Breast cancer biomarker and use thereof

Abstract

The present application belongs to the technical field of biomarkers, and particularly relates to a breast cancer biomarker and application thereof. The present application first identifies long-chain non-coding RNA CCLA, and confirms that the expression of CCLA in triple-negative breast cancer tissue is significantly higher than that in normal tissue, and high expression is closely related to poor prognosis of patients. Through RT-qPCR verification and survival analysis of 81 TNBC clinical samples, the potential of CCLA as a specific biomarker of TNBC is confirmed, a new specific target for precise diagnosis and treatment of TNBC is provided, and the shortage of TNBC target points in the prior art is effectively overcome.

Description

Technical Field

[0001] This invention belongs to the field of biomarker technology, specifically relating to the identification of long non-coding RNA and its application as a tumor marker in triple-negative breast cancer. Background Technology

[0002] Triple-negative breast cancer (TNBC) is the most aggressive and has the worst prognosis among breast cancer subtypes. Due to its high heterogeneity and lack of expression of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2), TNBC is ineffective with endocrine therapy and HER2-targeted therapy. TNBC is typically diagnosed when these marker targets are not detected by immunohistochemistry of patient samples. However, the lack of corresponding targets for suitable drug combinations, treatment insensitivity, and poor prognosis make it a significant challenge in treating TNBC.

[0003] Long noncoding RNA (lncRNA) is a class of RNA molecules longer than 200 nucleotides that do not encode proteins. It plays a crucial regulatory role in tumorigenesis, development, metastasis, and drug resistance. The Cyclin D3-CDK6 complex is a key regulator of the G1 / S phase transition in the cell cycle. Recent studies have revealed that this complex can also influence tumor cell survival and apoptosis by regulating cellular metabolism (such as the pentose phosphate pathway and serine synthesis pathway), particularly in TNBC with Rb protein loss of function, where its mechanism of action is more complex and remains unclear.

[0004] Currently, studies have reported that lncRNAs influence tumor progression by binding to cyclin or kinase complexes. For example, lncRNA DILA1 has been reported to promote tamoxifen resistance in breast cancer by inhibiting the degradation of Cyclin D1 (ShiQ et al, Nature Communications 2020). In the field of TNBC, although some studies have involved the function of the cyclin D-CDK complex, no studies have reported the specific mechanisms by which specific lncRNAs directly participate in the formation of the cyclin D3-CDK6 complex and regulate TNBC cell apoptosis through Rb-independent metabolic pathways. Summary of the Invention

[0005] To address the aforementioned problems in the existing technology, this invention provides an application of long non-coding RNA as a tumor marker in triple-negative breast cancer.

[0006] The technical solution adopted in this invention is as follows:

[0007] A long non-coding RNA CCLA, the nucleotide sequence of which is shown in SEQ ID No:1.

[0008] The application of the long non-coding RNA CCLA as a molecular marker for triple-negative breast cancer.

[0009] The applications include:

[0010] a. Application of products that detect CCLA expression levels in the preparation of reagents for the diagnosis of triple-negative breast cancer or for monitoring the prognosis of triple-negative breast cancer patients;

[0011] b. The application of CCLA inhibitors in the preparation of drugs for treating triple-negative breast cancer; or

[0012] c. Application of CCLA in predicting the sensitivity of triple-negative breast cancer to immunotherapy drugs.

[0013] The product used to detect CCLA expression levels is a reagent, chip, or kit.

[0014] The cancer cell type of the triple-negative breast cancer is any one of MDA-MB-231, MDA-MB-468, or BT549.

[0015] The inhibitor of CCLA is selected from at least one of the following:

[0016] Small interfering RNA (siRNA), double-stranded RNA (dsRNA), short hairpin RNA (shRNA), antisense oligonucleotides, lipids, small molecule chemicals, antibody drugs, peptides, or interfering lentiviruses.

[0017] A kit for the diagnosis or prognostic monitoring of triple-negative breast cancer, comprising a specific primer pair designed for the nucleotide sequence shown in SEQ ID NO:1. The expression level of CCLA in the sample is detected by methods such as qRT-PCR; if the expression level is higher than a preset threshold (e.g., more than 2-fold increase relative to the internal reference gene GAPDH), it suggests that the patient may have TNBC or a poor prognosis.

[0018] The nucleotide sequences of the specific primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0019] The beneficial effects of this invention are as follows:

[0020] This invention is the first to identify the long non-coding RNA CCLA and confirm that its expression in triple-negative breast cancer tissue is significantly higher than that in normal tissue. Moreover, high expression is closely related to poor patient prognosis (such as shortened overall survival). Through RT-qPCR validation and survival analysis of clinical samples (81 TNBC patients), the potential of CCLA as a TNBC-specific biomarker was confirmed, providing a new specific target for the precise diagnosis and treatment of TNBC and overcoming the shortcomings of the lack of TNBC targets in the existing technology. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The results of qRT-PCR validation of high CCLA expression in TNBC tissues and cell lines, and the Kaplan-Meier survival curves of high CCLA expression and poor patient prognosis are shown. Among them, A is the validation of CCLA expression in TNBC patient tissue samples, B is the CCLA expression in TNBC cell lines, C is the correlation between CCLA and overall survival (OS) of TNBC patients, and D is the correlation between CCLA and disease-free survival (DFS) of TNBC patients.

[0023] Figure 2 To establish and validate CCLA downregulated cell lines; where A represents a 90% knockdown of CCLA expression in MDA-MB-231 cells compared to the control group (si-NC); and B represents a 60% knockdown of CCLA expression in MDA-MB-468 cells compared to the control group (**p<0.01).

[0024] Figure 3 To compare the cell cycle and apoptosis of MDA-MB-231 cells and the control group by using si-CCLA to downregulate them; where A shows no significant change in cell cycle distribution between the two groups, and B shows the CCLA downregulation group compared with the control group. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0026] The first aspect of this application provides a long non-coding RNA CCLA, the nucleotide sequence of which is shown in SEQ ID No:1.

[0027] The second aspect of this application provides the use of the aforementioned long non-coding RNA CCLA as a molecular marker for triple-negative breast cancer.

[0028] In some embodiments, the application includes:

[0029] a. Application of products that detect CCLA expression levels in the preparation of reagents for the diagnosis of triple-negative breast cancer or for monitoring the prognosis of triple-negative breast cancer patients;

[0030] b. The application of CCLA inhibitors in the preparation of drugs for treating triple-negative breast cancer; or

[0031] c. Application of CCLA in predicting the sensitivity of triple-negative breast cancer to immunotherapy drugs.

[0032] In some embodiments, the product for detecting CCLA expression levels is a reagent, chip, or kit.

[0033] In some embodiments, the cell line type of TNBC is any one of MDA-MB-231, MDA-MB-468, or BT549.

[0034] In some embodiments, the inhibitor of CCLA is selected from at least one of the following: small interfering RNA (siRNA), double-stranded RNA (dsRNA), short hairpin RNA (shRNA), antisense oligonucleotides, lipids, small molecule chemicals, antibody drugs, peptides, or interfering lentiviruses.

[0035] In some embodiments, the nucleotide sequences of the specific primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0036] A third aspect of this application provides a kit for the diagnosis or prognostic monitoring of triple-negative breast cancer, the kit comprising a specific primer pair designed for the nucleotide sequence shown in SEQ ID NO:1; the nucleotide sequences of the specific primer pair are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0037] Example 1: TNBC screens out CCLA

[0038] This embodiment provides a long non-coding RNA CCLA, and the specific screening process is as follows:

[0039] Eighty-one patients with tumor-associated breast cancer (TNBC) were screened, including 19 patients with paired samples of both breast cancer and adjacent normal tissue, and 63 patients with unpaired samples of cancer and normal tissue. All samples were cryopreserved in liquid nitrogen, and transcriptome sequencing was performed by Beijing Novogene Technology Co., Ltd., including mRNA, miRNA, lncRNA, and circular RNA. Differential expression was defined as a 2-fold or greater change with statistical significance (corrected p<0.05). A total of 540 lncRNAs were identified as upregulated in tumors, and 853 were downregulated. The 10 most significantly upregulated and 10 most significantly downregulated lncRNAs were presented. CCLA expression in TNBC tumor tissue was 5.8-fold higher than that in adjacent normal tissue (p=0.0144). These lncRNAs participate in biological processes such as cellular energy metabolism, damage repair, and molecular structure regulation through multiple core pathways.

[0040] The nucleotide sequence of the long non-coding RNA CCLA (as shown in SEQ ID No:1) is as follows:

[0041]

[0042] CCLA is a novel, previously unreported lncRNA. The identification of CCLA is as follows:

[0043] Using 3' and 5' RACE kits in MDA-MB-231 cells, primers close to the 5' and 3' ends were designed based on the lncRNA reference sequence to clone the 3' transcription start point and 5' transcription end point of CCLA, respectively. Specific primers were used for long-fragment amplification. The forward primer sequence of the specific primer pair was: TGCCCTTGCGTGTGGGAGAT (as shown in SEQ ID NO:2), and the reverse primer sequence was: GAAATCCAGGGAGGAAAGCAG (as shown in SEQ ID NO:3). The amplified product was cloned into the pGM-T vector, sequenced, and the full-length sequence was obtained (as shown in SEQ ID NO:1). The final identification showed a full length of 3156 nt, consisting of 3 exons, originating from the second intron region of CCND3, and named Cyclin D3-Cognate Long noncoding RNA, CCLA.

[0044] Example 2: CCLA is generally highly expressed in TNBC

[0045] CCLA expression was verified by qRT-PCR, and the results were consistent with sequencing. Compared with adjacent normal tissue, CCLA was significantly highly expressed in tumor tissue (p<0.01). Figure 1 A). Subsequently, CCLA expression was detected in six human breast cancer cell lines and one human normal breast epithelial cell line MCF-10A: normal cells showed almost no expression, while all breast cancer cell lines showed expression. Among them, CCLA was generally highly expressed in three TNBC cell lines (MDA-MB-231, MDA-MB-468, and BT549), with significantly increased expression in MDA-MB-231 and MDA-MB-468, and relatively low expression in BT549. Figure 1 B).

[0046] Furthermore, based on the median expression level (median FPKM) of CCLA in the tumor samples of the patients, the patients were divided into a "low expression group (less than the median expression level)" and a "high expression group (greater than or equal to the median expression level)" for survival analysis. Survival curves were plotted using the Kaplan-Meier method, and the results are as follows: Figure 1 As shown in C and D, the overall survival (OS) and disease-free survival (DFS) of patients in the low CCLA expression group were significantly longer than those in the high expression group (p<0.05).

[0047] Example 3: Establishment of a research model for CCLA siRNA downregulation

[0048] siRNAs were designed targeting the CCLA sequence and transfected into TNBC cell lines (MDA-MB-231 cells and MDA-MB-468 cells).

[0049] qRT-PCR analysis revealed that, compared to the control group (si-NC), CCLA expression in the experimental group (si-CCLA) was knocked down by 90% in MDA-MB-231 cells. Figure 2 A), MDA-MB-468 cells were knocked down by 60% (**p<0.01) Figure 2 B).

[0050] Example 4: Reduced CCLA expression inhibits TNBC cell apoptosis

[0051] Cell cycle and apoptosis were detected using si-CCLA-downregulated MDA-MB-231 cells and a control group. Figure 3 As shown in Figure A, no significant changes were observed in the cell cycle distribution in the CCLA downregulated group and the control group. However, as... Figure 3 As shown in Figure B, compared with the control group, the proportion of early and mid-stage apoptotic cells (O4) in the CCLA downregulated group was 51.8% vs. 31.8%, and the proportion of mid-to-late-stage apoptotic cells (O2) was 22.3% vs. 7.8%. Therefore, it can be concluded that decreased CCLA expression can promote TNBC cell apoptosis without significantly affecting the cell cycle.

[0052] The above experimental results demonstrate that lncRNA CCLA, as a tumor marker, plays an important role in predicting and diagnosing triple-negative breast cancer, providing a new direction for elucidating the pathogenesis of TNBC and finding molecular targets.

[0053] As an alternative implementation method, the method for detecting CCLA expression is not limited to qRT-PCR, but can also be Northern Blot, RNA fluorescence in situ hybridization (FISH), aptamer, or high-throughput sequencing.

[0054] As an alternative approach, CCLA-targeting inhibitors can be used in combination with other TNBC treatments (such as chemotherapy drugs like paclitaxel, platinum-based drugs, and immune checkpoint inhibitors) to enhance efficacy.

[0055] This invention identifies the long non-coding RNA CCLA for the first time and confirms that its expression in triple-negative breast cancer tissue is significantly higher than that in normal tissue. Moreover, high expression is closely related to poor patient prognosis (such as shortened overall survival). Through RT-qPCR validation and survival analysis of clinical samples (81 TNBC patients), CCLA shows the potential as a TNBC-specific biomarker, providing a new specific target for the precise diagnosis and treatment of TNBC, and overcoming the shortcomings of the lack of TNBC targets in the existing technology.

[0056] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A long non-coding RNA CCLA, characterized in that, The nucleotide sequence of the long non-coding RNA CCLA is shown in SEQ ID No:

1.

2. The use of the product for detecting the expression level of the long non-coding RNA CCLA as described in claim 1 in the preparation of a reagent for diagnosing triple-negative breast cancer or for monitoring the prognosis of triple-negative breast cancer patients.

3. The application according to claim 2, characterized in that, The product used to detect CCLA expression levels is a reagent, chip, or kit.

4. The application according to claim 2, characterized in that, The cancer cell type of the triple-negative breast cancer is any one of MDA-MB-231, MDA-MB-468, or BT549.

5. A kit for the diagnosis or prognostic monitoring of triple-negative breast cancer, characterized in that, The kit for the diagnosis or prognostic monitoring of triple-negative breast cancer includes a pair of specific primers designed for the nucleotide sequence shown in SEQ ID NO:

1.

6. The reagent kit according to claim 5, characterized in that, The nucleotide sequences of the specific primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3.

Images