., fibroblasts or blood cells), iPS, iPS-RPE, or other types of iPS-ocular cells. iPS reprogramming and RPE differentiation for the generation of patient-specific iPS and iPS-RPE can be performed prior to or after genetic repair (e.g., gene transfer therapy or gene editing).

[0313] The present disclosure provides herein compositions and methods of correcting CYP4V2 mutations via gene editing. The description in the examples section herein illustrates compositions and methods of correcting the most common mutation c.802-8_810del17insGC mutation in BCD patients using CRISPR / Cas9 constructs. It can also be used for other gene editing methods (e.g., CRISPR / Crpl, TALEN, zinc fingers) and other IRD mutations (e.g., but not limited to, other CYP4V2 mutations in Table 1), in combination with methods known in the art to which the present invention pertains.

[0314] The most common CYP4V2 mutation in BCD patients is c.802-8_810del17insGC (referring to a 17 base deletion and two base (GC) insertions in the position 8 bases from the end of intron 6 of the CYP4V2 gene, also referred to as IVS6-8del / insGC, see SEQ ID NO: 46, which shows the sequence of a human CYP4V2 genomic DNA region comprising the c.802-8_810del17insGC mutation, and SEQ ID NO: 47, which shows the corresponding wild-type sequence). The c.802-8_810del17insGC mutation is shown in the following sequence showing the human CYP4V2 intron 6-exon 7 junction. The intron 6 sequence is shown in lower case letters and the exon 7 sequence is shown in upper case letters. The 17 bp deletion and GC insertion are located within the parentheses): caa aca gaa gca tgt gat tat cat tca aa(tca tac agG TCA TCG CT)(GC)GAA CGG GCC AAT GAA ATG AAC GCC AAT GA (SEQ ID NO: 46), resulting in a predicted skipping of exon 7. (Xiao et al., Biochem Biophys Res Commun. 409: 181-6, 2011; Meng et al., 2014, Mol. Vis., 20: 1806-14; Wada et al., Am J Ophthalmol. 139: 894-9, 2005; Jiao et al., European Journal of Human Genetics (2017) 25, 461-471). A recent study estimated that the c.802-8_810del17insGC mutation has been present for 1,040 to 8,200 generations in the Chinese population and for 300 to 1100 generations in the Japanese population. See Jiao et al., European Journal of Human Genetics (2017) 25, 461-471.

[0315] Cell therapy (also referred to as cellular therapy or cytotherapy) can be used as described herein for treating or preventing an eye disease in a subject. As described herein, the BCD, certain RPs, IRDs, and other eye diseases referred to herein are associated with genetic or epigenetic alterations in CYP4V2 nucleic acid sequences.

[0316] Cell therapy generally involves injection, implantation, transplantation, or other delivery of a composition comprising cells to a subject (e.g., into a tissue or organ (e.g., an eye) of a patient). The methods described herein are unique in that they allow for a genetically repaired autologous cell therapy for subjects having an eye disease.

[0317] The methods described herein include obtaining cells from a subject having an eye disease (e.g., associated with a genetic or epigenetic alteration in a CYP4V2 nucleic acid sequence) and repairing a mutation within a CYP4V2 nucleic acid (e.g., DNA or RNA) using, for example, gene editing, or repairing via delivery of a nucleic acid sequence encoding a functional CYP4V2 protein (e.g., gene transfer). Prior to administering the cells back into the subject (e.g., into the eye of the subject), the cells can be made pluripotent (e.g., by inducing pluripotency, e.g., to make iPSCs) and can be differentiated into one or more ocular cells (e.g., iPS-RPE, iPS-CEC, iPS-PRC). It will be appreciated that the cells can be genetically repaired prior to or after the cells are made pluripotent or after the cells are differentiated into ocular cells.

[0318] A. Cell origin

[0319] In some cases, autologous cells (e.g., subject (e.g., patient)-specific cells) can be used in the cell therapy methods described herein. For example, cells such as fibroblasts or peripheral blood mononuclear cells (PBMCs) can be obtained from a subject and used to generate iPSCs, as described in the Examples section. Almost all types of cells can be used to generate iPSCs, and thus can be used as source cells. In some cases, iPSCs can be generated using cells obtained from urine (see, e.g., Zhou et al., 2012, Nat. Protoc., 7:2080-9) or hair follicle or dermal papilla cells (see, e.g., Muchkaeva et al., 2014, Acta Naturae, 6:45-53).

[0320] B. Inducing pluripotency

[0321] Methods of making induced pluripotent stem cells (iPSCs) are known in the art to which the present disclosure pertains. Briefly, iPSCs can be made by introducing a specific set of proteins (e.g., nucleic acids encoding a specific set of proteins) into a cell. Those skilled in the art will appreciate that one exemplary, non-limiting method is by introducing one or more transgenes encoding OCT4, SOX2, KLF4, c-MYC (e.g., “Sakkers Factor”). In some embodiments, reprogramming uses all four transcription factors. In some embodiments, one, two, or three transcription factors can be used. Li et al., Stem Cells, 2009; 27:2992-3000. Zhu et al., Cell Stem Cell 2010; 7:651-655. In some embodiments, iPSCs can be generated by direct delivery of reprogramming proteins. Kim et al., Cell Stem Cell. 2009; 4(6):472-6. The Examples section provides methods for generating iPSCs using non-integrating methods, e.g., by Sendai virus (Example 1) or by episomal methods (Example 2). However, any method of generating iPSCs is contemplated within the scope of the present disclosure.

[0322] iPSCs can be generated using various methods (e.g., Sendai virus, episomal methods, with or without small molecules), see the Examples section, see also, e.g., Hubbard et al., J. Vis. Exp., 2014, 92:52009. Further, methods of making iPSCs from a variety of different cell types are known in the art to which the present disclosure pertains. See, e.g., Hayashi et al., 2012, PLoS One, 7(9):e45435; Poon et al. 2015, PLoS One, 10(7):e0131288; Lamba et al. 2010, PLoS One, 5(1):e8763. iPSCs typically express detectable levels of at least one marker, including but not limited to Oct-4, Sox-2, SSEA4, TRA-1-60, TRA-1-81, AP, and / or NANOG.

[0323] Any type of stem cell can be used in the cell therapy methods described herein, including but not limited to induced pluripotent stem cells (iPSCs), hematopoietic stem cells (HSCs), embryonic stem (ES) cells, mesenchymal stem cells, adult stem cells, or tissue-specific stem cells. Stem cells used in the methods described herein can be multipotent, pluripotent, or totipotent stem cells.

[0324] The term "pluripotent" as used herein refers to a cell that is capable of developing into at least one of ectoderm, endoderm, and mesoderm cells. In one embodiment, the term "pluripotent" refers to a cell that is totipotent and multipotent. The term "totipotent" cell as used herein refers to a cell that is capable of developing into cells of all lineages. The term "multipotent" as used herein refers to a cell that has not undergone terminal differentiation. The pluripotent cells of the present application can be any stem cell, or generated from a non-pluripotent cell, such as a fibroblast, using induction, dedifferentiation, and nuclear transfer methods known in the art. The pluripotent cells described herein, whether stem cells or generated from non-pluripotent cells, can be from a subject having BCD or having a CYP4V2 mutation or a healthy individual.

[0325] iPSCs can be characterized by one or more of: a. a unique morphology of the iPSC; b. one or more pluripotency markers, such as Oct-4, Sox-2, SSEA-4, TRA-1-60, TRA-1-81, Nanog, and AP; c. the ability to differentiate into a desired cell type (e.g., RPE cells); and / or d. teratoma analysis. Not all of the above are necessary to characterize an iPSC and verify pluripotency (e.g., teratoma; see, e.g., Buta et al., 2013, Stem Cell Res., 11(1):552-562).

[0326] C. Gene Editing

[0327] A variety of gene editing techniques can be used in the methods described herein to repair genetic or epigenetic alterations present in the CYP4V2 nucleic acid of a subject. Gene editing can be performed using any number of techniques, including clustered regularly interspaced short palindromic repeats (CRISPR) technology (see, e.g., U.S. Patent Nos. 8,697,359; 8,889,418; 8,999,641; and US2014 / 0068797), transcription activator-like effector nucleases (TALEN) technology (see, e.g., Li et al., 2011, Nucleic Acids Res., 39(14):6315-25), or zinc finger nuclease technology (see, e.g., Wright et al., 2005, The Plant J., 44:693-705).

[0328] To accomplish gene editing using CRISPR technology, a nucleic acid encoding a nuclease (e.g., often a Cas9 nuclease, but other nucleases can also be used (e.g., other Cas nucleases, such as Cpfl, or non-Cas nucleases)) can be incorporated into one or more vectors and administered to a subject as described herein. By way of example only, cells described herein (e.g., a subject cell prior to reprogramming into an iPSC, a subject iPSC prior to differentiation into RPE, corneal epithelial cells, or photoreceptor cells, or after differentiation into RPE, corneal epithelial cells, or photoreceptor cells (referred to herein as "iPSCs-RPE," "iPSC-CEC," or "iPSC-PRC")) can be transduced or transfected with one or more constructs (e.g., vectors, RNPs, mRNAs) containing and / or encoding at least one guide RNA (gRNA), at least one CRISPR-associated protein (e.g., Cas9 or Cpfl), and at least one donor template nucleic acid. In some embodiments, a donor template nucleic acid is not required, e.g., when gene repair is achieved via a knock out.

[0329] Likewise, to accomplish gene editing using TALEN technology, a nucleic acid encoding a TALEN (e.g., a dimeric transcription factor / nuclease) can be incorporated into a vector and administered to a subject as described herein. Likewise, to accomplish gene editing using zinc finger nuclease technology, a nucleic acid encoding a custom DNA endonuclease (e.g., a heterodimer, where each subunit contains a zinc finger domain and a Fokl endonuclease domain) can be incorporated into one or more vectors and administered to a subject as described herein.

[0330] The components required to perform each of these technologies are commercially available and can be customized for a particular target sequence. See, e.g., Caribou Biosciences; GenScript, CRISPR Therapeutics; Editas Medicine; Cellectis Bioresearch; Life Technologies; Sangamo BioSciences; or Sigma Aldrich Chemical Co.

[0331] In appropriate cases, gene editing can occur such that the genetic or epigenetic alteration in the CYP4V2 nucleic acid of the subject is repaired, such that a functional CYP4V2 protein is expressed. A CYP4V2 nucleic acid sequence is repaired when the presence of CYP4V2 nucleic acid (e.g., CYP4V2 mRNA) is restored, the presence of CYP4V2 protein is restored, or the function of CYP4V2 protein is restored. Likewise, "repairing" or "correcting" can refer to restoring an affected sequence (e.g., a genetic or epigenetic alteration) to a wild-type sequence or another non-mutated sequence as described herein.

[0332] There can be cases where it is desirable to use gene editing to introduce one or more mutations into a cell (e.g., in a CYP4V2 nucleic acid). This is one way to create a cellular model of a disease (e.g., BCD). For example, embryonic stem cells (ES cells) can be gene edited to produce cell lines with artificial CYP4V2 mutations, which can then be differentiated into RPE cells. Alternatively, iPS cell lines or RPE cell lines (e.g., ARPE-19 cell lines) from healthy subjects (e.g., non-BCD subjects) can be gene edited to produce CYP4V2 mutant iPS or RPE cell lines.

[0333] In some cases, it is desirable to screen cells (e.g., using whole genome sequencing) after the gene editing step is complete to confirm that the targeted mutation has been repaired and that no significant off-target editing has occurred.

[0334] CRISPR and CRISPR-associated protein 9 (Cas9) is referred to as CRISPR-Cas9, consisting of a RNA-guided nuclease (Cas9) and a guide RNA, creates site-specific DNA breaks, which are repaired by endogenous cellular mechanisms. Possible outcomes of this approach include mutation of specific sites via mutagenic non-homologous end-joining (NHEJ), creation of insertions or deletions (indels) at the break site, and precise alteration of genomic sequences via homologous recombination (HR) using an exogenously introduced donor template. The CRISPR guide RNA consists of two RNAs, which are referred to as CRISPR targeting RNA (crRNA, also referred to herein as CRISPR RNA) and trans-activating crRNA (tracrRNA). The crRNA is typically about 20 nucleotides (nt) long. It hybridizes with the target DNA sequence by Watson-Crick base pairing and directs the Cas endonuclease to cleave the target genomic DNA.

[0335] To repair the most common CYP4V2 mutations via gene editing, various CYP4V2 mutation CRISPR correction constructs were developed (see the Examples section). CRISPR was used because it is simpler to implement and has higher editing efficiency than other forms of gene editing, such as TALENs and zinc finger nucleases. The CRISPR constructs contain optimized and in vitro validated gRNA sequences and different construct options that can be readily used to correct the c.802-8_810del17insGC mutation in BCD patient cell lines, resulting in gene-corrected cells that can be used in cell therapies for BCD, including but not limited to autologous cell therapies.

[0336] CRISPR gene editing therapy involves the use of a CRISPR-associated protein (Cas), which is a nuclease and a CRISPR guide RNA. The role of the CRISPR guide RNA is to guide the Cas to the sequence targeted by the CRISPR guide RNA, which is via the protospacer element contained in the CRISPR guide RNA that is complementary to (or specific to) the target sequence. In order for the Cas (e.g., Cas9 or Crfl) to bind to and cleave the target sequence or near the target sequence, the presence of a protospacer adjacent motif (PAM) sequence is also required. The PAM sequence is a short stretch of DNA (usually 2-6 nucleotides) that serves as a binding signal for the Cas. Different Cas can have different PAM and cleavage patterns. For example, for S. pyogenes Cas9 (SpCas9), the typical PAM sequence is NGG. For S. aureus (SaCas9), the PAM sequence is NGRRT or NGRRN. For N. meningitidis (NM) and T. denticola (Td), the PAM sequences are NNNNGATT and NAAAAC, respectively. Engineered or mutated Cas can also cause PAM sequence changes. For example, the PAM sequence for SpCas9 VQR variant (D1135V, R1335Q, and T1337R) is NGAN or NGNG. The PAM sequence for SpCas9 EQR variant (D1135E, R1335Q, and T1337R) is NGAG. The PAM sequence for SpCas9 VRER variant (D1135V, G1218R, R1335E, and T1337R) is NGCG. For Cpf1, the PAM sequence is TTTN. Cas usually creates a double-stranded break (DSB), but altered Cas can cause a single-stranded break (e.g., SpCas9 Nickase (Cas9n D10A)) or no break (dCas9). Cas9 creates a blunt end 3 nt upstream of the PAM site, while Cpf1 cleaves in a staggered manner, creating a 5-nucleotide 5' overhang 18-23 bases away from the PAM.

[0337] The CRISPR guide RNA for Cas9 typically comprises a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA). The crRNA comprises a protospacer element sequence designed to be complementary to (or specific for) a targeted sequence within or near a gene targeted for correction, disruption, or replacement, and a sequence corresponding to the complementary region of the tracrRNA. The tracrRNA comprises a region complementary to the corresponding region of the crRNA and a sequence that interacts with CRISPR-associated protein 9 (Cas9). Cpf1 does not require a tracrRNA.

[0338] The protospacer element is typically about 20 nucleotides in length. Longer or shorter protospacer element sequences (about 16-24 nt) can also be used. The protospacer element can be 100% complementary to the target sequence or can contain mismatches to the target sequence. In some embodiments, a "G" nucleotide can optionally be added at the beginning of the protospacer element sequence.

[0339] After the DNA molecule is cleaved by Cas, it can be repaired in one of two ways. Error-prone non-homologous end joining (NHEJ) repair can result in an indel mutation that disrupts the function of the protein encoded by the gene. NHEJ can be used to create artificial mutations in a cell line. In some embodiments, it can be used to create a mutation (e.g., an indel in an exon or splice acceptor region) in the CYP4V2 gene of a cell line (e.g., an ES cell, iPS cell, or ARPE-19 cell line) that does not have an endogenous CYP4V2 mutation, thereby creating a disease cell model (e.g., a BCD cell model). In addition, two additional CRISPR guide RNAs can be used together to knock out the targeted region of a target gene or the entire target gene, thereby creating a knockout model. In some embodiments, CRISPR-based gene silencing is used to disrupt (or silence) or defect a gene, e.g., to treat a dominant genetic disease. During gene silencing, the cell attempts to repair the broken DNA, but NHEJ often accompanies errors that disrupt the gene when it does so, effectively silencing the gene. In some embodiments, NHEJ can also cause correction of the mutation, e.g., especially when the mutation is a single nucleotide variation or no more than about 10 nucleotides. Alternatively, if a donor nucleic acid sequence is available, the DNA break can be repaired by homology-directed repair (HDR) for correction or replacement of the target gene. The donor nucleic acid sequence can be provided as a single-stranded DNA (ssDNA), or a single-stranded oligo DNA nucleotide (ssODN), or a vector. In some embodiments, for a donor nucleic acid sequence provided as an ssODN, the donor nucleic acid sequence is no more than about 1 kb, 800 bp, 600 bp, 500 bp, 400 bp, 300 bp, 280 bp, 260 bp, 240 bp, 220 bp, or 200 bp. In some embodiments, for a donor nucleic acid sequence provided as a vector, the donor nucleic acid sequence is no more than about 25 kb, 20 kb, 15 kb, 10 kb, 9 kb, 8 kb, 7 kb, 6 kb, 5 kb, 4.5 kb, 4 kb, 3.5 kb, or 3 kb. In some embodiments, the donor nucleic acid sequence is symmetric. In some embodiments, the donor nucleic acid sequence is asymmetric. In some embodiments, the length of the donor nucleic acid sequence can be adjusted for higher HRD rates. In some embodiments, if the PAM targeted by the Cas used in the CRISPR gene editing is also present in the donor nucleic acid sequence, it can be mutated (to a different nucleotide) so that the PAM is no longer present in the donor nucleic acid sequence, thereby avoiding cleavage and destruction of the donor template or the DNA sequence repaired from the donor template by Cas.In addition to correcting or replacing a mutant or defective gene or portion thereof, HDR can also be used to create artificial mutations (e.g., insert mutations in an exon or splice acceptor region) in the CYP4V2 gene of a cell line (e.g., ES cell, iPS cell, or ARPE-19 cell line) that does not have an endogenous CYP4V2 mutation, thereby creating a disease cell model (e.g., a BCD cell model).

[0340] The CRISPR guide RNA and Cas used in CRISPR gene editing therapies can be provided in the form of a vector (e.g., a plasmid (e.g., pX330, pX458, pX459), a recombinant AAV vector, or a recombinant lentivirus vector) or mRNA and / or RNA and protein encoding such components.

[0341] The donor template can be provided as an ssDNA (e.g., ssODN) or cloned in a plasmid or other type of vector (e.g., an AAV vector (e.g., AAV2 or AAV6)) for use in HDR.

[0342] A variety of compositions and methods can be used to improve on-target editing or repair efficiency and / or reduce potential off-targets. For example, different Cas (e.g., Cas9 or Cpfl) or Cas of different species (e.g., SpCas9, SaCas9, NM Cas9) or variants (SpCas9, SpCas9VQR) can be used to broaden the PAM selection available for target sequences, thereby enhancing specificity. If the target sequence region lacks an NGG PAM site for SpCas9 but is rich in AT, then Cpfl can be considered instead. Cas9 nickases (e.g., Cas9 D10A) only create a single-strand break in the target DNA, thus requiring two paired CRISPR guide RNAs to create a double-strand break. This requirement significantly increases the on-target specificity because it is unlikely to create two off-target nicks in close enough proximity to cause a DSB. In addition, asymmetric donor templates can enhance the HDR rate. dCas9 that is catalytically inactive does not cut the target DNA, but still enables sequence replacement without any error-prone repair that usually accompanies Cas9 cleavage. See Richardson et al., Nature Biotechnology 34, 339-344 (2016).

[0343] Achieving targeted gene correction while avoiding or minimizing off-target editing are two goals of gene editing. Previous studies have revealed off-target mutations arising from gene editing technologies including, but not limited to, CRISPR and TALENs, see, e.g., Tsai et al., Nature Biotechnology 33, 187-197 (2015); Wang et al., Nature Biotechnology 33, 175-178 (2015); Wu, W.H. et al. CRISPR repair reveals causal mutation in a preclinical model of retinitis pigmentosa. Mol. Ther. 24, 1388-1394 (2016). For gene editing used in vivo or in cell therapy (e.g., ex vivo in cells that are then transplanted in vivo), the second goal, avoiding or minimizing off-target editing, is as important as achieving targeted gene correction because off-target editing can cause disease or induce tumor formation. It should be noted that not all off-target editing can be predicted with computer software or algorithms.

[0344] Accordingly, careful design, validation, and refinement were used to develop and validate CYP4V2 mutation CRISPR gene correction constructs:

[0345] (1) Multiple candidate gRNAs were generated based on the mutant CYP4V2 nucleic acid sequence containing the c.802-8_810del17insGC mutation;

[0346] (2) The top 5 gRNAs were selected using the following criteria (see SEQ ID NOs: 48-52, Table 5, and Figure 12 ) :

[0347] a. proximity of gRNA cleavage site to modification site, and

[0348] b. off-target profile of gRNA;

[0349] (3) The activity of the top 5 gRNAs was validated in genomic DNA from a BCD patient homozygous for the c.802-8_810del17insGC mutation (see Figure 13 ) ;

[0350] (4) Three gRNAs were selected based on (2) and (3). Each of the 3 gRNAs was cloned into the pX459 plasmid along with a nucleic acid sequence encoding Cas9 and a puromycin resistance gene (Puro) (see Figure 15 ) so that transfected cells could be selected using puromycin.

[0351] (5) Two donor templates (both sense and anti-sense complementary) were generated that provide the HDR donor nucleic acid sequence. ssODNs containing the donor template sequences were synthesized by IDT (see SEQ ID NOs: 56 and 57).

[0352] (6) In addition to the plasmid constructs, CRISPR RNP constructs were also developed. RNP constructs have certain advantages over other constructs. A detailed discussion is provided below and in the Examples section.

[0353] (7) CYP4V2 CRISPR correction constructs were validated in iPS cells derived from a BCD patient homozygous for the c.802-8_810del17insGC mutation.

[0354] (8) Whole genome sequencing was performed in unmodified cells and iPS cells genetically repaired by CYP4V2 mutation CRISPR correction constructs to confirm correction of the c.802-8_810del17insGC mutation and to assess off-target editing.

[0355] Methods to determine the optimal conditions for transfection in iPSCs and for selecting transfected cells are provided. See the Examples section for details. It is contemplated that these constructs can be used not only to treat BCD patient specific iPS cells in vitro, but also to treat source cells (e.g., fibroblasts or PBMCs) or iPS-RPE, iPS-PRC, iPS-CE cells or iPS-CEC cells or other ocular cells derived from BCD patient specific iPS cells in vitro and in vivo in patients with the c.802-8_810del17insGC mutation. In one embodiment, the components of the constructs can be used directly. In some embodiments, the components in the constructs can be modified or cloned into different vectors to achieve higher in vivo transduction efficiency or higher specificity for the target cell type or to achieve other purposes. For example, Cas9 can be modified to be a Cas9 nickase (Cas9n D10A) that contains a mutation that allows the endonuclease to make a single-strand cut rather than a double-strand break. Pairing two opposite facing gRNA sequences with a SpCas9 nickase is an effective method of gene editing that prevents the formation of undesirable indels. In addition to plasmids, other common vectors for packaging CRISPR components include lentiviral vectors and adeno-associated viral (AAV) vectors. When using AAV vectors, a S. aureus Cas9 ortholog (SaCas9) can be used as the endonuclease because SaCas9 is about 1 kb shorter than SpCas9 and provides additional flexibility to the AAV packaging constraints.

[0356] Various modifications were made to the CRISPR RNP construct. Synthetic sgRNA was used instead of IVT sgRNA or crRNA:tracrRNA duplex. Synthetic gRNA has higher purity than IVT sgRNA, thus the risk of off-target editing caused by impurities in sgRNA can be reduced. In addition, chemical modifications were applied to sgRNA to prevent intracellular degradation of sgRNA, which can improve editing efficiency. More details can be found in the example section.

[0357] It is contemplated that mRNA constructs comprising Cas9-encoding mRNA and guide RNA oligonucleotides can also be used in addition to the plasmid constructs and CRISPR RNP constructs described herein.

[0358] After transfecting the BCD patient-specific iPS cells with the CYP4V2 mutation CRISPR correction construct, the transfected cells are selected using puromycin. It is understood that other markers such as GFP can be incorporated into the construct and used as a marker in place of or in addition to puromycin. Single cell cloning is performed after selection, after which some cells from the single cell clones are collected for sequencing. After the sequencing results confirm that the target gene editing was successful and no pathogenic gene editing was found, the remaining cells of the same clone are used to differentiate into the desired ocular cell type, such as iPS-RPE cells.

[0359] D. Differentiation of iPSCs

[0360] Genetically repaired BCD patient iPS cells are differentiated into iPS-RPE cells (or another type of ocular cell (e.g., iPS-CEC, iPS-CE cell, or iPS-PRC). Methods of differentiating iPSCs into RPE cells or another type of ocular cell (e.g., CEC and PRC) are known. See, e.g., Hayashi et al., 2012, PLoS One, 7(9):e45435; Songstad et al., Investigative Ophthalmology & Visual Science December 2015, Vol. 56, 8258-8267; and Lamba et al., PLoS One. 2010 Jan 20; 5(1): e8763. For example, induced pluripotent stem cells (iPSCs) can be generated from the reprogramming of cells and these cells can be further differentiated into, for example, RPE cells (referred to herein as “iPS-RPE”), corneal epithelial cells (referred to herein as “iPS-CEC”), photoreceptor cells (or photoreceptor progenitor cells; referred to herein as “iPS-PRC”), or iPS-choroid endothelial (CE) cells (referred to as “iPS-CE”).

[0361] The differentiated cells (e.g., iPS-RPE cells) are tested for biochemical function as described in the Examples section to confirm that their biochemical function has been improved compared to iPS-RPE cells from a patient without genetic repair.

[0362] iPSC-RPE cell lines produced as described herein exhibit a morphology (e.g., pigmentation and hexagonal shape) and / or express one or more biomarkers indicative of RPE cells. Biomarkers for RPE cells (and iPS-RPE cells) are known and include, but are not limited to, one or more of RLBP1 (also known as CRALBP), RPE65, Bestrophin-1, MITF, Vinculin, LRAT, RDH5, PAX6, MERTK, TYR, and / or ZO-1, and can be used to determine or confirm that RPE differentiation has occurred. Likewise, biomarkers for CECs (and iPS-CECs) and PRCs (and iPS-PRCs) are known and include, for example, cytokeratin 12 and cytokeratin 3 for corneal epithelial cells; Crx for photoreceptors; recoverin for rods and cones; and Nrl for rods.

[0363] E. Administration / Delivery

[0364] Genetically repaired iPS-RPE cells can be used for autologous transplantation into the patient from which the iPS-RPE cells were derived. Patients with BCD or another ocular condition due to a CYP4V2 mutation can be treated with the cell therapy methods provided herein. Likewise, the methods can be used to provide a genetically repaired autologous cell therapy for other ocular diseases caused by one or more genetic mutations.

[0365] Methods of administering or delivering cells are known, and methods of administering or delivering cells to the eye are known, see, e.g., Wert et al., J Vis Exp. 2012; (69): 4286; WO 2016 / 179496; Schwartz et al., Investigative Ophthalmology & Visual Science April 2016, volume 57, ORS Fc1-ORS Fc9. In one embodiment, ocular cells can be transplanted via injection of a cell suspension (e.g., RPE cell suspension). In another embodiment, cells can be transplanted as part of a patch or scaffold, e.g., using natural and / or synthetic scaffolds to generate polarized, functional RPE monolayers in vitro tissues.

[0366] A therapeutically effective amount of cells for administration to the eye is known to those of skill in the art and will vary with the type of cells to be transplanted, the maturity of the cells to be transplanted and whether division after transplantation is desired, the size of the area targeted for replacement or the number of cells, and the subject to be treated (e.g., the age, sex, weight, disease, and stage of development of the disease and condition of the subject to be treated); the route of administration; and the desired regimen. In a single administration, a therapeutically effective amount of cells used in ocular cell therapy can range from about 1* 10 3 to about 1* 10 8 cells.

[0367] While iPSC cell lines can be generated for individual subjects, iPSC cell banks can also be generated with common HLA haplotypes (or in which the HLA haplotype has been genetically manipulated) that will be designed to achieve immunologic match with a large portion of the patient population. See, e.g., Turner et al., Cell Stem Cell, 13:382-384, 2013. In addition, iPSC cell lines can be generated to be immunologically silent, regardless of the genotype of the subject (see, e.g., Riolobos et al., Mol. Ther., 21 :1232-41, 2013). When combined with these approaches, patient-specific iPS cells and iPS-ocular cells can be used not only narrowly autologously, but also for transplantation into other patients.

[0368] The cell therapy administration step typically occurs after the onset of disease symptoms or after the subject has shown signs of retinal degeneration or corneal dystrophy, if applicable. In one embodiment, the ocular cell therapies provided herein can be used independently to treat an ocular disease (e.g., BCD). In another embodiment, the ocular cell therapies provided herein can be used in combination with one or more other treatment options, including but not limited to the CYP4V2 gene transfer therapies and / or CYP4V2 CRISPR gene editing therapies provided herein.

[0369] Likewise, the administration can occur one or more times (e.g., over the course of weeks, months, or years) and can be administered to the same eye or to the contralateral eye. In addition, one or more types of cells can be administered in a single administration or administered separately.

[0370] Post-treatment assessments can use methods described in the CYP4V2 gene therapy section herein, including but not limited to via ocular examination, such as visual function, e.g., as measured by visual acuity, visual field, dark adaptation, visual function, and / or Optical Coherence Tomography (OCT, e.g., Spectral Domain-OCT (SD-OCT)), and ERG.

[0371] Methods of using CRISPR RNP in ocular cell therapy and gene therapy

[0372] A CRISPR RNP is a gene editing ribonucleoprotein (RNP) complex that includes a guide RNA complexed with a Cas protein (e.g., a Cas9 protein). The guide RNA is composed of two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). In one embodiment, the crRNA and tracrRNA are provided as two separate nucleic acid molecules. In another embodiment, the crRNA and tracrRNA can be combined in a chimeric single guide RNA (sgRNA). The sgRNA can be about 100 nucleotides (nt) in length, or can be shorter or longer as desired or necessary. The twenty nt at the 5' end (crRNA) hybridizes to the target DNA sequence by Watson-Crick base pairing and directs the Cas endonuclease to cleave the target genomic DNA, with the remaining double-stranded structure on the 3' side serving for Cas9 recognition.

[0373] CRISPR RNP has advantages and disadvantages compared to traditional Cas9 / gRNA constructs (e.g., plasmid constructs incorporating nucleic acid sequences of CRISPR guide RNA and Cas9 protein). For example, the guide RNA (crRNA and tracrRNA) and Cas9 protein can be delivered to the target cell as a complete complex, thus not requiring the cell's own transcription machinery to express the CRISPR components. Therefore, CRISPR RNP is able to edit rapidly after transfection. In addition, the CRISPR components are consumed from the cell more quickly, which can reduce the possibility of off-target editing. Furthermore, it can reduce the possibility of integration mutagenesis caused by plasmids. Given these advantages, RNP is also advantageous in in vivo gene editing. However, on the other hand, because RNP is quickly cleared from the cell via protein degradation, the on-target editing efficiency of RNP can be lower than plasmid constructs that have a longer duration of expression in the cell.

[0374] To assess the above hypotheses and demonstrate whether CRISPR RNP constructs can achieve both the desired gene editing and gene therapy goals in ocular cell therapy, two sets of constructs were designed. One construct was a plasmid construct and the other was an RNP construct. Both constructs were transfected using iPS cells from the same BCD patient and then sequenced to analyze on-target gene repair and off-target editing in each construct. Off-target editing was determined by comparison to genomic DNA from unmodified fibroblasts from the same patient. Results from the plasmid and RNP constructs can be compared.

[0375] Detailed descriptions of the RNP, methods of forming the RNP, and using the RNP construct to generate gene-corrected cells (iPS and iPS-RPE cells) for BCD patients are provided in the Examples section.

[0376] It should be noted that similar CRISPR RNP constructs can be used to correct or inactivate other mutations of BCD and other mutations of RP and IRD. In one aspect, the crRNA sequence used herein is changed to another crRNA sequence that specifically targets a different target mutation sequence. In another aspect, the guide RNA or sgRNA in the RNP construct can be modified to enhance gene editing efficiency. See Hendel et al., Nat Biotechnol. 2015 Sep;33(9):985-989. In some embodiments, the CRISPR RNP construct can be transfected using electroporation. In some embodiments, the CRISPR RNP construct can be transfected using lipofection or nucleofection. In some embodiments, the CRISPR RNP construct can be delivered via microinjection.

[0377] In addition to in vitro gene repair and treatment of patient cells, CRISPR RNP constructs can also be used to treat ocular diseases caused by genetic mutations in vivo and have advantages over other types of CRISPR constructs (e.g., plasmids and / or mRNAs encoding CRISPR components) in in vivo applications. For example, CRISPR RNP constructs have higher potency, lower off-target risk, and / or lower toxicity or innate immune response activation compared to in vitro transcribed Cas9 mRNA and sgRNA. In one embodiment, a CRISPR RNP construct comprising a Cas9 protein complexed with a guide RNA targeting a region of a mutant DNA sequence can be directly injected into the eye of a subject (e.g., subretinal injection, intravitreal injection, or injection into the cornea). In another embodiment, a Cas9 variant engineered with multiple SV40 nuclear localization sequences (NLS) that have been shown to increase editing efficiency in brain cells in vivo (Staahl et al., Nat Biotechnol. 2017 May; 35(5):431-434) can be used to achieve higher editing efficiency in ocular cells. Cas9 proteins with one or more NLS (at the N- and / or C-terminus) are commercially available from various CROs such as IDT and Feldan. In some embodiments, the CRISPR RNP construct is delivered “as is.” In some embodiments, the CRISPR RNP construct is formulated with a pharmaceutically acceptable carrier at the time of delivery. In some embodiments, the CRISPR RNP construct is delivered in a packaged form, e.g., in a nanoparticle.

[0378] It is understood that the ratio between the CRISPR RNP components (e.g., guide RNA and Cas9 protein) can be adjusted and optimized by testing different ratios in patient cell lines in vitro prior to in vitro or in vivo treatment (e.g., BCD patient-specific iPS cells or iPS-RPE cells). The CRISPR RNP construct can be used independently or in combination with another CRISPR construct, including but not limited to a plasmid or vector encoding a CRISPR guide RNA or crRNA, or a Cas protein or a combination thereof; a Cas9-encoding mRNA; a guide RNA oligonucleotide; another CRISPR RNP construct; or a combination or hybrid thereof. In addition, the CRISPR RNP construct can be used to correct or inactivate one or more mutations associated with one or more ocular diseases.

[0379] Gene therapy in combination with cell therapy treatment

[0380] The disclosures herein provide various treatment options for BCD and other ocular diseases caused by mutations in CYP4V2, including but not limited to CYP4V2 gene transfer therapy and CYP4V2 CRISPR gene editing therapy. CYP4V2 gene transfer therapy and CYP4V2 gene editing therapy can be used in vivo or in vitro or both. When implemented in vivo, CYP4V2 gene transfer therapy and / or CYP4V2 CRISPR gene editing therapy can treat remaining ocular cells affected by BCD as a gene therapy. When implemented in vitro in patient cells or cells derived from a patient, the cells treated by CYP4V2 gene transfer therapy and / or CYP4V2 CRISPR gene editing therapy can be transplanted into the patient as a cell therapy to replace dead or degenerating ocular cells. Notably, the gene therapy and cell therapy compositions and methods provided herein can be combined to provide additional benefits to the patient that cannot be achieved by using gene therapy or cell therapy alone. The "combination therapy" can also expand the eligible patient base. For example, for late stage patients who have little or no photoreceptor or RPE cells left, gene therapy is not as effective as in early stage patients. In this case, cell therapy can benefit by providing new cells (e.g., RPE or photoreceptor cells), while gene therapy can improve the effectiveness of cell therapy by rescuing remaining RPE or photoreceptor cells and / or by improving the condition of the choroidal cells, which affect the condition of ocular cells. The combined "rescue" and "replacement" effects of gene therapy and cell therapy each make the combination therapy an improvement over gene therapy or cell therapy alone. This combination therapy approach can be applied to other ocular diseases caused by one or more genetic mutations.

[0381] Methods and compositions for CYP4V2 gene therapy

[0382] The present disclosure relates to various compositions comprising nucleic acid molecules encoding functional CYP4V2 proteins and various methods of using these compositions to treat ocular cells and / or ocular diseases. In one embodiment, the functional CYP4V2 proteins can be used directly for therapeutic purposes. In some embodiments, nucleic acid molecules encoding functional CYP4V2 proteins are used. In some embodiments, expression cassettes are used to direct and control expression of the products of the nucleic acid molecules, the expression cassettes comprising such nucleic acid molecules encoding functional CYP4V2 proteins operably linked to one or more regulatory sequences. In some embodiments, vectors are used to package the CYP4V2 expression cassettes comprising the nucleic acid molecules encoding functional CYP4V2 proteins and one or more regulatory sequences in order to enhance delivery to target cells and to achieve the desired expression of the products of the CYP4V2-encoding nucleic acid molecules and the expression cassettes.

[0383] In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the vector is a plasmid. In some embodiments, the vector is another type of viral vector or non-viral vector. The methods of treatment comprise administering or delivering an effective amount (or effective concentration) of these vectors to the eye and / or target cells of a subject. In one embodiment, the treatment is administered directly in vivo. In another embodiment, the treatment comprises ex vivo treatment of target cells (e.g., ocular cells) and transplantation of the treated target cells into a subject (e.g., into the eye of a subject). These methods of treatment are directed to ocular diseases and other conditions associated with CYP4V2 mutations. In one embodiment, the ocular disease is Crystalline Retinal Dystrophy (BCD).

[0384] A. Functional CYP4V2 Proteins and Nucleic Acids Encoding Functional CYP4V2 Proteins

[0385] CYP4V2 (Cytochrome P450, Family 4, Subfamily V, Polypeptide 2, (MIM 608614), synonym: CYP4AH1) is one of the proteins in the cytochrome P450 superfamily (P450) and a member of the cytochrome P450 subfamily 4 (CYP4). Cytochrome P450 (CYP) is an important heme-containing protein known for its role as an oxidizing enzyme. The term P450 is derived from the spectrophotometric peak at 450 nm of the enzyme when in the reduced state and complexed with carbon monoxide. It is involved in the metabolism of xenobiotics and endogenous compounds, such as steroids and fatty acids. CYP enzymes have been identified in all kingdoms of life: animals, plants, fungi, protists, bacteria, archaea, and even viruses. However, it is not ubiquitous; for example, CYP enzymes have not been found in E. coli.

[0386] P450 proteins serve as key elements in the structure. For example, P450 proteins can be identified by their signature sequence element FXXGXXXCXG (SEQ ID NO: 30), where the cysteine serves as an axial ligand for the heme iron. Sequence identity among P450 proteins is relatively low, but their general topography and structural fold are highly conserved. The conserved core consists of a coil called the'meander', a four-helix bundle, helices J and K, and two sets of beta-sheets. These make up the haem-binding loop (with an absolutely conserved cysteine that serves as the fifth ligand for the heme iron), the proton-transfer groove, and the conserved EXXR motif (SEQ ID NO: 31) in helix K. P450 proteins are the major membrane-associated proteins located in the inner membrane of the cell's mitochondria or in the endoplasmic reticulum.

[0387] In addition to structural similarity, P450 proteins also share functional similarity. The most common reaction catalyzed by P450 enzymes is a monooxygenase reaction, such as insertion of one oxygen atom into an aliphatic position of an organic substrate (RH) while the other oxygen atom is reduced to water:

[0388] RH + O2+ NADPH + H + → ROH + H2O + NADP +

[0389] Many hydroxylation reactions (insertion of a hydroxyl group) use P450 enzymes. Many P450 enzymes have steroids and / or fatty acids as substrates.

[0390] The human CYP4V2 protein (NCBI RefSeq: NP_997235.3) has 525 amino acids (the amino acid sequence is shown in SEQ ID NO: 4). There are variants of the human CYP4V2 protein, including pathological variants (i.e., mutations) (see Table 1 herein for a select list of CYP4V2 mutations in BCD patients) and non-pathological (i.e., functional) variants.

[0391] In one aspect, the functional CYP4V2 protein is the human CYP4V2 protein (SEQ ID NO: 4). In other aspects, the functional CYP4V2 protein is a functional variant or fragment of the human CYP4V2 protein, including but not limited to a protein having the amino acid sequence shown in SEQ ID NO: 5.

[0392] A functional CYP4V2 protein can also be a variant of another functional CYP4V2 protein. The following is a discussion based on altering the amino acids of the polypeptides described herein to produce second generation molecules that are equivalent or even improved. For example, in a protein structure, certain amino acids can be substituted for other amino acids without a significant loss of structural or functional ability to interact with, for example, a binding site on a substrate molecule, such as a binding site for a fatty acid. Because it is the interaction ability and nature of a protein that determines the biological functional activity of the protein, certain amino acid substitutions can be made in a protein sequence and its underlying DNA or RNA encoding sequence, and still produce a protein with similar properties. Thus, it is contemplated that various alterations can be made in the amino acid sequence of a functional CYP4V2 protein or in the DNA or RNA sequence of the gene or coding region thereof, without significantly losing its biological utility or activity, as discussed herein. For example, SEQ ID NO: 5 is an amino acid sequence of a CYP4V2 protein variant that has one amino acid change compared to the human CYP4V2 protein sequence shown in SEQ ID NO: 4.

[0393] Various techniques, algorithms, software, and tools can be used to design or engineer functional derivatives, variants, and / or fragments of a functional CYP4V2 protein, such as a human CYP4V2 protein. For example, the structure and function or alterations of various polypeptides can be modeled, solved, or predicted by NMR, x-ray crystallography, or computer modeling, such as ClustalW, SWISS-MODEL server, Swiss-Pdb Viewer, Polyphen-2, PROVEAN, SIFT, Condel, MutationAssessor, and FatHMM.

[0394] A functional CYP4V2 protein can also be a fragment of a functional CYP4V2 protein or derived from a fragment thereof. For example, both the human CYP4V2 protein (SEQ ID NO: 4) and its variant (SEQ ID NO: 5) have a transmembrane domain between about the 13th amino acid residue and about the 35th residue from the N-terminus. The backbone of the human CYP4V2 protein (SEQ ID NO: 4) is between about aa 36-525. Thus, a functional CYP4V2 can be derived from a deletion of the first about 35 amino acids of the human CYP4V2 protein (SEQ ID NO: 6) and replacement of this deletion with an alternative transmembrane domain sequence. Another source of a functional CYP4V2 protein is a splice variant of a functional CYP4V2 protein.

[0395] The predicted CYP4V2 transmembrane segment is located near the N-terminus, followed by a globular domain typical of CYP450 family members. The globular domain of CYP4V2 includes 18 helical and beta-structure segments. The heme group is located near the surface of the protein, coordinated with helix I toward the interior of the protein and helix L on the surface. Li et al., Am J Hum Genet. 74:817-826, 2004. CYP4V2 protein is primarily active in fatty acid metabolism. Many other P450 enzymes are also involved in fatty acid metabolism. CYP4V2 is ubiquitously expressed in nearly all tissues and organs. Expression of CYP4V2 is found in the heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, retina, retinal pigment epithelium, cornea, and lymphocytes (Li et al., Am J Hum Genet. 74:817-826, 2004). However, most other P450 enzymes are not present in ocular cells. For example, CYP4V2 and CYP1B1 are the only P450 enzymes expressed at high levels in the ARPE-19 cell line; CYP2E1, CYP2J2, and CYP3A4 are only transcribed at low levels (5% of CYP4V2 mRNA expression), and transcripts of CYP4A11, CYP4B1, CYP4F2, CYP4F3, and CYP4F12 were not detected (Nakano et al., Mol Pharmacol 2012; 82:679-686). In fact, the symptoms of CYP4V2 mutations are limited to the eye, where CYP4V2 is the only major P450 enzyme expressed, in addition to CYP1B1, and the only P450 subfamily 4 (CYP4) enzyme expressed, while these symptoms are not displayed in organs where CYP4V2 is present with other P450 enzymes, suggesting that other P450 enzymes, particularly CYP4 enzymes, can serve to replace all or part of the function of CYP4V2. Indeed, the CYP4 subfamily has been found to have a common role in fatty acid metabolism, including but not limited to as hydroxylases of PUFAs. See Hardwick, Biochem. Pharmacol., 75(12):2263-75; Fer et al., J. Lipid Res., 49(11):2379-89; Nakano et al., Mol. Pharmacol., 2012, 82:679-686. Protein sequences of human CYP4 proteins are shown in SEQ ID NOs: 8-18.

[0396] In addition to sharing substrates and functions with other proteins of the CYP4 subfamily, computational analysis shows that CYP4V2 was copied from an ancestor of CYP46A (SEQ ID NO: 7), which then was duplicated to create the entire CYP4 family. Pan et al., Int. J. Mol. Sci., 2016, 17(7) pii: E1020. doi: 10.3390 / ijms17071020.

[0397] Further, the CYP4V2 gene (or orthologs of the CYP4V2 gene, such as Cyp4v3 in mice) is conserved in many species, including but not limited to humans, chimpanzees, rhesus monkeys, dogs, cows, mice, rats, chickens, frogs, horses, rabbits, and fruit flies (SEQ ID NOs: 19-29). Orthologs containing the human gene CYP4V2 have been found in 196 organisms.

[0398] A functional CYP4V2 protein can comprise or be designed, engineered, or derived from, including but not limited to:

[0399] (i) the human CYP4V2 protein (SEQ ID NO: 4);

[0400] (ii) a variant of the human CYP4V2 protein or a functional CYP4V2 protein (e.g., an altered amino acid and / or splice variant) (e.g., SEQ ID NO: 5);

[0401] (iii) one or more fragments of a functional CYP4V2 protein (e.g., SEQ ID NO: 6);

[0402] (iv) a CYP4V2 (or ortholog) of another species;

[0403] (v) another CYP4 protein or CYP46A1;

[0404] (vi) a polypeptide capable of ameliorating, treating, or suppressing one or more biochemical abnormalities of one or more of the compounds listed in Table 2 in a patient’s cells (e.g., iPS-RPE cells of a BCD patient); and / or

[0405] (vii) a derivative, hybrid, or variant of any one or more of (i) through (vi) above.

[0406] It is contemplated that the compositions and methods disclosed herein can be used to express any functional CYP4V2 protein as described above. In one embodiment, the functional CYP4V2 protein is a polypeptide comprising all or a portion of the amino acid sequence set forth in SEQ ID NO: 4, 5, or 6. In some embodiments, the functional CYP4V2 protein is a polypeptide comprising all or a portion of an amino acid sequence selected from the group consisting of CYP4V2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, and CYP46A (SEQ ID NOS: 4-18), and CYP4V2 of chimpanzee, rhesus monkey, dog, cow, mouse, rat, chicken, frog, horse, rabbit, and fruit fly (SEQ ID NOS: 19-29), and derivatives, hybrids, variants, and / or fragments thereof. In some embodiments, the functional CYP4V2 protein can have at least 80% amino acid sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to any of the sequences selected from the group consisting of SEQ ID NOS: 4-29. In one embodiment, the functional CYP4V2 protein is a polypeptide comprising sequence elements of FxxGxxxCxG and ExxR (SEQ ID NOS: 30 and 31).

[0407] In some embodiments, the functional CYP4V2 protein is a compound or agent capable of ameliorating, treating, or suppressing one or more biochemical abnormalities in a patient's cells (e.g., iPS-RPE cells of a BCD patient).

[0408] In one embodiment, a functional CYP4V2 protein can be used directly to treat BCD, similar to protein-based drugs for other diseases. In another embodiment, a nucleic acid molecule encoding a functional CYP4V2 protein is used to express a functional CYP4V2 protein in the targeted cells. In one embodiment, the nucleic acid molecule is RNA. In another embodiment, the nucleic acid molecule is DNA, including but not limited to complementary DNA (cDNA), for long-term expression. The cDNA can be positive-sense or negative-sense, single-stranded or double-stranded. In some embodiments, the nucleic acid encoding a functional CYP4V2 protein is operably linked to one or more regulatory sequences to form a CYP4V2 expression cassette. In some embodiments, such an expression cassette is packaged in a vector to enhance delivery and / or expression efficiency.

[0409] A codon is a set of three nucleotides and encodes a particular amino acid or causes termination of translation (i.e., a stop codon). Most amino acids (generally all but methionine) are encoded by multiple codons. Thus, the same protein can be expressed with different nucleic acid sequences. The sequence identity between two nucleic acid molecules encoding the same protein sequence can range from 0% to more than 99%. For example, one nucleic acid sequence (SEQ ID NO: 1) and another nucleic acid sequence (SEQ ID NO: 2) both encoding the human CYP4V2 protein (SEQ ID NO: 4) share only 77% sequence identity.

[0410] Codon optimization of nucleic acid sequences can improve and / or stabilize protein expression without changing the encoded amino acid sequence. Codon optimization is the substitution of codons present in a nucleic acid sequence with preferred codons that encode the same amino acid, e.g., preferred codons for mammalian expression. Various strategies and parameters can be used in codon optimization, including but not limited to codon usage bias, GC content, CpG dinucleotide content, mRNA secondary structure, cryptic splicing sites, premature PolyA sites, internal chi sites, and ribosomal binding sites, negative CpG islands, RNA instability motifs (AREs), repeat sequences (direct repeats, reverse repeats, and Dyad repeats), and restriction sites that can interfere with cloning. Methods of codon optimization are known in the art to which the present invention pertains, e.g., U.S. Patent No. 6,114,148 and US 20110081708. Codon-optimized nucleic acid sequences for a given amino acid sequence or polypeptide-encoding nucleic acid sequence can be generated by the methods described herein and / or by using various codon optimization software, including via online software.

[0411] It will be appreciated that different codon-optimized nucleic acid sequences encoding the same protein can be generated depending on the codon-optimization method, configuration, algorithm, or software used. However, codon-optimization does not always result in improved expression over the wild-type unmodified nucleic acid sequence. See Alexeyev MF, Winkler HH: Gene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP / ADP translocase. Biochim Biophys Acta. 1999, 1419: 299-306. 10.1016 / S0005-2736(99)00078-4; Curran KA, Leavitt JM, Karim AS, Alper HS: Metabolic engineering of muconic acid production in Saccharomyces cerevisiae. Metab Eng. 2013, 15: 55-66; Agashe D, Martinez-Gomez NC, Drummond DA, Marx CJ: Good codons, Bad transcript: large reductions in gene expression and fitness arising from synonymous mutations in a Key enzyme. Mol Biol Evol. 2013, 30(3): 549-560. 10.1093 / molbev / mss273. doi: 10.1093 / molbev / mss273.

[0412] Provided herein is a codon-optimized nucleic acid sequence (SEQ ID NO: 2) encoding a human CYP4V2 protein (SEQ ID NO: 4). Both SEQ ID NO: 1 and SEQ ID NO: 2 encode the same human CYP4V2 protein (SEQ ID NO: 4). The codon-optimized nucleic acid sequence (SEQ ID NO: 2) has an improved codon adaptation index (CAI) of 0.95 compared to the CAI of 0.94 of the nucleic acid sequence set forth in SEQ ID NO: 1. A CAI of 1.0 is considered perfect in a desired expression organism. It is understood that the disclosure encompasses all forms and types of codon-optimized nucleic acid sequences, as represented by the cDNA sequence set forth in SEQ ID NO: 2, including any RNA sequence or DNA sequence or other nucleic acid sequence corresponding to or derived from this cDNA sequence, and which can be the sequence provided herein in single-stranded or double-stranded form, and / or sense, negative sense, anti-sense, or complementary-sense to the sequence provided herein.

[0413] In addition to codon optimization, other methods can be used to improve translation performance. For example, a Kozak sequence or a Shine-Dalgarno sequence can be used to improve translation initiation efficiency. A different stop codon (e.g., TGA) can be used to improve translation termination efficiency. In addition to the ORF sequence, a nucleic acid sequence encoding a functional CYP4V2 protein can also include one or more non-coding sequences (such as UTRs) and / or one or more introns to improve protein expression. A Kozak sequence (an exemplary sequence is shown in SEQ ID NO: 36) can be inserted immediately before the CYP4V2-encoding cDNA to enhance expression.

[0414] As discussed herein, it is contemplated that functional variants and / or fragments of the human CYP4V2 protein can be employed. A nucleic acid sequence encoding a functional variant of the human CYP4V2 protein (SEQ ID NO: 4) (SEQ ID NO: 5) is provided in SEQ ID NO: 3.

[0415] In some embodiments, the CYP4V2 nucleic acid molecule is a polynucleotide molecule encoding any functional CYP4V2 protein, including but not limited to SEQ ID NOs: 4-30, or a polypeptide having at least 80% amino acid sequence identity to any of the sequences set forth in SEQ ID NOs: 4-30. In some embodiments, the CYP4V2 nucleic acid molecule is a polynucleotide sharing at least 60% sequence identity to any one of SEQ ID NOs: 1, 2, or 3.

[0416] A vector (e.g., viral vector or non-viral vector) and CYP4V2 expression cassette as described herein typically contains one or more CYP4V2 nucleic acid molecules or fragments thereof. It should be understood that a nucleic acid molecule can take a variety of forms, including but not limited to DNA or RNA, single-stranded nucleic acid (e.g., ssDNA, ssRNA), double-stranded nucleic acid (e.g., dsDNA, dsRNA), plus-strand or minus-strand nucleic acid, complementary DNA (cDNA), genomic DNA, messenger RNA (mRNA), small interfering RNA (siRNA), and / or DNA directed RNA interference (ddRNAi). A nucleic acid molecule can also include one or more nucleotide analogs or backbone modifications. Further, it should be understood that a cDNA can be synthesized from an mRNA template in a reaction catalyzed by reverse transcriptase, or can be designed and synthesized based on the protein it is intended to encode, including but not limited to a codon-optimized cDNA, or can be synthesized from another nucleic acid molecule via mutagenesis. It should also be understood that a cDNA can contain only exons, or can contain exons plus other sequences, such as untranslated regions (UTRs) and / or introns. In some cases, a vector and CYP4V2 expression cassette described herein can include a nucleic acid molecule having a sequence encoding a human CYP4V2 protein or a functional variant or fragment thereof.

[0417] A suitable nucleic acid sequence can be any nucleic acid sequence encoding a functional CYP4V2 protein. The nucleic acid sequence can or can not contain non-coding elements, such as UTRs, introns, or Kozak sequences. It can include a wild-type sequence or a synthetic sequence or a modified sequence (e.g., a codon-optimized sequence). A nucleic acid sequence encoding a functional CYP4V2 protein can be produced as described herein or by other methods known in the art to which the present invention pertains.

[0418] A nucleic acid molecule having a sequence encoding a human CYP4V2 protein as set forth in SEQ ID NO: 1 is referred to herein as "CYP4V2st." A nucleic acid molecule having a codon-optimized sequence encoding a human CYP4V2 protein as set forth in SEQ ID NO: 2 is referred to herein as "CYP4V2op." A nucleic acid molecule having a sequence encoding a functional variant of a human CYP4V2 protein as set forth in SEQ ID NO: 3 is referred to herein as "CYP4V2fv." In some embodiments, a nucleic acid sequence encoding a functional CYP4V2 protein has at least 60% sequence identity to one of SEQ ID NOs 1, 2, or 3.

[0419] Functional CYP4V2 proteins and nucleic acid molecules encoding such functional CYP4V2 proteins can be synthesized or isolated, purified, and detected using methods known in the art to which the present application pertains. In addition, protein synthesis or isolation, purification, and detection can also be commercially obtained through CROs including Wuxi Apptec (Shanghai, China) and GenScript (Piscataway, New Jersey). Nucleic acid molecule synthesis or isolation, purification cloning, and detection can be commercially obtained through CROs including GenScript (Piscataway, New Jersey) and Integrated DNA Technologies (Coralville, Iowa).

[0420] Polypeptides can be synthesized (e.g., via recombinant protein expression or chemical synthesis) or isolated. A "purified" polypeptide, as used herein, is a polypeptide that has been separated or purified from cellular components with which it is naturally associated. Generally, a polypeptide is considered "purified" when it is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) free of polypeptides and naturally-occurring molecules with which it is naturally associated, on a dry weight basis. Synthetic polypeptides are "purified" because they are inherently separated from components with which they are naturally associated.

[0421] Polypeptides can be purified from natural sources (e.g., biological samples) by known methods, such as DEAE ion-exchange, gel filtration, and hydroxyapatite chromatography. Polypeptides can also be purified, for example, by expression of a nucleic acid in an expression vector. In addition, purified polypeptides can be obtained by chemical synthesis. The purity of a polypeptide can be measured using any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0422] Polypeptides are typically detected using antibodies. Techniques for detecting polypeptides using antibodies include enzyme linked immunosorbent assay (ELISA), Western blot, immunoprecipitation, and immunofluorescence. The antibodies can be polyclonal or monoclonal. Antibodies having specific binding affinity for a polypeptide or a portion of a polypeptide can be generated using methods well known in the art to which the present application pertains. The antibodies can be attached to a solid support, such as a microtiter plate, using methods known in the art to which the present application pertains. In the presence of a polypeptide, an antibody-polypeptide complex is formed.

[0423] An "isolated" nucleic acid molecule generally refers to a nucleic acid molecule free from the sequences that naturally flank the nucleic acid in the genome of the organism from which the isolated nucleic acid molecule is derived (e.g., a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease digestion). Such isolated nucleic acid molecules are typically introduced into a construct (e.g., a cloning construct or an expression construct for use in gene therapy) generally for ease of manipulation, for expression of a protein, for production of a fusion protein, or for other purposes, including but not limited to for packaging into a vector (e.g., a viral vector or a non-viral vector).

[0424] Nucleic acids can be isolated using conventional techniques in the art. For example, nucleic acids can be isolated using any method, including but not limited to recombinant nucleic acid techniques, site-specific mutagenesis, polymerase chain reaction (PCR), and / or other genetic engineering methods. General PCR techniques are described in, for example, PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation, which can be used to isolate nucleic acids. Mutagenesis protocols are described in, for example, In Vitro Mutagenesis Protocols, Braman, ed., Humana Press, 2002.

[0425] Isolated nucleic acids can also be chemically synthesized, either as a single nucleic acid molecule or as a series of oligonucleotides.

[0426] Constructs containing nucleic acids are known in the art to which the present application pertains. Constructs, including cloning constructs and expression constructs, can be custom ordered commercially or can be generated by routine recombinant DNA techniques in the art. Constructs can have regulatory sequences operably linked to nucleic acids to be expressed, and can further include sequences such as sequences encoding selectable markers (e.g., antibiotic resistance genes). Regulatory sequences are discussed herein. Constructs containing nucleic acids can encode chimeric or fusion polypeptides (i.e., polypeptides operably linked to heterologous polypeptides, which can be at the N- or C-terminus of the polypeptide). Representative heterologous polypeptides are polypeptides that can be used in purification or detection of the encoded polypeptide (e.g., 6xHis tag, glutathione S-transferase (GST), CFP, Fc, FLAG, HA, Myc, RFP, Strep, VSV, GFP, and YFP).

[0427] Constructs carrying nucleic acid sequences can be introduced into host cells. As used herein, "host cell" refers to the particular cell into which a nucleic acid is introduced and also includes the progeny of the cell that carry the construct. Host cells can be any prokaryotic or eukaryotic cell. For example, host cells can be bacterial cells, such as E. coli cells, or insect cells, yeast, or mammalian cells (such as Chinese hamster ovary cells (CHO), COS cells, HEK293 cells, HeLa, Vero, V27, A549, K562, B50, WI38, and BHK cells). Other host cells include, but are not limited to, iPS cells, ES cells, RPE cells, iPS-RPE cells, iPS-photoreceptor cells, ES-RPE cells, ARPE-19 cells, corneal cells, photoreceptor cells, choroidal cells, optic nerve cells, any other type of ocular cell discussed herein, neuronal cells, epithelial cells, blood cells, fibroblast cells, lymphocytes, and cells derived from stem cells. Many methods for introducing nucleic acids or vectors or expression cassettes carrying nucleic acid transgenes into host cells in vivo and in vitro are well known to those of ordinary skill in the art, and these methods include, but are not limited to, electroporation, sonoporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, liposome transfection, microinjection, and viral-mediated nucleic acid transfer.

[0428] Nucleic acids can be detected using any number of amplification techniques (see, e.g., PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188), with a pair of appropriate oligonucleotides (e.g., primers). Numerous modifications of the original PCR have been developed, and these modifications can be used to detect nucleic acids. Nucleic acids can also be detected using hybridization. Hybridization between nucleic acids is discussed in detail in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nded., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; chapters 7.37-7.57, 9.47-9.57, 11.7-11.8, and 11.45-11.57). Sambrook et al. disclose appropriate Southern blot conditions for oligonucleotide probes of less than about 100 nucleotides (chapters 11.45-11.46) and for oligonucleotide probes of greater than about 100 nucleotides (see chapters 9.47-9.54).

[0429] B. Vectors

[0430] In some embodiments, nucleic acid molecules encoding functional CYP4V2 proteins or fragments thereof are delivered to ocular cells in need of treatment by means of a vector. With respect to delivery to ocular cells, the desired therapeutic vector is non-toxic and effective for delivering nucleic acid molecules (e.g., DNA, RNA) into target cells. Gene therapy vectors are known in the art to which the present invention pertains and can be viral vectors or non-viral vectors.

[0431] One method for introducing nucleic acids into cells in vivo is by using viral vectors containing nucleic acid molecules (e.g., cDNA). The advantage of infecting cells with viral vectors is that a large proportion of target cells are able to receive the nucleic acid molecules. Further, molecules encoded within the viral vectors (e.g., from cDNA contained in the viral vectors) can be effectively expressed in cells that have received the viral vectors containing the nucleic acid molecules.

[0432] Examples of viral vectors that can be used include, but are not limited to, adenoviral vectors, adeno-associated viral vectors (AAV), lentiviral vectors, herpes virus (HV) vectors such as herpes simplex virus (HSV) vectors, papillomavirus vectors, poxvirus vectors, human foamy virus (HFV) vectors, Epstein Barr virus (EBV) vectors, vaccinia virus vectors, Sendai virus vectors, and retroviral vectors. Plasmids can also be used to deliver nucleic acid molecules into target cells. In some cases, the viral vector is a recombinant viral vector, such as a recombinant AAV (rAAV) vector. Those of skill will appreciate that certain vectors will integrate or are more likely to integrate into the genome of a host cell (e.g., a cell of a subject), while other vectors will not integrate or are less likely to integrate into the genome of a host cell (e.g., express extrachromosomally).

[0433] Recombinant AAV (rAAV) vectors are commonly used in gene therapy methods. AAVs belong to the Parvoviridae family and each contain a single-stranded DNA. rAAV vectors are currently considered the safest and most efficient gene transfer platform in mammalian cells (Salganik et al., 2015, Microbiol. Spectr., 3(4): doi:10.1128 / microbiolspec.MDNA3-0052-2014). To date, 12 AAV serotypes (AAV1 through AAV12) and over 100 variants have been isolated from human and non-human primate tissue samples (see, e.g., Gao et al., 2005, Curr. Gene Ther., 5:285-97) and other species. Both naturally occurring and modified AAV types can be used in the methods described herein.

[0434] Wild-type AAVs contain a linear single-stranded DNA genome encapsidated within a capsid composed of three proteins, VP1, VP2, and VP3. In recombinant AAV (rAAV), the rep and cap genes from a wild-type AAV genome are typically replaced with a transgene expression cassette flanked by AAV inverted terminal repeats (ITRs) required for packaging. As used herein, “rAAV vector” refers to a recombinant AAV vector containing one or more AAV viruses or one or more capsid elements derived from one or more AAV viruses.

[0435] While AAV and other viral vector-mediated gene therapy has these advantages, not all viral vectors and not all AAV types are suitable for treating a particular disease. Gene therapy using viral vectors (e.g., AAV vectors) faces two major challenges. First, it is desirable for the AAV vector to have sufficient transduction efficiency in the cell type targeted for treatment. Second, potential immune responses triggered by the viral vector need to be considered. See Madsen et al., Adeno-associated virus serotype 2 induces cell-mediated immune responses directed against multiple epitopes of the capsid protein VP1. J Gen Virol 90, 2622-2633 (2009); Mingozzi et al., CD8(+) T-cell responses to adeno-associated virus capsid in humans. Nat Med 13, 419-422 (2007). While the eye is considered an immune-privileged organ relative to many other organs compared to most other organs and tissues, and immune responses in gene therapy mediated by AAV in the eye can be controlled by the use of immunosuppressants, the role of immune responses, such as neutralizing antibodies (NABs), in AAV transduction in the eye in large animals is not well understood. Moreover, intravitreal AAV administration is more likely to interact with the immune system than subretinal administration. Thus, viral vectors used in ocular gene therapy will trigger minimal or no immune response, thereby avoiding potential side effects and ensuring that the transduction / expression efficiency of the viral vector is not substantially reduced by immune responses (e.g., pre-existing NABs in a subject) and / or thereby reducing the dose of rAAV vector.

[0436] Various compositions and methods related to AAV vector design and selection can be used to address these challenges. With respect to treating BCD using CYP4V2 gene therapy, a vector with sufficient transduction efficiency in RPE cells is desirable when the targeted cells are primarily RPE cells. A vector with sufficient transduction efficiency in corneal cells is desirable when treating corneal cells of a BCD patient. In some embodiments, a vector with sufficient transduction efficiency in RPE cells is used. In some embodiments, a vector with sufficient transduction efficiency in corneal cells is used. In some embodiments, a vector with sufficient transduction efficiency in RPE and photoreceptor cells is used. In some embodiments, a vector with sufficient transduction efficiency in RPE, photoreceptor, and choroid cells is used. In some embodiments, a vector with sufficient transduction efficiency in retinal cells is used. In some embodiments, a vector with sufficient transduction efficiency in ocular cells is used. In some embodiments, a vector with sufficient transduction efficiency in ocular cells and / or blood cells is used. To address potential immune responses (e.g., NABs and cell-based immune responses against the gene therapy vector), different AAV serotypes and variants, modified AAV vectors, and / or immunosuppression regimens can be used.

[0437] The rAAV vectors used herein can be based on or derived from a wild-type AAV (e.g., one of AAV1 through AAV12 or other wild-type AAV variants, including but not limited to AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, AAV9, AAV10, AAV11, and AAV12, isolated from humans or other species) or a modified AAV. Modified AAVs can be generated in many different ways, including but not limited to pseudotyped AAVs (e.g., AAV2 / 5, AAV2 / 8, AAV2 / 1, AAV2 / 4, AAV2 / 6, AAV2 / 7, AAV2 / 9, AAV2 / 12, AAV8 / 2), chimeric AAVs (e.g., AAV-DJ), capsid-modified AAVs (e.g., capsid mutant AAVs (e.g., AAVs with Y-F, K-R, T-A, S-A, and / or T-V mutations, and AAV-DJ / 8 or AAV-DJ / 9, which are capsid mutant AAVs from AAV-DJ), capsid variant AAVs (e.g., AAV 7m8 and derivatives), ancestral AAVs (e.g., Anc80), recombinant AAVs including any alterations to the genome and / or capsid of naturally occurring AAVs or variants, and any combination thereof. It should be understood that modified AAVs can be referred to in different ways, including but not limited to artificial, modified, synthetic, reconstituted, engineered, evolved, designed, derived, or enhanced AAVs, or AAVs generated via rational design and / or directed evolution and / or DNA shuffling, or AAV variants. The use of modified AAVs can have certain advantages compared to unmodified AAVs, including but not limited to higher transduction efficiency, higher tissue or cell specificity, less immune response, and / or better suitability for certain types of administration (e.g., intravitreal injection or delivery via the bloodstream).

[0438] In some embodiments, the modified AAV vectors used herein are pseudotyped AAVs. AAV pseudotyping refers to mixing capsids and genomes from different viral serotypes. These serotypes are denoted with a slash, so AAV2 / 5 indicates a virus containing a serotype 2 genome (e.g., ITRs) packaged in a serotype 5 capsid. In some embodiments, the AAV vectors are AAV2 / 1, AAV2 / 2, AAV2 / 5, AAV2 / 8, AAV2 / 6, AAV2 / 9, AAV2 / 4, AAV2 / 7, AAV2 / 10, or AAV2 / 12 vectors.

[0439] In some embodiments, the modified AAV vectors used herein are chimeric (sometimes also called hybrid or shuffled) AAVs, which are derived from different AAV serotypes, including different AAV serotypes isolated from different species. In some embodiments, the AAV vectors are AAV-DJ, AAV-DJ / 8, or AAV-DJ / 9. AAV-DJ is an AAV variant generated from a hybrid library of eight serotypes of AAV by a DNA shuffling method. Grimm, D. et al. (2008). J. Virol. 82:5887-5911. It is capable of efficiently transducing a broad range of cell types, including ocular cells. In addition, chimeric AAVs have a stronger ability to evade immune neutralization than naturally occurring AAVs, and thus can effectively deliver a higher number of therapeutic transgenes. Hybrid AAVs can be further modified. For example, AAV-DJ / 8 and AAV-DJ / 9 are generated by making point mutations in the heparin binding domain (HBD) of AAV-DJ. Grimm, D. et al. (2008). J. Virol. 82:5887-5911.

[0440] In some embodiments, the modified AAV used herein is a capsid mutant AAV. It involves making one or more mutations (e.g., point mutations) in the AAV capsid protein. Capsid mutant AAVs have advantages over unmodified AAVs. For example, point mutations of surface-exposed tyrosine (Y) residues of AAV capsid proteins are reported as a simple and effective way to escape phosphorylation and subsequent ubiquitination, resulting in higher transduction efficiency both in vitro and in vivo (Zhong et al., Proc Natl Acad Sci U S A. 2008; 105(22): 7827-32; Markusic et al., Mol Ther. 2010; 18(12): 2048-56; Li et al., Hum Gene Ther. 2010 Nov; 21(11): 1527-1543). For example, site-directed mutagenesis of each of seven AAV2 capsid tyrosine residues (Y252, Y272, Y444, Y500, Y700, Y704, and Y730) by substitution with phenylalanine residues can result in increased vector transduction and transgene expression by escaping EGFR-PTK phosphorylation and ubiquitin-proteasome pathway in human cells in vitro and murine liver cells in vivo (Zhong et al., Virology. 2008 Nov 25; 381(2): 194-202). It is also reported that point mutations at specific tyrosine (Y), serine (S), threonine (T), and lysine (K) residues on the AAV capsid can significantly improve transduction both in vitro and in vivo (Gabriel et al., Hum Gene Ther Methods. 2013; 24(2): 80-93; Sen et al., Hum Gene Ther Methods. 2013; 24(2): 104-16; Sen et al., Sci Rep. 2013; 3: 1832; Wu et al., J Virol. 2006; 80(22): 11393-7). The modified AAVs can also be capsid mutated to produce another modified AAV. For example, AAV-DJ / 8 and AAV-DJ / 9 are produced by making point mutations in the heparin binding domain (HBD) of AAV-DJ, which is a hybrid AAV. Grimm, D., et al. (2008). J. Virol. 82: 5887-5911. Capsid mutations also enable AAVs to escape NABs and produce less immune responses. In addition, certain capsid mutations enable AAVs to be more suitable for intravitreal delivery. Kay et al., PLoS One, 8: e62097, 2013.In some embodiments, the AAV vectors used herein are modified AAVs having one or more capsid mutations including, but not limited to, tyrosine mutated to phenylalanine (Y-F), threonine mutated to valine (T-V), lysine mutated to arginine (K-R), threonine mutated to alanine (T-A), serine mutated to alanine (S-A), and / or mutations affecting the heparin binding domain (HBD) of the AAV, and / or mutations in its antigenic region, including but not limited to mutations at positions 459, 493, and 551. In some embodiments, the AAV vectors are AAV2 having one or more of the following capsid mutations: Y444F, Y500F, Y730F, Y252F, Y272F, Y700F, Y704F, and T491V, where the number (e.g., 444) indicates the position of the point mutation in the AAV capsid. In some embodiments, the AAV vectors are AAV5 having one or more of the following capsid mutations: Y263F and Y719F. In some embodiments, the AAV vectors are AAV8 having one or more of the following capsid mutations: Y447F, Y733F, and T494V. In some embodiments, the AAV vectors are AAV1 having a capsid mutation of Y731F. In some embodiments, the AAV vectors are AAV6 having one or more of the following capsid mutations: Y445F and Y731F. In some embodiments, the AAV vectors are AAV9 having a capsid mutation of Y731F. In some embodiments, the AAV vectors are AAV-DJ, AAV-DJ / 8, or AAV-DJ / 9 having one or more of the following capsid mutations: K137R, T251A, and S503A.

[0441] In some embodiments, the modified AAV vector is an AAV having a variant AAV capsid protein. Variant AAV capsid proteins are known in the art to which the application pertains. In some embodiments, the non-naturally occurring capsid protein can include a selected AAV sequence (e.g., a fragment of a vpl capsid protein) combined with a heterologous sequence (e.g., a sequence obtained from a different selected AAV serotype, a non-contiguous portion of the same AAV serotype, from a non- AAV viral source, or from a non-viral source). In some embodiments, the modified AAV vector includes one or more amino acid insertions (e.g., from about 5 amino acids to about 11 amino acids) in the GH loop of the capsid protein. The variant AAV capsid protein can confer increased infectivity of retinal cells as compared to the infectivity of non-variant AAVs (e.g., wild-type AAVs). In some embodiments, the modified AAV is one that is capable of delivering a transgene across the blood-ocular barrier (BOB), a property that makes it suitable for delivery via the bloodstream, providing an alternative route of administration / delivery to the conventional routes of administration used in ocular gene therapy (e.g., subretinal injection or intravitreal injection). In some embodiments, the AAV having a variant AAV capsid protein is AAV 7m8 or a derivative or variant thereof (Dalkara et al., Science Translation Medicine, 5:189ra76, 2013; PCT Application No. PCT / US2012 / 034413, PCT Application No. PCT / US2014 / 039015, U.S. Application No. 14 / 214,011, and U.S. Application No. 13 / 899,481). In some embodiments, the AAV having a variant AAV capsid protein is AAV-PHP.B.

[0442] In some embodiments, the AAV vector can be reconstructed or synthesized via reconstruction of a viral revolutionary lineage. This reconstruction can result in an ancestral, archaic, or parent AAV. In one embodiment, the AAV vector is Anc80 (an ancestor of AAV1, 2, 8, and 9) or a derivative thereof. Zinn et al., Cell Rep. 2015 Aug 11; 12(6): 1056-68.

[0443] In some embodiments, one or more AAV and / or other viral vectors can be modified (e.g., optimized for intravitreal delivery, enhanced transduction in target cell types (e.g., RPE cells), or for delivery via the bloodstream) by means of techniques known in the art, including, for example, "directed evolution" and / or "rational design." See, e.g., Asuri et al., Mol Ther. 20:329-338, 2012 and Yang et al., Methods Mol Biol. 709:127-139, 2011. Modified AAV or other viral vectors can be described, for example, as "engineered," "hybrid," "evolved," "enhanced," or "designed" vectors. These modifications can, for example, improve vector targeting (e.g., improve suitability for intravitreal delivery or delivery via the bloodstream), transduction efficiency, and / or reduce immune response, resulting in, for example, lower required doses. In some embodiments, the rAAV vector is AAV serotype rh10 (EP 20100178940) or ShH10. In some embodiments, the rAAV vector is AAV-PHP.B (US 20150079038).

[0444] In some embodiments, AAV vectors can be generated and / or selected from a combination of more than one of the strategies described herein. For example, AAV-DJ / 8 and AAV-DJ / 9 are generated by making point mutations in the heparin binding domain (HBD) of AAV-DJ, which is a hybrid AAV.

[0445] It is known in the art that certain AAVs can be more suitable for intravitreal delivery than some other AAVs. Many such AAVs for intravitreal delivery involve modification of the AAV capsid protein via mutation (e.g., AAV2 (tetra Y-F+T-V) (Kay et al., PLoS One. 2013 Apr 26; 8(4)) or variant AAV capsid proteins (e.g., AAV 7m8). In addition, there are AAVs suitable for delivery via the bloodstream, such as AAV-PHP.B. However, the use of these AAVs is not limited to intravitreal or delivery via the bloodstream, for example, they can also be used as AAV vectors for subretinal and other routes of administration.

[0446] In some embodiments, self-complementary AAV vectors (scAAV) are used. Wild-type AAV has a single-stranded DNA genome. One drawback of AAV is its single-stranded DNA genome. Because the single-stranded AAV genome relies on cellular DNA replication machinery to synthesize the complementary strand, transgene expression is delayed and less robust than double-stranded DNA. With respect to CYP4V2 gene therapy, we developed a scAAV design (see Figure 7) to circumvent the rate-limiting second strand synthesis in conventional single-stranded AAV vectors and promote robust transgene expression. scAAV.CYP4V2 contains an intramolecular self-complementary CYP4V2 DNA structure that eliminates the need for host cell DNA synthesis and results in faster and more robust expression upon transduction. However, the self-complementary structure of scAAV reduces the packaging limit of scAAV vectors from about 4.7-5.0 kb for ssAAV to about 2.4-2.5 kb for scAAV. Therefore, shorter length regulatory sequences (e.g., promoters, enhancers, and / or polyA signals) are needed in the scAAV design. To ensure that the expression cassette does not exceed the vector packaging limit and depending on the length of the cDNA and other regulatory sequences used, certain optional regulatory sequences such as enhancers can need to be excluded from the scAAV construct. One of the two ITRs in the scAAV design is a truncated ITR with a mutation at the terminal resolution site (TRS). For a detailed discussion of scAAV structure, purification, and production, see McCarthy, Molecular Therapy, Vol. 16, No. 10, pp. 1648-1656, October 2008.

[0447] Many other vector designs can be employed. For example, a dual vector system (e.g., an AAV-based dual vector system, such as a trans-splicing or hybrid dual AAV vector) can be used to express a nucleic acid sequence (e.g., a CYP4V2 nucleic acid sequence). See, e.g., Colella et al., Gene Ther. 21, 450-456, 2014. For example, a dual vector system can include (i) a first AAV vector polynucleotide having inverted terminal repeat sequences at each end (5' and 3' ends) of the polynucleotide, and between the inverted terminal repeat sequences, a suitable promoter operably linked to a partial coding sequence encoding an N-terminal portion of a protein encoded by a nucleic acid sequence of interest; and ii) a second AAV vector polynucleotide having inverted terminal repeat sequences at each end (5' and 3' ends) of the polynucleotide, and between the inverted terminal repeat sequences, a partial coding sequence encoding a C-terminal portion of the protein encoded by the nucleic acid sequence of interest, followed by a polyadenylation (pA) signal sequence.

[0448] For our studies, various rAAV vectors were designed and generated, including scAAV2 / 1, AAV2 / 2, AAV2 / 5, scAAV2 / 5, AAV2 / 8, scAAV2 / 9, and AAV2 / 2(Y444F+Y500F+Y730F) (see the schematic and annotations in FIG. 7 herein). It was demonstrated that rAAV vectors of various vector designs can be used in CYP4V2 gene therapy. In addition, given the pre-existing neutralizing antibodies against certain AAV types in the patient population and other individual immune responses, including multiple rAAV vectors as options can help reduce potential immune responses in CYP4V2 gene therapy. It will also provide more options if subsequent administration to the same eye or administration to the contralateral eye of the same subject is needed.

[0449] Methods to generate viral delivery vectors, including the use of helper-free systems to generate viral delivery vectors, are known in the art to which this invention pertains. See, e.g., PCT / US2007 / 010055; U.S. Patent No. 6458587; U.S. Patent No. US 6428988 B1. Manufacturing of various vectors used in gene therapy, including but not limited to AAV vectors, adenoviral vectors, lentiviral vectors, and retroviral vectors, can also be obtained commercially through contract research organizations (CROs) and contract manufacturing organizations (CMOs), such as Vector Biolabs (Malvern, PA) and Cell Biolabs, Inc. (San Diego, CA).

[0450] In some embodiments, recombinant AAV vectors suitable for use in the methods described herein can be produced by culturing host cells (e.g., HEK293 cells) containing a nucleic acid molecule encoding an AAV serotype capsid protein or a fragment thereof; a rep gene; a minigene, which minimally includes an AAV inverted terminal repeat (ITR) and a nucleic acid molecule of interest (e.g., having a CYP4V2 nucleic acid sequence); and helper functions sufficient to allow packaging of the nucleic acid of interest into an AAV capsid protein. Components required to be cultured in host cells to package nucleic acids in AAV capsids can be provided to the host cells in cis or in trans. Alternatively, any one or more of the required components (e.g., the nucleic acid molecule of interest, rep sequences, cap sequences, and / or helper functions) can be provided by a stable host cell engineered to contain one or more of the required components. Any of these components can be selected from any suitable serotype. For example, rAAV vectors are produced by co-transfecting producer cells (e.g., HEK 293 cells) with (a) a plasmid (AAV cis-plasmid) containing a cloned recombinant AAV genome consisting of a gene of interest (e.g., a cDNA encoding CYP4V2) and other desired regulatory sequences flanked by two AAV ITRs; (b) another construct expressing AAV viral Rep and Cap genes in trans; (c) adenovirus helper factors, which are provided by infecting or transfecting the producer cells with a third plasmid providing these adenovirus helper factors. In addition to HEK293 cells, other cell lines can also be used to produce rAAV vectors, including but not limited to HeLa, Vero, A549, B50, WI38, and BHK cells.

[0451] In some embodiments, the viral delivery vector is a rAAV2 virus, a rAAV2 / 5 virus, a rAAV2 / 8 virus, a rAAV2 / 1 virus, a rAAV2 / 4 virus, a rAAV2 / 6 virus, a rAAV2 / 9 virus, a rAAV2 / 12 virus, or a rAAV virus having capsid elements from one or more of AAV1, AAV2, AAV5, AAV8, AAV9, and / or AAV12 viruses. In one embodiment, the viral delivery vector is a rAAV virus having one or more Y-F mutations, including but not limited to AAV2 (Y444F+Y500F+Y730F) or AAV8 (Y733F).

[0452] In some embodiments, the viral delivery vector is a single-stranded rAAV (ssAAV) virus. In some embodiments, the viral delivery vector is a self-complementary rAAV (scAAV) virus.

[0453] In addition to AAV vectors, other viral vectors can also be used in CYP4V2 gene therapy. For example, adenoviral vectors have also been shown to be suitable for gene delivery. For example, Mori et al., 2002. IOVS, 43:1610-1615 discloses the use of an adenoviral vector, a type 5 Ad with E-1 deletion, partial E-3 deletion, in which the transgene (green fluorescent protein) is driven by a CMV promoter. Peak expression levels were exhibited after injection of 10 7 to 10 8 subretinal injection provided higher levels of expression than intravitreal injection.

[0454] In some embodiments, the delivery vector is a plasmid containing a nucleic acid molecule encoding a human CYP4V2 protein or a functional variant or fragment thereof.

[0455] Non-viral vectors can also be used in CYP4V2 gene therapy. Examples of non-viral vectors include, but are not limited to, naked nucleic acid, dendrimers, liposomes (e.g., cationic or anionic liposomes), polymers (e.g., polyplexes), lipid-polymer systems, and nanoparticles (e.g., inorganic or synthetic nanoparticles). For example, Farjo et al., 2006, PLoS 1 :e38 demonstrated efficient non-viral ocular gene transfer using compacted DNA nanoparticles as a system for non-viral gene transfer to ocular tissues. As a proof of concept, a pZEEGFP5.1 (5,147 bp) expression construct was used, which encodes an enhanced green fluorescent protein (GFP) cDNA transcribed under the control of a CMV immediate-early promoter and enhancer. The DNA nanoparticles were formulated by mixing plasmid DNA with CK3OPEG10K, a 30-mer lysine peptide with an N-terminal cysteine conjugated to 10 kDa polyethylene glycol via a maleimide linkage using known methods. The nanoparticles were concentrated to 4 mg / ml of DNA in saline. The compacted DNA was delivered to the vitreous cavity at a dose of 0.6 μg. GFP expression was observed in the lens, retina, and pigment epithelium / choroid / sclera by PCR and microscopy.

[0456] In addition, a number of patents have been issued regarding methods of ocular gene transfer, including, but not limited to, U.S. Patent No. 7,144,870, which provides a hyaluronan-mediated adenoviral transduction method; U.S. Patent Nos. 7,122,181 and 6,555,107, which provide lentiviral vectors and their use in mediating ocular gene delivery; U.S. Patent No. 6,106,826, which provides a herpes simplex virus vector and its use in mediating ocular gene delivery; and U.S. Patent No. 5,770,580, which provides a DNA expression vector and its use in mediating ocular gene delivery.

[0457] A method for screening and selecting vectors suitable for use in CYP4V2 gene therapy from different vectors is provided in the Examples section herein. The examples use different AAV vectors to illustrate the method. It is understood that one skilled in the art can also use the method to make comparisons and selections among different types of vectors, for example, viral vectors versus non-viral vectors, adenovirus versus AAV, lentivirus versus AAV, HSV versus AAV, etc.

[0458] C. CYP4V2 expression cassettes and regulatory sequences

[0459] The present disclosure also provides an expression cassette comprising a nucleic acid sequence encoding a functional CYP4V2 protein (e.g., a nucleic acid sequence of SEQ ID NO: 1, 2, or 3) and an expression control sequence operably linked to the CYP4V2-encoding nucleic acid sequence. In addition to the nucleic acid molecule encoding a functional CYP4V2 protein, other key elements of an expression cassette used in CYP4V2 gene therapy include one or more regulatory sequences to control expression of the nucleic acid molecule. In some embodiments, the expression cassette is packaged in a delivery vector (e.g., in an rAAV vector flanked by AAV ITRs) to enhance delivery, transduction, and / or expression efficiency. Any AAV ITR can be used in the methods described herein. The ssAAV vectors described in the Examples section herein contain two AAV2 ITRs, each about 141 bp (exemplary sequences are shown in SEQ ID NOs 42 and 43). The scAAV vectors described in the Examples section contain two AAV2 ITRs, one of which is a truncated ITR (exemplary sequences are shown in SEQ ID NOs 44 and 45). AAV2 ITRs typically have a length of about 132 to about 167 bp, depending on the parental vector used.

[0460] The term "regulatory sequence" as used herein refers to any genetic element (e.g., polynucleotide sequence) capable of modulating the replication or expression (transcription or translation) of a nucleic acid sequence or otherwise directing, influencing, and / or modulating the expression of a nucleic acid sequence. Common expression control sequences include promoters, polyadenylation (poly A) signals, enhancers, upstream regulatory domains, introns, UTRs, response or inducible elements, replication origins, internal ribosome entry sites (IRES), transcriptional start sequences, termination sequences, RNA processing sequences such as splicing and polyadenylation (poly A) sequences, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, or sequences that enhance the secretion of encoded proteins. Regulatory sequences can be of bacterial, yeast, insect, mammalian, or viral origin, or can be derivatives, hybrids, or variants thereof, or can be synthetic, and a vector can contain combinations of regulatory sequences from different sources. For example, a regulatory sequence can be heterologous (e.g., of different origin or from a different gene; e.g., from a non-CYP4V2 gene) or homologous (e.g., from the same gene; e.g., from a CYP4V2 gene) with respect to the coding sequence (e.g., CYP4V2 gene) whose expression is modulated by the regulatory sequence. "Operably linked" as used herein means that a promoter and / or other regulatory sequence is positioned in such a way with respect to a nucleic acid coding sequence as to be able to direct, influence, or modulate the expression of the nucleic acid coding sequence. A regulatory sequence can be "operably linked" to a nucleic acid coding sequence in the same vector or in a different vector. One or more regulatory sequences operably linked to a nucleic acid coding sequence can be contiguous and / or can act in trans or at a distance to direct, influence, or modulate the expression of the nucleic acid coding sequence. Of the regulatory sequences, a promoter is required, while other regulatory sequences such as enhancers, introns, and terminators can be beneficial, but are optional.

[0461] Various promoter sequences can be used to drive expression of a nucleic acid coding sequence. Some promoters are constitutive promoters that direct expression in almost all tissues and most cell types, while others are more controlled. Regulated promoters can act only in certain tissues or cells (i.e., tissue- or cell-specific promoters) or at certain times in development (i.e., developmental stage-specific promoters) and / or can depend on environmental conditions or external stimuli such as chemicals, oxygen levels, heat, or light (i.e., inducible promoters).

[0462] In some cases, it can be desirable to use a constitutive promoter (or ubiquitous promoter).Exemplary constitutive promoters include, but are not limited to, the cytomegalovirus (CMV) promoter (Gray et al., Hum Gene Ther. 2011 Sep;22(9): 1143-1153; Norman et al., PLoS ONE 5(8):e12413, August 2010), the chicken beta-actin promoter, the hybrid CAG (also known as CAGGS, CBA, or CB) promoter derived from CMV / chicken beta actin / rabbit beta-globin (Miyazaki J, Takaki S, Araki K, Tashiro F, Tominaga A, Takatsu K, Yamamura K. 1989. Expression vector system based on the chicken beta-actin promoter directs efficient production of interleukin-5. Gene 79:269-277; Acland, G. M. et al. MoI Then, 2005, 12: 1072-1082), the small CBA (smCBA) promoter (-953 bp, see Mah et al. 2003, Hum. Gene Ther. 14:143-152; Haire et al. 2006 IOVS, 2006, 47:3745-3753), the CBh promoter (-800 bp, see Gray et al., Hum Gene Ther. 2011 Sep;22(9): 1143-1153), the human beta-actin promoter (ACTB) (Norman et al., PLoS ONE 5(8):e12413, August 2010), the elongation factor 1 alpha (EF-1 alpha) promoter (see Gill et al., Gene Ther. 2001; 8(20): 1539-1546; Norman et al., PLoS ONE 5(8):e12413, August 2010), the phosphoglycerate kinase (PGK, human or mouse) promoter (Norman et al., PLoS ONE 5(8):e12413, August 2010), the ubiquitin C (UBC) promoter (Norman et al., PLoS ONE 5(8):e12413, August 2010), the GUSB (glucuronidase beta) promoter, the GUSB minimal promoter (hGBp) (Husain, Gene Therapy (2009) 16, 927-932), the UCOE promoter, the elongation factor 1 alpha short (EFS) promoter, the Simian virus 40 (SV40) promoter, the Rous sarcoma virus (RSV) promoter.For a general comparison and discussion of various promoters, see, e.g., Powell, Discov Med. 2015 Jan; 19(102): 49-57. It will be appreciated that in some cases, “constitutive” or “ubiquitous” promoters can tend to be silenced or promote differential expression strength in selected cell types, see, e.g., McCown et al., Brain Res. 1996; 713(1-2): 99-107; Gray et al., Hum Gene Ther. 2011; 22: 1143-1153.

[0463] In some cases, it is desirable to use a cell-specific or tissue-specific promoter that directs expression of a nucleic acid coding sequence in a particular type of cell or tissue. Based on the disclosure herein, it will be appreciated that a cell-specific or tissue-specific promoter can be specific for an ocular cell or tissue or for a lymphocyte. Ocular cell types include, but are not limited to, retinal cells, retinal bipolar cells, photoreceptor cells, rod and cone cells, ganglion cells, retinal pigment epithelial (RPE) cells, choroidal cells, or corneal epithelial cells. Thus, a cell-specific promoter as described herein can be a retinal-specific promoter (e.g., RPE-specific, photoreceptor-specific (e.g., cone-specific and / or rod-specific), and / or choroidal-specific) or a corneal-specific promoter.Exemplary eye cell-specific promoters include, but are not limited to, the human G protein-coupled receptor kinase 1 also known as rhodopsin kinase 1 (GRK1) promoter (Genbank Accession No. AY327580), a 292 nt fragment of the GRK1 promoter (position 1793-2087) (see Beltran et al., Gene Therapy 17: 1162-74, 2010), the human interphotoreceptor retinoid-binding protein (IRBP) proximal promoter, a 235 nt fragment of the hIRBP promoter, the RPGR proximal promoter, the red opsin promoter, the red-green opsin promoter, the blue opsin promoter, the mouse opsin promoter (both long and short versions, Le et al., Molecular Vision 2006; 12: 389-398; Beltran et al., Gene Therapy 17: 1162-74, 2010), the rhodopsin (Rho) promoter (Mussolino et al., Gene Therapy, 18:637-45, 2011), the alpha-subunit of cone transducin (Morrissey et al., BMC Dev, Biol, 11:3, 2011), the beta phosphodiesterase (PDE) promoter, the retinitis pigmentosa 1 (RP1) promoter (Nicord et al., J. Gene Vied. 9:1015-23, 2007), the NXNL2 / NXNL1 promoter (Lambard et al., PLoS One, 5:el3025, 2010), the RPE65 promoter (Li et al., Investigative Ophthalmology & Visual Science, December 2002, Vol. 43, 3640), the retinal degeneration slow / peripherin 2 (Rds / perph2) promoter (Cai et al., Exp Eye Res, 91:186-94, 2010), the VMD2 promoter (vitelliform macular dystrophy 2, also known as BEST1, Kachi et al., Human Gene Therapy, 20:31-9, 2009), the IRBP / GNAT2 promoter (hIRBP enhancer fused to cone transducin alpha promoter), the Rds (retinal degeneration slow) promoter, the hPDE6b promoter, or the VEcad promoter (VE-cadherin (VE-cadherin) / cadherin 5 (CDH5) / CD144 promoter).It will be appreciated that other promoters known in the art based on the principles and teachings provided herein can be used in place of or in addition to any of the exemplary promoters provided herein.

[0464] Exemplary inducible promoters include, but are not limited to, calcium-sensitive promoters (e.g., NFAT promoters, see Gene Ther. 2013 Mar;20(3):248-54), zinc-inducible sheep metallothionein (MX) promoters, dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoters, T7 polymerase promoter systems, ecdysone insect promoters, tetracycline-repressible systems, tetracycline-inducible systems, RU486-inducible systems, rapamycin-inducible systems, various commercially available inducible promoters, and inducible promoters regulated by specific physiological states, such as temperature, acute phase, specific differentiation state of the cell, or only in replicating cells. In some embodiments, the inducible promoter is one that is strictly regulated and specific to a particular ocular cell type.

[0465] A promoter can be a hybrid of another promoter and / or another regulatory sequence, or a truncated / shortened or modified version or otherwise derived from another promoter and / or another regulatory sequence, such as the CAG promoter, which is a hybrid of the CMV immediate early enhancer, chicken beta-actin promoter, and rabbit beta-globin gene, and the smCBA promoter, which is a truncated version of the CBA promoter. A promoter can contain other elements, such as introns, exons, and / or enhancers, such as the CAG promoter. More than one promoter can be used together in an expression cassette.

[0466] In some cases, to increase expression and / or to stabilize expression above that which occurs due to the promoter, the use of an enhancer sequence is desirable. Representative enhancer sequences include, but are not limited to, a post-transcriptional regulatory element (e.g., the woodchuck hepatitis virus post-transcriptional regulatory element (also known as WPRE) or the hepatitis B virus post-transcriptional regulatory element (also known as HPRE or HBVPRE, Donello et al., J Virol. 1998 Jun;72(6):5085-92; Sun et al., DNA Cell Biol. 2009 May;28(5):233-240), or various shortened, mutated, or modified WPREs, such as a ~247 bp shortened WPRE containing the gamma and alpha elements of minimal WPRE (Choi et al., Mol Brain. 2014;7:17; Donello et al., J Virol. 1998 Jun;72(6):5085-5092; Zanta-Boussif et al., Gene Therapy (2009) 16, 605-619), or an IRBP enhancer (Nicord et al., J. Gene Virol. 9:1015-23, 2007), a constitutive transport element (CTE) enhancer (e.g., Mason-Pfizer Monkey Virus CTE or avian leukosis virus CTE), a cytomegalovirus (CMV) immediate early enhancer, an enhancer derived from an immunoglobulin gene, or an SV40 enhancer, or a cis-acting element identified in the mouse proximal promoter, an intronic regulatory sequence, such as a mini-intron splice donor / acceptor known as SD-SA derived from SV-40, an internal ribosome entry site (IRES), which can be used to produce more than one polypeptide from a single gene transcript, such as a protein containing more than one polypeptide chain or two different proteins, can be a poliovirus internal ribosome entry sequence, which supports transgene expression in RPE, photoreceptors, and ganglion cells.

[0467] Polyadenylation of transcripts is important for nuclear export, translation, and mRNA stability. Thus, the efficiency of transcript polyadenylation is important for transgene expression. Representative PolyA signal sequences include, but are not limited to, SV40 polyA signal, SV40 late polyA signal, SV40 early polyA signal, bovine growth hormone polyadenylation (bGH polyA) signal, small polyA, or human growth hormone polyadenylation signal (hGH polyA). In some cases, upstream enhancer (USE) sequences can be used to improve the efficiency of the polyA signal, such as SV40 late 2xUSE, HIV-1 USE (human immunodeficiency virus 1), GHV USE (Ground squirrel hepatitis virus), adenovirus (L3) USE, hTHGB USE (human thrombopoietin), or hC2 USE (human C2 complement gene) (Schambach A, Galla M, Maetzig T, Loew R, Baum C. Improving transcriptional termination of self-inactivating gamma-retroviral and lentiviral vectors. Mol Ther. 2007; 15(6): 1167-1173).

[0468] As with promoter sequences, other regulatory sequences used in the expression cassettes can be hybrids of regulatory sequences, shortened / truncated, modified, or otherwise derived versions of regulatory sequences. For example, shortened WPRE, SV40 late 2xUSE, SV40 late polyA. In addition to the elements described herein, the expression cassettes can also contain other regulatory sequences, such as introns, UTRs, and linker sequences. It has been demonstrated that inclusion of a splice site (i.e., an exon flanked by two introns) is useful to increase gene expression of proteins from the expression cassettes.

[0469] It is known in the art to which this invention pertains that regulatory sequences or hybrid regulatory sequences often have multiple versions and more than one name. For example, various promoters, enhancers, and poly A signals have multiple versions including but not limited to the CMV promoter, the EF1 alpha promoter, the WPRE enhancer, and the SV40 poly A signal. The CAG promoter has multiple alternative names including but not limited to the CBA promoter, the CB promoter, or the CAGGS promoter. Furthermore, it is also known in the art to which this invention pertains that regulatory sequences can be shortened, modified, or combined with other sequences to produce derivatives or variants, for example, the CAG (also known as CBA, CB, or CAGGS) promoter is a hybrid of the CMV immediate early enhancer, the chicken beta actin promoter, and the rabbit beta-globin gene, the smCBA promoter is a truncated CAG promoter, the CB SB The promoter is a shortened CAG promoter that differs by about 152 bp at the 5' end of the CMV immediate early enhancer. Furthermore, regulatory sequences can have different designations, for example, post-transcriptional regulatory elements such as HPRE or WPRE can also be referred to as enhancers. Any regulatory sequence described herein encompasses all variants, derivatives, and / or hybrids of this regulatory sequence. Any exemplary sequence provided herein in relation to a regulatory sequence is exemplary in nature and does not limit the definition or scope of this regulatory sequence to what is shown in the exemplary sequence.

[0470] In some embodiments, microRNA (miRNA) technology can be used in the expression cassette design to achieve targeted expression specificity, for example, by suppressing off-target transgene expression. For example and without limitation, a target sequence for miR181, a miRNA that has been shown to be expressed only in ganglion cells and inner retina, can be added immediately downstream of the CYP4V2 cDNA to inhibit expression cassette-mediated synthesis of CYP4V2 protein in ganglion cells and inner retinal cells. Likewise, target sequences for miRNAs that are expressed only in certain cell types can be used to suppress CYP4V2 protein expression mediated by the expression cassette in these types of cells to achieve targeted tissue- or cell-specific expression.

[0471] D. Designing effective expression cassettes and delivery vectors for CYP4V2 gene therapy

[0472] Detailed discussion of the methods of designing CYP4V2 expression cassettes and delivery vectors and the various designs of these studies are provided in the Examples section herein.

[0473] Treatment of ocular diseases using the EFS promoter and / or small poly A signal (SPA)

[0474] As discussed herein, gene delivery vectors have a packaging size limit. For example, the packaging limit for single-stranded AAV vectors is about 4.7-5.0 kb, beyond which transduction and expression efficiency will drop significantly. For self-complementary AAV (scAAV), the packaging limit is halved to about 2.4-2.5 kb. Thus, size is important for vector-mediated gene delivery and gene therapy. For double-stranded self-complementary vectors, it is desirable and sometimes critical to use small size regulatory sequences to leave enough room for the transgene (e.g., cDNA). Because of this size limit, large promoters are also not suitable for use with scAAV. With respect to CYP4V2 gene therapy, given that the size of the cDNA is about 1578 bp and the AAV ITR (with mutations) is about 258 bp, only about 500-600 bp is left for regulatory sequences. Because CYP4V2 is ubiquitously expressed, it is desirable in some embodiments to use a constitutive promoter to drive CYP4V2 transgene expression. However, there is no room for the about 1.7 kb constitutive CAG promoter we used in the single-stranded AAV design, or the about 953 bp shortened CBA promoter (smCBA), or the about 800 bp CBh promoter, the same is true for many other constitutive promoters, such as the about 600 bp CMV promoter. A shorter length EFS promoter (exemplary sequence shown in SEQ ID NO: 34) can instead be used for the scAAV design. The same size limit applies to other regulatory sequences, such as polyA signals. The bGH Poly A is about 225 bp, the SV40 polyA is about 240 bp and the SV40 late polyA is about 120 bp. Any of these will take up a large portion of the ~500 bp length left for regulatory sequences including the promoter. Thus, the scAAV design uses a small polyA signal (SPA), which is only about 54 bp (exemplary sequence shown in SEQ ID NO: 35).

[0475] The design using the EFS promoter and SPA occupies only about 300 bp and together with the AAV ITRs occupies about 600 bp, leaving about 1.8-1.9 kb of remaining packaging space for the nucleic acid sequence encoding the desired protein and any other sequences in the expression cassette designed for scAAV, and about 4.1-4.4 kb of remaining packaging space for the nucleic acid sequence encoding the desired protein and any other sequences in the expression cassette designed for ssAAV. Thus, larger sized cDNAs and / or other sequences can be packaged in the rAAV vectors containing the EFS promoter and SPA compared to using larger promoter and polyA signal sequences, including but not limited to the CMV promoter, CAG promoter, smCBA promoter, CBh promoter, EF1a promoter, bGH polyA, SV40 polyA, and SV40 late polyA.

[0476] A schematic of the expression cassette containing the EFS promoter and SPA is provided in FIG. 7c. The construct shown in FIG. 7b includes a CYP4V2 cDNA. For expression cassettes for other transgene expression, the CYP4V2 cDNA can be replaced with another gene of interest.

[0477] The use of the EFS promoter and SPA to drive nucleic acid coding sequences in expression cassettes and delivery vectors to treat ocular diseases was tested in this study. scAAV2 / 1 vectors containing the EFS promoter, CYP4V2 cDNA, and SPA, referred to as scAAV1.EFS.CYP4V2op.SPA, were generated. The scAAV1-EFS-CYP4V2op-SPA was administered in iPS-RPE cells of a BCD patient. Despite the short length of the EFS promoter and SPA, the scAAV1-EFS-CYP4V2op-SPA showed rapid and robust effects in iPS-RPE cells of a BCD patient within just 4 days (see Table 3). This indicates that the EFS promoter and / or SPA are small size regulatory sequences that are well suited for use in scAAV systems for ocular gene therapy. Furthermore, the robust expression of the scAAV vectors makes the scAAV design suitable for other routes of administration besides subretinal delivery (e.g., intravitreal delivery).

[0478] The use of the EFS promoter and / or SPA is not limited to CYP4V2 gene therapy or scAAV constructs. It can be used in gene therapies involving other genes where the transgene size and / or the scAAV design requires the use of a shorter length promoter and polyA signal to drive rapid and sufficient protein expression.

[0479] E. Treatment options, subject selection, and administration

[0480] CYP4V2 gene therapy can be administered in a variety of ways. In some cases, the treatment can be administered in vivo in a subject (e.g., a BCD patient) by effective delivery of a delivery vehicle containing a CYP4V2 expression cassette to a targeted cell, tissue, or organ of the subject, e.g., RPE, photoreceptor, choroid, cornea, lymphocyte, retina, or eye, thereby administering the treatment in vivo in the subject. In some cases, the treatment can be administered in vitro in a targeted cell (e.g., a patient iPS-RPE cell, a patient iPS-photoreceptor cell, an iPS-photoreceptor progenitor cell, an iPS-CEC, a lymphocyte). The treated cell can then be transplanted into a subject in need (e.g., a BCD patient). In some cases, the treatment can be administered via both an in vivo method and an in vitro method in combination. In some cases, CYP4V2 gene therapy can be used independently. In some cases, CYP4V2 gene therapy can be used with another treatment option.

[0481] Subjects that are candidates for the treatment methods of the application include subjects diagnosed with BCD. Subjects with other ophthalmic clinically defined conditions caused by mutations in the CYP4V2 gene (e.g., inherited retinal degeneration (IRD), retinitis pigmentosa (RP), or corneal dystrophy) can also be treated using the methods described herein. Diagnosis of BCD, IRD, RP, corneal dystrophy, or another ophthalmic condition caused by a mutation in the CYP4V2 gene can be made using methods known in the art to which the application pertains. The methods described herein can include identifying a subject, e.g., a pediatric, adolescent, or adult subject, having BCD or another ophthalmic condition caused by a mutation in the CYP4V2 gene or suspected of having BCD or another ophthalmic condition caused by a mutation in the CYP4V2 gene (e.g., based on the presence of symptoms of the condition and the absence of other apparent causes), and obtaining a sample comprising genomic DNA from the subject, detecting the presence of a mutation in the CYP4V2 gene using known molecular biology methods.

[0482] A number of mutations have been identified in the CYP4V2 gene and these mutations cause BCD, with at least one mutation in each of the 11 exons of the gene. Genotype analysis shows that the most common CYP4V2 mutation in BCD patients is c.802-8_810del17insGC (referring to a 17 base deletion and two base (GC) insertion at position 8 bases from the end of intron 6 of the CYP4V2 gene, also known as IVS6-8del / insGC; this insertion-deletion mutation is located at the intron 6-exon 7 junction and the 17 bp deletion includes the exon 7 splice acceptor site, causing an in-frame deletion of exon 7 encoding 62 amino acids), resulting in skipping of exon 7. (Xiao et al., Biochem Biophys Res Commun. 409: 181-6, 2011; Meng et al., 2014, Mol. Vis., 20: 1806-14; Wada et al., Am J Ophthalmol. 139: 894-9, 2005; Jiao et al., European Journal of Human Genetics (2017) 25, 461-471). Various types of mutations, including but not limited to missense, splice site, frameshift, deletion, insertion, insertion-deletion, nonsense, polymorphism (e.g., single nucleotide polymorphism), and premature termination, are found in CYP4V2 mutations associated with BCD. A summary of selected CYP4V2 mutations in human BCD patients is provided in Table 1 and can be found in various publications and online databases, such as LOVD (databases.lovd.nl / shared / genes / CYP4V2), OMIM (omim.org / allelicVariant / 608614), and ClinVar (ncbi.nlm.nih.gov / clinvar?term=608614 [MIM]).

[0483] It should be noted that the human CYP4V2 mutations in Table 1 are not exhaustive. More CYP4V2 mutations can be identified in the future. It should be understood that not all variations from a reference sequence are mutations. Some variations are non-pathological. Methods to confirm whether a genetic variation is a pathological variation (i.e., a mutation) are known in the art to which this invention pertains, including but not limited to comparing the variation to previously clinically identified known mutations, and / or determining whether there is a corresponding functional change. For example, one method to determine whether a genetic variation is a pathological variation (i.e., a mutation) is to test the biochemical functions of iPS-RPE cell lines derived from subjects as described herein and compare to the biochemical functions of iPS-RPE cell lines of healthy controls to assess whether there are any abnormalities.

[0484] Patients having BCD or another ophthalmic condition due to CYP4V2 mutations that can be treated using the methods described herein preferably retain a number of photoreceptors and visual function, e.g., as measured by visual acuity, visual field, visual function, and / or optical coherence tomography (OCT, e.g., spectral-domain OCT (SD-OCT)).

[0485] Prior to administration, the final product will undergo a series of steps (e.g., super-purification) to meet clinical grade standards. Clinical grade production is commercially available via various GMP facilities, including but not limited to facilities in the NIH Gene Therapy Resource Program (GTRP) and contract manufacturing organizations (CMOs).

[0486] Prior to administration, a subject can be tested for pre-existing neutralizing antibodies (NAbs) against the type of AAV vector the subject will be receiving administration of. In one embodiment, if a subject has pre-existing NAbs against this AAV type, an alternative AAV vector that has low cross-reactivity to the subject's pre-existing NAbs or an AAV vector with a modified capsid structure can be used to administer to the subject, thereby reducing the immune response and retaining sufficient transduction efficiency via the AAV vector. Other methods of minimizing the immune response are known in the art to which this application pertains, including but not limited to administering immunosuppressants and regimens prior to, during, and / or after treatment.

[0487] The viral vector or non-viral vector or a combination thereof (e.g., a hybrid vector) can be delivered into ocular cells of a subject using one or more physical means. As used herein, ocular cells refer to, but are not limited to, retinal pigment epithelial (RPE) cells, photoreceptor cells, corneal epithelial cells, retinal cells, retinal bipolar cells, rod cells, cone cells, ganglion cells, choroidal cells, and / or lens cells. Additionally or alternatively, the vector can be delivered into nearby or adjacent cells or cells that can come into contact with the targeted cells, including but not limited to cells in the brain or cells in the optic nerve or blood cells.

[0488] Ex vivo therapy can use any method or combination of methods and / or agents that can effectively deliver the vector to the cells targeted for therapy (e.g., iPS-RPE cells of a BCD patient). Ex vivo therapy can be performed via one or more rounds of infection. In some cases, the vector is administered directly to the cultured cells to transfect or transduce those cells. In some cases, other methods of delivery into cells and / or to enhance the efficiency of transfection / transduction in cells can be used, including but not limited to multiplex transfection / transduction, electroporation, magnetofection, or sonoporation. The methods and agents used to infect / transfect cells with the vector or expression cassette are known in the art to which this application pertains, including but not limited to as described in the Examples section herein.

[0489] The ex vivo treated cells can then be transplanted into the eye of a subject. For example, the genetically repaired iPS-RPE cells from a BCD patient can be transplanted into the patient via subretinal injection. The methods, agents, and devices used to transplant the cells into the eye are known in the art to which this application pertains, see, e.g., Wert et al., J Vis Exp. 2012; (69): 4286; WO 2016 / 179496; Schwartz et al., Investigative Ophthalmology & Visual Science April 2016, volume 57, ORS Fc1-ORS Fc9.

[0490] For in vivo treatment, the vector and / or expression cassette can be delivered to the cells targeted for in vivo treatment (e.g., via administration to the eye of a subject in need of treatment, thereby delivering to the cells targeted for treatment). Methods of in vivo delivery of nucleic acid molecules, expression cassettes, vectors to target ocular cells are known in the art to which this application pertains. For example, administration to the eye can be according to the cells targeted for treatment using any method (or combination of methods and / or agents) effective to deliver the vector to the retina, subretinal space, choroid, or generally the posterior segment of the eye, cornea, lens, or vitreous. Administration can be via any suitable means, including but not limited to injection (e.g., subretinal injection, intravitreal injection, direct retinal injection, direct injection into the suprachoroidal space of the posterior segment of the eye), eye drops, and can be administered in combination with other delivery techniques (e.g., electrically assisted delivery to the corneal epithelium). CYP4V2 nucleic acids, expression cassettes, and / or delivery vectors can also be introduced into cells using, for example, DNA particle bombardment (e.g., by gene gun), hydrodynamic gene transfer, eye drops, electroporation, magnetic transfection, or sonoporation. Methods and techniques of administration to the eye and delivery are known in the art to which this application pertains. See, for example, and without limitation, Wert et al., J Vis Exp. 2012; (69): 4286; WO2016 / 179496; Mohan et al., Prog Retin Eye Res. 2012 Jan; 31(1): 43-64.

[0491] In addition to the use of subretinal injections for the delivery of RPE cells as is known in the art, one aspect of the methods discussed herein is the intravitreal delivery of nucleic acid molecules (e.g., having a non-mutant CYP4V2 nucleic acid sequence) to treat or prevent eye disease. Some vectors (e.g., AAV2 (quad-Y-F+T-V) and AAV 7m8) show particular promise for efficient transduction in the retina via intravitreal administration. Furthermore, AAV or other viral vectors can be modified by techniques known in the art, including, for example, "directed evolution" and "rational design," to improve or optimize their suitability as vectors for gene delivery to one or more types of cells or tissues in ways other than the subretinal injections known in the art (e.g., intravitreal injection). In addition to subretinal delivery, scAAV vectors can also be used in intravitreal delivery because of their rapid and robust expression profile. Because CYP4V2 is ubiquitously distributed and has particularly high expression in the retina, genetic and epigenetic alterations of CYP4V2 are particularly amenable to repair via intravitreal administration of one or more vectors. Current methods of gene therapy often require administration of vectors subretinally. Thus, one of the technical advances achieved by the materials and methods disclosed herein is the intravitreal delivery of nucleic acid sequences (e.g., wild-type or non-mutant nucleic acid sequences, or nucleic acid sequences encoding gene editing polypeptides) and / or polypeptides to treat and prevent eye disease associated with genetic or epigenetic alterations in nucleic acid sequences of CYP4V2.

[0492] Certain techniques and agents can be used to facilitate the administration or delivery process. Non-limiting examples include the use of lubricants to avoid vector adhesion to the delivery vehicle (e.g., needle). Furthermore, the use of immunosuppressive drugs before, during, and / or after the administration or delivery process can increase the efficiency of infection or transduction.

[0493] Various pharmaceutically and / or physiologically acceptable vehicle excipients, diluents, and / or carriers can be used to formulate the vectors for delivery into ocular cells of a subject. Vehicle excipients, diluents, and / or carriers suitable for administration to the eye can be referred to as pharmaceutically acceptable carriers, examples of which include sterile pyrogen-free water and sterile pyrogen-free buffered saline (e.g., saline buffered using a phosphate or other buffer, such as HEPES to maintain the pH at an appropriate physiological level), isotonic sodium chloride solutions, balanced salt solutions, emulsions (e.g., oil / water emulsions), and various types of wetting agents. In some cases, the formulation can include other medicinal agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, and diluents. In some cases, the formulation can include DBPS, glycerol, or Tween 20 for long-term storage.

[0494] Methods of determining the most effective way of administering and the therapeutically effective dose will be known to the skilled artisan and will vary depending on the vector, its capsid structure, the vector design (e.g., ssAAV vs. scAAV), the composition of the expression cassette, the expression level of the vector, the promoter, other regulatory sequences or nucleic acid molecules, the vector titer, the target cell type, the target expression level, the size or number of regions of the cell being targeted, and the subject being treated (e.g., the age, sex, weight, disease and stage of development of the disease and potential immune response of the subject being treated); the route of administration; the location of the cell being targeted for treatment (e.g., retina vs. cornea); the nature and expression level of the relevant gene in wild-type cells and / or tissues; and the desired regimen. Therapeutically effective doses can be determined and evaluated in disease models (e.g., BCD cell models (e.g., iPS-RPE cell lines from BCD patients) or animal models) and confirmed or modified by clinical trials. For in vitro treatment of cells, the dose is typically expressed in MOI, which is then multiplied by the number of cells to be treated. MOI is generally in the range of about 1 x 10 3 GC / cell to about 1 x 10 6 GC / cell (GC: genome copies, measures AAV particles containing genomes (also known as vector genomes (vg) or genome particles (gp)). For in vivo treatment, in addition to the factors described above, the actual dose administered will also be influenced by the individual circumstances of each patient during administration, for example, in the case of Choroideremia described below, patient 6 had a reduced dose during subretinal administration. Thus, a therapeutically effective dose for a single administration in vivo can be in the approximate range of about 1 x 10 6 to 2 x 10 13 GC and include the endpoints (e.g., about 1 x 10 11 GC to about 1 x 10 12 GC, about 1 x 10 10 GC to about 1 x 10 11 GC, about 1 x 10 9 GC to about 1 x 10 10 GC, about 1 x 10 6 GC to about 1 x 10 9 GC, about 1 x 10 12 to 2 x 10 13 GC and include the endpoints (e.g., about 1 x 10 6 to 2 x 10 13Dose administration of GC. In another embodiment, the in vivo dose is determined by the number of cells targeted for treatment multiplied by the target MOI (e.g., 1 x 10 3 GC / cell to about 1 x 10 6 The volume of the agent containing the rAAV vector in any single administration to the eye can range from about 1 μΐ (0.001 mL) to about 1000 μΐ (1 mL).

[0495] Compositions as described herein can be formulated into a single dose or multiple doses. Likewise, administration can occur once or multiple times (e.g., over weeks, months, or years) and can be administered to the same eye or the contralateral eye. In the case of multiple administrations, the same or different AAV serotype and / or route of administration can be considered. Administration can also be used to treat different tissues and cells, e.g., one administration targets the RPE and another administration targets the cornea.

[0496] Methods of viral vector production, GMP production, purification, formulation, and dosing for use in gene therapy, including ocular gene therapy, are known to those of skill in the art, and methods of making viral vectors can be performed by any of the companies and methods shown below with respect to each of the gene therapy studies for LCA-2. The expression cassettes provided herein can be inserted into any of the exemplary viral vectors listed below. Alternatively, viral vectors can be produced according to the examples provided below. See Bainbridge et al., 2008. N Engl J Med. 358:2231-9; Maguire et al., 2008. N Engl J Med. 358:2240-8; Hauswirth et al., Hum Gene Ther. 2008 Oct; 19(10):979-990.

[0497] For example, in the Bainbridge study, gene delivery was performed using the tgAAG76 vector, a recombinant adeno-associated virus vector of serotype 2. The vector contains the human RPE65 coding sequence, driven by the human RPE65 promoter and terminated by the bovine growth hormone polyadenylation site, as described elsewhere. The vector was produced by Targeted Genetics Corporation under Good Manufacturing Practice guidelines, using the B50 packaging cell line, an adenovirus-adeno-associated virus hybrid shuttle vector containing the tgAAG76 vector genome, and adenovirus 5 helper virus. The vector was administered at 1 x 10 11The titer of 1.5 x 1011vector particles / ml was filled in a buffered saline solution and frozen in 1 ml aliquots at -70°C.

[0498] Maguire used a recombinant AAV2.hRPE65v2 viral vector, which is a replication-deficient AAV vector containing the RPE65 cDNA, which has been documented to provide long-term durable (>7.5 years, ongoing observation) visual function recovery after a single subretinal injection of AAV2.RPE65 in a canine LCA2 model. The cistplasmid used to generate AAV2.RPE65 contains a kanamycin resistance gene. The virus was manufactured by The Center for Cellular and Molecular Therapeutics after triple transfection of HEK293 cells and isolated and purified by microfluidization, filtration, cation exchange chromatography (POROS 50HS; GE Healthcare, Piscataway, N.J.), density gradient ultracentrifugation, and diafiltration in PBS. This combination provides the best purity of AAV vector product, including efficient removal of empty capsids and residual cesium chloride. A portion of the product was supplemented with PF68 NF Prill Poloxamer 188 (PF68; BASF, Ludwigshafen, Germany) to prevent subsequent loss of vector to product contact surfaces. The purified virus with or without PF68 was then passed through a 0.22-μm filter using a 60-ml sterile syringe and needle filter and stored frozen (-80°C) in sterile tubes until use. 1.5 x 1011 10 The injection of 1.5 x 1011AAV2.hRPE65v2 vector genomes in a volume of 150 μl of phosphate buffered saline supplemented with Pluronic F-68 NF Prill Poloxamer 188 was administered into the subretinal space.

[0499] The viral vector used by Hauswirth was a recombinant adeno-associated virus serotype 2 (rAAV2) vector that was altered to carry the human RPE65 gene (rAAV2-CB SB -hRPE65), which has previously been demonstrated to restore vision in animal models with RPE65 deficiency. The RPE65-LCA viral vector was delivered by subretinal injection (5.96 x 1010vector genomes in 150 μl). 10

[0500] ​Methods and regimens for administration of therapeutic agents (e.g., proteins, nucleic acid molecules, expression cassettes, gene therapy vectors, cells), including but not limited to administration to the eye, and other procedures and regimens (including but not limited to immunological tests, eye examinations, and immunosuppressants), are known in the art to which the present application pertains. For example, the following is an example of subretinal injection of AAV vectors used by MacLaren in the treatment of achromatopsia. Surgery began with a retinal detachment using balanced salt solution (Alcon Laboratories, Fort Worth, TX, USA) via a 41G Teflon cannula (DORC International BV, Zuidland, Netherlands). Once the retinal target area was detached from the underlying retinal pigment epithelium, a fixed volume (0.1 mL) containing 1 x 1011 10 AAV2.REP1 genome particles was injected via a new syringe into the subretinal space created in the first five patients. In patient 6, a reduced dose of up to 6 x 1010 9 genome particles was injected. The vector was injected slowly via the same retinotomy, causing the detachment to further enlarge. In the first five patients, the surgery was not difficult or complicated, but in patient 6, the retina was difficult to detach from the surrounding macula, so it was necessary to induce a detachment from a point close to the fovea, which caused a visible stretching of the papillomacular bundle. Because of concern about stretch-related damage to this important structure in a patient with 6 / 7·5 vision, a smaller volume of vector was injected in the second step (up to 0.06 mL). In all patients, the remaining vector in the syringe was expelled into a polypropylene vial via the cannula, and then frozen. This remaining vector was later tested for potency by Western blotting after transduction of a human HT1080 cell line. The patients were treated with a 10-day course of oral prednisolone, starting 2 days before surgery, at 1 mg / kg (70-100 mg) for 7 days, then reduced to 40 mg for 1 day, 20 mg for 1 day, and 10 mg for 1 day. Blood samples were taken for immunological tests preoperatively and at 1 week and 5-6 weeks postoperatively. See MacLaren et al., Lancet. 2014 Mar 29;383(9923):1129-1137.

[0501] In the Hauswirth study, dosing was as follows. After mild intravenous sedation, the surgical eye received retrobulbar anesthesia, then was prepared and draped in a standard sterile fashion. A standard three-port 23-gauge core and peripheral vitrectomy was performed. The conjunctiva over the right sclerotomy was dissected with a Westcott scissors and 0.3 mm pick. Hemostasis was maintained by eraser-tipped cautery. The sclerotomy was enlarged with a 20-gauge MVR blade to allow easy insertion of a subretinal cannula into the eye. The vector was drawn up into a 39-gauge injection cannula (Synergetics, O'Fallon, MO) and introduced into the subretinal space. At the end of the procedure, the sclerotomy was secured with 7.0 Vicryl suture and the conjunctiva was closed with interrupted sutures. Subconjunctival antibiotics and steroids were administered. Postoperatively, topical antibiotics and steroids were used for 20 days. See Hauswirth et al., Hum Gene Ther. 2008 Oct; 19(10): 979-990.

[0502] For in vitro CYP4V2 gene therapy treatment, post-treatment assessment can compare cell morphology and / or biochemical dysfunction of patient cells, e.g., comparing levels of a compound that shows abnormality in iPS-RPE cells (or iPS-PRC or iPS-CEC cells, if applicable) of a BCD patient before and after treatment, to assess whether morphology and / or biochemical function of the cells is improved after treatment.

[0503] For in vivo CYP4V2 gene therapy treatment, post-treatment assessment can use ocular and retinal examinations (and corneal tests, if applicable) known in the art for retinal and corneal diseases, including but not limited to dark adaptation, contrast sensitivity, visual field testing, visual acuity testing, color vision testing, ERG, OCT, fundus imaging, corneal examination, functional testing such as mobility, etc. Efficacy can be verified by one of the following: improvement in vision, cessation of disease progression, or slower rate of retinal degeneration or vision loss than expected.

[0504] One challenge with gene therapy mediated by viral vectors is the immune response of the subject receiving the gene therapy. In addition to the risks associated with the subject generally, the immune response can significantly reduce the transduction efficiency of the viral vector and / or cause long-term transgene expression to fail to be established. Mingozzi F, Meulenberg JJ, Hui DJ, Basner-Tschakarjan E, Hasbrouck NC, Edmonson SA, Hutnick NA, Betts MR, Kastelein JJ, Stroes ES, High KA, AAV-1 -mediated gene transfer to skeletal muscle in humans results in dose-dependent activation of capsid-specific T cells. Blood. 2009 Sep 3;114(10):2077-86.

[0505] Perhaps, in part because of the unique immune environment of the eye, the immune effects of various recombinant viral vectors (e.g., AAV, lentivirus, adenovirus) in ocular gene therapy appear to be quite benign. Nonetheless, a significant cell-mediated immune response develops after intraocular administration of adenovirus. But neither AAV nor lentivirus elicit a cell-mediated response, thus making them promising vectors for the treatment of chronic ocular (retinal) diseases. J Bennett, Immune response following intraocular delivery of recombinant viral vectors, Gene Therapy (2003) 10, 977-982. doi: 10.1038 / sj.gt.3302030. On the other hand, however, previous studies have shown that intravitreal administration of AAV vectors causes an increase in anti-AAV antibody levels in the vitreous humor and serum of non-human primates. Furthermore, the presence of pre-existing neutralizing antibody titers in the serum of monkeys was strongly correlated with weak transgene expression, decaying transgene expression, or no transgene expression after intravitreal administration of AAV. Kotterman et al., Antibody Neutralization Poses a Barrier to Intravitreal Adeno-Associated Viral Vector Gene Delivery to Non-Human Primates, Gene Ther. 2015 Feb;22(2): 116-126. Thus, reducing the immune response, particularly the neutralizing antibody (NAb) immune response, in ocular gene therapy is desirable in order to maintain the desired transduction efficiency and / or long-term transgene expression.

[0506] Historically, it has been a common practice for companies in the field of gene therapy to use one serotype of AAV vector. Often the vector type with the best transduction efficiency and the most safety data from animal studies and / or clinical trials of other gene therapies is used. For example, AAV2 is the most commonly used AAV serotype in ocular gene therapy in clinical trials. However, due to individual differences in the immune system, such as individual differences in pre-existing anti-AAV antibodies, the best serotype for one patient is not always the best for another patient. For example, the prevalence of pre-existing anti-AAV neutralizing antibodies against a particular AAV serotype varies among countries and among populations. Furthermore, the immune response can significantly reduce transduction efficiency, which can reduce the efficacy of the administered gene therapy and / or require administration of a higher dose.

[0507] Provided herein is a method to reduce immune response to viral vectors, maintain transduction efficiency, reduce viral vector and / or immunosuppressant dosage, and / or maximize therapeutic efficacy for different patients with the same genetic disease in viral vector-mediated gene therapy, comprising:

[0508] (a) establishing a library of more than one recombinant viral vector (e.g., rAAV) with sufficient transduction efficiency in the target cell type for which the gene therapy is intended. The library of viral vectors can be expanded by generating variants with mutations in the antigenic region or other mutations or variants on the capsid of the viral vectors, upon confirmation of sufficient transduction efficiency of the mutations or variants in the target cells related to the disease (e.g., in iPS-RPE or RPE cell lines for CYP4V2 gene therapy for BCD).

[0509] (b) detecting pre-existing neutralizing anti-viral vector antibodies (NAbs) against different viral vector serotypes and / or capsid mutations or variants in a subject in need of the gene therapy, and / or testing and comparing different viral vectors in patient-specific disease target cells (e.g., iPS-RPE cells) derived from the subject.

[0510] (c) selecting a viral vector from the library of viral vectors that (i) has sufficient transduction efficiency in the disease target cells and (ii) has low cross-reactivity with the pre-existing Nabs in the subject, and / or (iii) has good phenotypic rescue results in the patient-specific disease target cells of the subject (e.g., patient-specific iPS-RPE or RPE cell lines for CYP4V2 gene therapy for BCD), wherein the library of viral vectors comprises different serotypes and / or capsid-modified viral vectors (e.g., including but not limited to capsid mutant AAVs and / or capsid protein variant AAVs).

[0511] (d) administering to the subject using the viral vector selected from (c).

[0512] (e) repeating (b) to (d) above (only the portion related to pre-existing NAb is repeated) whenever the subject needs to be administered the gene therapy, including but not limited to subsequent administration to the same organ (e.g., eye or contralateral eye) or to other organs.

[0513] Potential benefits of this method include reduced use of immunosuppressants, lower dosage of rAAV vectors, higher transduction efficiency and longer transgene expression, and / or higher percentage of patients suitable for the gene therapy.

[0514] It will be appreciated that this method can be used in conjunction with other viral vectors. Moreover, this method can be used in all types of ocular gene therapy and non-ocular gene therapy, whether the therapy is related to the CYP4V2 gene or to other genes.

[0515] Methods of detecting pre-existing anti-AAV antibodies are known in the art to which this invention pertains. Notably, anti-AAV antibodies include both neutralizing and non-neutralizing antibodies. Methods to detect pre-existing anti-AAV antibodies and other immune responses against AAV are known in the art to which this invention pertains. Melvin Y Rincon et al., JMIR Res Protoc. April-June 2016; 5(2): e102; Hauswirth et al., Hum Gene Ther. October 2008; 19(10): 979-990. While the effect of neutralizing antibodies is most significant, even non-neutralizing antibodies can trigger vector clearance by the immune system. Non-neutralizing antibodies can be detected by ELISA. Boutin S, Monteilhet V, Veron P, Leborgne C, Benveniste O, Montus MF, Masurier C, Prevalence of serum IgG and neutralizing factors against adeno-associated virus (AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population: implications for gene therapy using AAV vectors. Hum Gene Ther. 2010 Jun;21(6):704-12.

[0516] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject methods and compositions belong. In addition to the definitions provided herein, commonly used terms in molecular biology can be found in Glossary of Genetics: Classical and Molecular, Rieger et al., 1991, 5th Edition, Springer- Verlag; Current Protocols in Molecular Biology, Ausubel et al., eds., 1998 Supplement, Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.; Current Protocols in Cell Biology, Bonifacino et al., eds., 1999 Supplement, John Wiley & Sons, Inc.; and Current Protocols in Neuroscience, Crawley et al., eds., 1999 Supplement, John Wiley & Sons, Inc.

[0517] Representative methods and materials are described herein; other suitable methods and materials known to those skilled in the art of the application can also be used. These methods and materials are illustrative only and are not intended to be limiting.

[0518] Examples

[0519] The application is further described in the following examples, which do not limit the scope of the application and the claims.

[0520] These studies were initiated, designed, organized, and sponsored by Reflection Biotechnologies Limited (“Reflection Bio”), a biotechnology company created and propelled by patients and families affected by rare retinal diseases. Rare disease patients bear the inevitable odds of human genetic mutations, yet are often overlooked by society and under-supported by public resources. As a patient-powered biotechnology company, Reflection Bio harnesses the power of “By Patients, For Patients” to provide patients with a united front and take a more active role in driving scientific and medical research and development for rare and other challenging diseases.

[0521] Patients diagnosed with BCD with different bi-allelic CYP4V2 mutations, including homozygous CYP4V2 mutations or compound heterozygous CYP4V2 mutations, were included in this study. In particular, one patient (referred to herein as patient 1, PI, or RB001) had a homozygous c.802-8_810del17insGC mutation. The c.802-8_810del17insGC mutation causes an in-frame deletion of exon 7 encoding 62 amino acids. The c.802-8_810del17insGC mutation is the most common mutation in BCD patients. Patient 2 (P2 or RB002) had compound heterozygous CYP4V2 mutations, each of which is a single nucleotide change that causes only one amino acid change in the 525 amino acid long CYP4V2 protein.

[0522] Informed consent was obtained. Procedures followed the guidelines of the Declaration of Helsinki and were approved by an institutional review board.

[0523] BCD human cell disease model examples

[0524] Clinically, BCD is associated with RPE atrophy, which in turn causes photoreceptor death and vision loss. Therefore, it is critical to establish and use a human RPE model to study BCD and develop treatments for BCD.

[0525] Example 1 - Generation and characterization of induced pluripotent stem cells (iPSCs) derived from BCD patients

[0526] In this study, iPSCs were generated from BCD patients using integration-free methods. Traditional techniques for iPSC reprogramming (e.g., lentivirus, retrovirus) integrate into the genome of the target cell. The resulting iPSCs and cells differentiated from those iPSCs will contain exogenous DNA and can be unsafe and problematic when used in cell therapy and drug discovery applications. Furthermore, integration can occur in critical regions of the genome, causing problems in unrelated developmental processes. In contrast to traditional reprogramming methods, integration-free reprogramming methods generate iPSCs that do not contain detectable vectors or transgenes, making them more suitable for use in cell therapy and drug discovery applications.

[0527] In this study, two different non-integrative reprogramming methods were used to generate iPSCs from BCD patients: one using Sendai virus and the other using an episomal vector. Two different types of samples were used: skin samples (skin fibroblasts) and blood samples (peripheral blood mononuclear cells (PBMCs)). Both methods can be used to generate BCD patient-specific iPSCs from skin, blood, or other samples such as urine and hair samples.

[0528] A. iPSC reprogramming from skin samples

[0529] Skin biopsies were performed on BCD patients, and human fibroblasts were obtained from these biopsies. These BCD patient-specific fibroblasts were then reprogrammed into iPS cell lines ...

Claims

1. An RNA molecule comprising a nucleic acid sequence targeting the CYP4V2 gene or the c.802-8_810del17insGC mutation in the CYP4V2 gene, wherein the nucleic acid sequence has at least 80% sequence identity with a nucleic acid sequence of any of the following: SEQ ID NO:48(UGAUUAUCAUUCAAAGCGAA), SEQ ID NO:49(GAUUAUCAUUCAAAGCGAAC), SEQ ID NO:50(GAUAAUCACAUGCUUCUGUU), SEQ ID NO:51(UUCAUUGGCGUUCAUUUCAU), and SEQ ID NO:52(CACAUGCUUCUGUUUGGACU).

2. The RNA molecule according to claim 1, wherein it is a guide RNA or CRISPR guide RNA (gRNA), CRISPR RNA (crRNA), or single guide RNA (sgRNA).

3. The RNA molecule according to claim 1 or 2, wherein the RNA molecule is chemically modified.

4. A DNA molecule encoding an RNA molecule according to claim 1, 2 or 3.

5. The RNA molecule according to claim 1, 2 or 3 or the DNA molecule according to claim 4, wherein the "g" nucleotide is added to the beginning of the nucleic acid sequence, the nucleic acid sequence targeting the CYP4V2 gene or the c.802-8_810del17insGC mutation in the CYP4V2 gene.

6. A composition comprising an RNA molecule according to claim 1, 2 or 3, a DNA molecule according to claim 4, or an RNA molecule or DNA molecule according to claim 5.

7. The composition according to claim 6, further comprising CRISPR-associated protein 9 (Cas9 protein) or a variant thereof or a nucleic acid molecule encoding Cas9 protein or a variant thereof.

8. The composition of claim 7, wherein the Cas9 protein or a variant thereof or the nucleic acid molecule encoding the Cas9 protein or a variant thereof further comprises one or more nuclear localization sequences (NLS) and / or selection markers.

9. The composition according to any one of claims 6 to 8, further comprising a donor nucleic acid molecule, said donor nucleic acid molecule comprising all or part of the wild-type sequence or functional sequence of the CYP4V2 gene.

10. The composition of claim 9, wherein the donor nucleic acid molecule comprises a sequence selected from any one of SEQ ID NO:47, 56 and 57 or a complementary sequence thereof, or has at least 80% sequence identity with any one of SEQ ID NO:47, 56 and 57 or a complementary sequence thereof.

11. The composition according to claim 9 or 10, wherein the donor nucleic acid molecule is contained in a single-stranded donor oligonucleotide (ssODN) or a carrier.

12. The composition according to any one of claims 6 to 11, wherein one or more of its components are provided in the form of a DNA molecule encoding the component, an mRNA molecule encoding the component, a nucleic acid molecule, a vector, an RNA molecule, a polypeptide, a ribonucleoprotein (RNP) or a protein-RNA complex and / or a combination thereof.

13. The composition according to any one of claims 6 to 12, wherein the vector is a plasmid, a recombinant AAV (rAAV) vector, a recombinant lentiviral vector, and / or a combination thereof.

14. The composition according to any one of claims 6 to 13, wherein any two or more of its components are in a single molecule or in combination in a molecule or a complex, in a single carrier or in combination in a carrier, in one or more nucleic acid complexes, or in one or more RNP complexes.

15. The composition according to any one of claims 6 to 14, further comprising a pharmaceutically acceptable carrier and additional components suitable for use with a particular route of administration or delivery device.

16. The composition according to any one of claims 6 to 15, for targeting, disrupting, correcting and / or replacing mutations in the CYP4V2 gene in vivo or in vitro cells.

17. The composition of claim 16, wherein the mutation in the CYP4V2 gene is the c.802-8_810del17insGC mutation.

18. Use of the composition according to any one of claims 6 to 17 in the preparation of a medicament for treating, inhibiting, or preventing Bietti's Crystalline Dystrophy (BCD, also known as Bietti Crystalline Corneoretinal Dystrophy, Bietti Crystalline Retinopathy, Bietti's Retinal Dystrophy) or retinitis pigmentosa (RP) or inherited retinal degeneration (IRD) associated with one or more mutations in the CYP4V2 gene in human subjects of need, the method comprising delivering the composition according to any one of claims 6 to 17 to the retina of the human subject, wherein the composition is used to transduce one or more retinal pigment epithelial (RPE) cells, one or more choroidal cells, or one or more photoreceptor cells of the human subject.

19. The use according to claim 18, wherein at least one mutation of the CYP4V2 gene in the human subject is a c.802-8_810del17insGC mutation.

20. A cell comprising the composition according to any one of claims 6 to 17.

21. The cell of claim 20, wherein the cell is a mammalian cell or an insect cell.

22. The cell according to claim 20 or 21, wherein the cell is HEK293 cell, 293T cell, A459 cell, Sf9 cell or other cell used for vector preparation.

23. The cell of claim 20, wherein the cell is a retinal pigment epithelial (RPE) cell, photoreceptor cell, photoreceptor progenitor cell, choroidal cell, retinal cell, induced pluripotent stem (iPS) cell, or stem cell of a human subject carrying one or more mutations in the CYP4V2 gene, or a cell derived from the retinal pigment epithelial (RPE) cell, photoreceptor cell, photoreceptor progenitor cell, choroidal cell, retinal cell, induced pluripotent stem (iPS) cell, or stem cell of the human subject.

24. The cell of claim 23, wherein at least one mutation in the CYP4V2 gene carried by the human subject is a c.802-8_810del17insGC mutation.

25. The use of the cells according to claim 20, 23, or 24 in the preparation of a medicament for treating, inhibiting, or preventing crystalline retinitis pigmentosa (BCD, also known as crystalline retinal degeneration, crystalline corneal retinal degeneration, crystalline retinopathy, Bietti retinal degeneration), retinitis pigmentosa (RP), or hereditary retinal degeneration (IRD) associated with the c.802-8_810del17insGC mutation in the CYP4V2 gene in human subjects of need, the method comprising delivering the cells according to claim 20, 23, or 24 to the retina of the human subject.

Images