Application of protein kinase family gene GmCIPK3 interacting with CBL in soybean

Abstract

The invention discloses an application of a soybean GmCIPK3 (GmCIPK3) protein coding gene GmCIPK3. The nucleotide sequence of the soybean GmCIPK3 protein coding gene GmCIPK3 is as shown in SEQ ID NO. 1. The constructed plant overexpression vector pBA002-GmCIPK3 is subjected to agrobacterium tumefaciens-mediated soybean genetic transformation to obtain a soybean receptor variety Tianlong, and it is found that compared with a receptor control group, the protein content in seeds of an overexpression transgenic soybean plant is increased, the oil content is reduced, and the protein quality of the seeds of the overexpression transgenic soybean plant is improved. Therefore, the gene can be introduced into plants as a target gene to improve the quality of soybean grain protein. Therefore, the new function of the soybean GmCIPK3 protein coding gene GmCIPK3 in soybean plants is found, the protein content and the oil content are changed through genetic engineering, and then the application in the aspect of transgenic soybean grain quality is affected.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and relates to a protein kinase family gene in soybean that interacts with CBL. GmCIPK3 Applications. Background Technology

[0002] Soybean (Glycine max L. Merr.), as one of the world's most important oilseed and protein crops, has its economic value and application range directly affected by the content and quality of protein and oil in its seeds. Approximately 35-45% of the dry weight of soybean seeds is protein, and 18-22% is oil. These two main storage substances accumulate through complex metabolic pathways during seed development. Previously, Dr. Yang Zhongyi of our laboratory treated the salt-tolerant variety NJAU_C204 ​​and the salt-sensitive variety NJAU_C136 with salt during germination, and extracted radicles for miRNA and degradationome sequencing. Based on this, a regulatory network of miRNAs and corresponding target genes was created using the Omicshare tool. One of the target genes with a one-to-one regulatory relationship, Glyma02g275900 (V4.0 version gene number Glyma02g275900), belongs to the protein kinase family gene that interacts with CBL and has a serine-threonine protein domain. CIPK (CBL-Interacting Protein Kinase) is a core component of the plant calcium signaling system. It regulates soybean seed development, metabolism, and stress responses through the CBL-CIPK signaling network, directly affecting protein content, oil composition, and nutritional quality. Glyma02g275900 is named in this invention. GmCIPK3 .

[0003] CIPKs are protein kinases encoding serine (Ser) / threonine (Thr) residues. CIPKs mainly consist of three domains: an N-terminal catalytic domain containing an activation loop and an ATP-binding site, responsible for catalyzing the reaction; a CBL interaction domain, the region that binds to CBL proteins and transduces calcium signaling to downstream target genes through interaction with CBLs (Kudla et al., 2018); and a C-terminal regulatory domain containing the NAF / FISL motif (Sánchez et al., 2013; Sanyal et al., 2015), involved in regulating CIPK kinase activity and interactions with other proteins.

[0004] CIPKs (CIPK family kinases) are protein kinases in plants closely related to intracellular calcium signaling pathways. Belonging to the Ser / Thr (serine / threonine) protein kinase family, they participate in various physiological processes in plants, including growth and development, and stress responses. CIPKs mediate multiple physiological processes, including ion balance, osmotic regulation, and signal transduction, through interactions with specific calcium-binding proteins (such as CBLs, Calcineurin B-like proteins). Wang and Li (2022) identified 20 SmCIPK genes, finding that increased SmCIPK expression under salt stress improved salt tolerance in Arabidopsis. Xu et al. (2021) investigated the relationship between CBL-CIPK and the ABA signaling pathway in soybean, finding that the interaction between GmCIPK2 and GmCBL1 affected downstream genes related to ABA signaling and drought response, thereby enhancing the plant's drought tolerance. In addition, Guo et al. (2018) found that, compared with wild-type (WT) plants, Arabidopsis thaliana AtCIPK9 negatively regulates lipid accumulation, and overexpression of BnCIPK9 in rapeseed reduces oil synthesis in transgenic rapeseed.

[0005] The CIPK (CBL-Interacting Protein Kinase) family plays a central role in plant calcium signaling transduction, primarily affecting protein and oil (lipid) content in crop seeds by regulating nitrogen metabolism, fatty acid synthesis, and carbon allocation pathways. In rice, OsCIPK23 activates the potassium channel OsAKT1 through phosphorylation (Xu et al., 2006), and may also affect nitrogen transport, increasing grain protein content. In Arabidopsis, AtCIPK8 regulates NRT1.1 (nitrate transporter), affecting nitrogen uptake and consequently seed protein (Hu et al., 2009). In wheat, TaCIPK14 affects ABA signaling by regulating PP2C, thus influencing grain protein content (Deng et al., 2013). DGAT (diacylglycerol acyltransferase) and PDAT (phospholipid-diacylglycerol acyltransferase) are key enzymes in TAG synthesis. In rapeseed, BnCIPK6 promotes DGAT1 expression and increases seed oil content through calcium signaling (Zhang et al., 2018). ACCase (acetyl-CoA carboxylase) is the rate-limiting enzyme in fatty acid synthesis, and CIPK may regulate its activity through phosphorylation. In Arabidopsis, AtCIPK11 promotes triglyceride (TAG) accumulation by regulating the key lipid synthesis transcription factor WRI1 (Li et al., 2015). Therefore, the function of GmCIPK3 in soybean requires further experimental verification. Summary of the Invention

[0006] The purpose of this invention is to disclose the role of a protein kinase family gene, GmCIPK3, that interacts with CBL in influencing soybean quality.

[0007] Soybean GmCIPK3 protein encoding gene GmCIPK3 Its nucleotide sequence is: SEQ ID NO. 1.

[0008] The amino acid sequence of soybean GmCIPK3 protein is: SEQ ID NO. 2.

[0009] Contains the soybean GmCIPK3 protein encoding gene described in this invention. GmCIPK3 Recombinant expression vectors.

[0010] use GmCIPK3 When constructing plant expression vectors, any type of enhancing or inducible promoter can be added before the transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified, such as by adding selective marker genes (BAR genes, luciferase genes, etc.). Considering the safety of transgenic plants, no selective marker genes may be added, and transformed plants can be screened directly based on phenotypic traits.

[0011] The soybean GmCIPK3 protein encoding gene described in this invention GmCIPK3 Application in improving the protein quality of soybean seeds through genetic engineering.

[0012] Carrying the present invention GmCIPK3 Plant expression vectors can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant hosts that are transformed can be monocotyledonous plants such as rice, wheat, and corn, or dicotyledonous plants such as tobacco, Arabidopsis thaliana, soybean, rapeseed, cucumber, tomato, poplar, turfgrass, and alfalfa.

[0013] Beneficial effects: This invention discovered GmCIPK3 A novel function in improving soybean grain quality. Discovered through tissue expression analysis. GmCIPK3 It is mainly expressed at high levels in seeds, and subcellular localization shows... GmCIPK3 The protein is mainly located in the cell nucleus and cytoplasm. A plant overexpression vector pBA002- was constructed. GmCIPK3 The gene was overexpressed in the soybean recipient variety Tianlong. The selected T1 generation positive seedlings were identified, and the quality phenotype of the harvested mature grains was evaluated. It was found that the protein content was increased and the oil content was decreased in the overexpressed soybean material. Figure 6 , Figure 7 This indicates that the gene can improve the quality phenotype of soybean seeds. Attached Figure Description

[0014] Figure 1 GmCIPK3 Cloning of genes According to predictions from the Phytozome website GmCIPK3 Primers were designed based on sequence information. Leaf cDNA from the extreme materials NJAU_C204 ​​and NJAU_C136 (Zhang Wei, 2018. Fine mapping of salt-tolerant QTLs in soybean germination and functional study of the GmCDF1 gene (Doctoral dissertation, Nanjing Agricultural University)) provided by the Soybean Improvement Center of Nanjing Agricultural University was used as templates for PCR amplification, yielding a 1326 bp DNA fragment. Sequencing analysis showed that the sequence information of this fragment was consistent with the sequence predicted by the Phytozome website, indicating that this 1326 bp fragment is indeed the correct sequence. GmCIPK3 Genes. The markers are 2k plus, and from bottom to top, they are 100, 250, 500, 750, 1000, 2000, 3000 and 5000bp.

[0015] Figure 2 GmCIPK3 Tissue expression analysis of genes Real-time quantitative PCR technology was used to... GmCIPK3 The expression of soybean extremophiles NJAU_C204 ​​and NJAU_C136 was studied in different tissues, namely roots, stems, leaves, flowers, pods, and seeds.

[0016] Figure 3 Subcellular localization of GmCIPK3 (A) d35s::GFP; (B) d35s::GmCIPK3-GFP.

[0017] Figure 4 Positive identification of overexpressing transgenic soybean lines using Bar test strips.

[0018] Figure 5 Overexpression of the target gene in transgenic soybean lines GmCIPK3 Expression level detection.

[0019] Figure 6 Comparison of protein content in seeds of overexpressing transgenic soybean lines and the control recipient variety Tianlong.

[0020] Figure 7 Comparison of oil content in seeds of overexpressing transgenic soybean lines and the control recipient variety Tianlong. Detailed Implementation

[0021] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0022] Unless otherwise specified, the methods used in the following embodiments are conventional methods. Example 1

[0023] (1) Soybeans GmCIPK3 Cloning and identification of its encoding genes According to predictions from the Phytozome website GmCIPK3 Primers were designed based on sequence information, and cDNA from leaves of salt-tolerant material NJAU_C204 ​​and salt-sensitive material NJAU_C136 was used as templates for PCR amplification. Upstream primers... GmCIPK3 -F: TTGCTCGGTTCCACTGCAGAA (SEQ ID NO.3); downstream primer GmCIPK3 -R: CATAACCGCGACTGTTGGAT (SEQ ID NO.4). Total RNA was amplified from soybean leaves using RT-PCR. GmCIPK3 Gene extraction. Soybean leaf tissue was collected, ground in a mortar and pestle, and added to a 1.5 mL EP tube containing lysis buffer. After thorough shaking, the mixture was transferred to a glass homogenizer. After homogenization, the homogenate was transferred to a 1.5 mL EP tube, and total RNA was extracted using a plant total RNA extraction kit (TIANGEN DP404). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was measured using a spectrophotometer. Using the obtained total RNA as a template, reverse transcription was performed according to the instructions of the reverse transcription kit provided by Takara to synthesize the first strand of cDNA. PCR amplification was then performed. The PCR reaction system consisted of: 2 μl cDNA (0.05 μg), 2 μl each of forward and reverse primers (10 μM), 25 μl 2×PhantaMax Buffer, 1 μl dNTP (10 mM), and 1 U PhantaMax Super-Fidelity DNA polymerase (Vazyme), with the volume made up to 50 μl of ultrapure water. The PCR program was as follows: Performed on a Bio-RAD PTC200 PCR instrument, the program was: 94°C pre-denaturation for 3 min; 94°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 45 s, for a total of 30 cycles; then terminated with a 72°C extension for 5 min, and stored at 4°C. The PCR product was recovered and cloned into the pGEM-Teasy vector. Sequencing yielded the soybean gene with a complete coding region. GmCIPK3 The cDNA sequence SEQ ID NO. 1 is 1326 bp in length and encodes the 233 amino acids shown in SEQ ID NO. 2.

[0024] (2) GmCIPK3 Expression characteristics in different organs of soybean RNA was extracted from the roots, stems, leaves, flowers, pods, and seeds of extremophiles NJAU_C204 ​​and NJAU_C136, and converted into cDNA for RT-PCR analysis. Total RNA extraction was performed in the same manner. The soybean constitutive expression gene Tubulin was used as an internal reference gene, with the amplification primers being the forward primer sequence: CCTCGTTCGAATTCGCTTTTTG (SEQ ID NO.5) and the reverse primer sequence: CAACTGTCTTGTCACTTGGCAT (SEQ ID NO.6). Real-time quantitative PCR analysis was performed using cDNA from different soybean tissues or organs as templates. GmCIPK3 The amplification primers are: GmCIPK3 -qPCR-F:CCACAGAGACCTGAAGCCAG(SEQ ID NO.7), GmCIPK3 -qPCR-R: GGGTCGTCGAAAGGCAAGTA (SEQ ID NO. 8). Results ( Figure 2 Analysis shows GmCIPK3 Its expression is relatively high in seeds.

[0025] (3) Subcellular localization of GmCIPK3 Subcellular localization was performed using transient expression in Arabidopsis protoplasts. The vector used was pAN580, and the primers were GmCIPK3-AN-F: acaaatctatctctctcgagATGAGTCAGCCTA (SEQ ID NO. 9) and GmCIPK3-AN-R: gctcaccatggatccCTTTGTTTCTCGCATTT (SEQ ID NO. 10). PCR amplification was performed, and after confirming the target band was correctly identified, gel extraction was performed. The gel extraction product was ligated into the vector via homologous recombination to construct the subcellular localization vector pAN580-GmCIPK3 (gene at the N-terminus of GFP). After transient expression in Arabidopsis protoplasts, the protoplasts were cultured in the dark for 16 h. Irradiation with a laser confocal microscope (Zeiss, LSM780) produced a green fluorescence signal, allowing for protein localization and photographic observation. The results are as follows: Figure 3 As shown, the empty vector plasmid was distributed throughout the cell, and the GmCIPK3:GFP fusion protein was distributed throughout the cell, indicating that GmCIPK3 may function in the nucleus and cytoplasm.

[0026] Example 2 (1) Construction of plant expression vectors The overexpression vector used in this study was driven by the cauliflower mosaic virus (CaMV) 35S promoter. The overexpression vector pBA002 was double-digested with MIUI I and Sac I at 37°C for 120 min, followed by product purification. The soybean cultivar with a complete coding region of 1326 bp, which was cloned in Example 1, was used. GmCIPK3 The CDS sequence of the gene was amplified by PCR using a high-fidelity enzyme.

[0027] upstream primer GmCIPK3 -F: CGCGCCGGGCCCAGGCCTACGCGTATGAGTCAGCCT (SEQ ID NO.11); downstream primer GmCIPK3 -R: ATCGGGGAAATTCGAGCTCTCACTTTGTTTCTCGCA (SEQ ID NO.12). The PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 72℃ extension for 1 minute, for a total of 35 cycles, followed by incubation at 72℃ for 5 minutes, and then isothermal at 4℃. The PCR products were then recovered from the gel and sequenced. Homologous recombination was used to identify correctly sequenced genes containing enzyme-digested adapters. GmCIPK3 The CDS sequence was cloned into the double-digested pBA002 vector. The ligation product was transformed into E. coli competent cells DH5α, and the resulting single colonies were sequenced to determine whether the vector ligation was successful. The plasmid with successful sequencing was named pBA002- GmCIPK3 Plasmid pBA002- was extracted from the successfully sequenced bacterial culture. GmCIPK3 The vector was then transferred into Agrobacterium tumefaciens strain EHA105 using a freeze-thaw method for later use.

[0028] (2) Obtaining transgenic plants containing pBA002- GmCIPK3 The Agrobacterium tumefaciens strain EHA105 was used to genetically transform the soybean recipient variety Tianlong through Agrobacterium tumefaciens-mediated transformation. The overexpression of the pBA002 vector, containing a 35S promoter, a NOS terminator, and a BAR marker gene, was performed. The BAR marker gene was used to identify the positive BAR test strips in the obtained transgenic plants. Figure 4 Simultaneously, the expression level of the target gene in positive transgenic soybean plants was analyzed by qRT-PCR. Soybean constitutively expressed Tubulin was used as an internal reference. Primer sequences are shown in SEQ ID NO. 5 and SEQ ID NO. 6, and real-time quantitative qPCR primer sequences are shown in SEQ ID NO. 7 and SEQ ID NO. 8. Detection... GmCIPK3Changes in gene expression levels in overexpression transgenic lines. Overexpression plants that tested positive with screening strips and showed significantly increased expression of the target gene GmCIPK3 were used for multigenerational propagation in a greenhouse (25℃, 12 h light / 12 h dark) for subsequent phenotypic studies on T2 generation overexpression transgenic soybean seeds.

[0029] The specific steps of Agrobacterium tumefaciens-mediated soybean genetic transformation are as follows: 1) Preparation of bacterial culture: The bacterial culture containing GmCIPK3-Cas9 vector, stored at -80℃, was streaked onto YEB solid medium containing 50µg / mL Rif and 50µg / mL Kana. It was incubated at 28℃ for approximately 2 days. Half of the bacterial line was picked and placed into 60mL of YEB liquid medium containing Rif and Kana, and incubated at 28℃ for approximately 14 hours using a shaker at 80rpm. OD600 =0.6-0.8, transfer the bacterial culture to a new 50mL sterile centrifuge tube. Centrifuge at 5000rpm for 10min. Discard the supernatant, then add an appropriate amount of CCM resuspending solution to adjust the OD. 600 Once the concentration reaches 0.4-0.5, it can be used for subsequent infection.

[0030] 2) Selection and sterilization of soybean seeds: First, select Tianlong seeds that are plump, smooth, intact, and free from disease and insect spots. Place 80 soybean seeds per dish and put the dish into a glass desiccator. Add sodium hypochlorite solution to concentrated hydrochloric acid in a 10:1 ratio to the beaker, quickly cover with the desiccator, and allow the chlorine gas generated inside to thoroughly sterilize the soybean seeds. After 6 hours of sterilization, cover the dish, remove it, and place it in a clean bench for about 40 minutes to completely remove any residual chlorine gas. Insert the seeds into SG4 medium, seal the dish with sterile tape, and place it in the dark for about 14 hours to allow for absorption and swelling.

[0031] 3) Genetic transformation and co-culture of soybean cotyledonary nodes: Using a tissue culture scalpel, the imbibed soybean was cut in half along the longitudinal axis from the hilum, dividing the cotyledonary node in two. The seed coat was then removed, and the hypocotyl tip was cut off, leaving approximately 3mm. A few light incisions were made at the cotyledonary node with the scalpel. Finally, the soybean was placed in a resuspended bacterial solution for infection, and immersed at 160 rpm for 40 minutes at 28℃. After infection, the soybean was transferred to CCM solid medium and cultured for 4 days, with the cut side facing down, arranged in a 4-5-5-4 pattern per dish.

[0032] 4) Bud Induction: After 4 days of co-culture, remove the explants, clip or cut off any excessively long radicles, and place them in jars (12-15 dishes per jar). Add approximately 200 mL of water to each jar and wash 4-5 times. Add approximately 150-200 mL of wash culture medium and wash three times, shaking at 160 rpm for 45 minutes at 28℃. Discard the wash culture medium and wash again with water 3-4 times. Wash once more with wash culture medium. Spread the cleaned explants flat on sterile filter paper and blow them in a laminar flow hood for about 40 minutes. Then, insert the explants, cut side up, at a 45° angle into SIM solid medium, arranging them in a 3-4-3 pattern. After 14 days of culture, insert the explants into new SIM solid medium containing 6 mg / L glufosinate in the same manner.

[0033] 5) Stem elongation: After growth on SIM medium, remove the explants, cut off the browned parts and withered leaves, and then make new wounds at the callus tissue. After treatment, insert the explants obliquely into SEM solid medium and culture them in a tissue culture room. Subculture every 14 days until repeated 3-4 times.

[0034] 6) Inducing root growth: When the seedlings in the SEM medium reach a height of 3-5cm, they can be cut off at the base of the stem with sterile scissors and inserted into the RM solid medium. When the roots grow to about 5cm, the soybean seedlings can be transplanted.

[0035] 7) Transplanting and Hardening-off: Transgenic positive plants should contain the resistance selection protein Bar. Use Bar transgenic test strips to detect positive plants. Once confirmed as positive, gently rinse the roots of the seedlings with clean water, then transplant them into plastic cups filled with vermiculite, ensuring a hole is cut at the bottom of the cup, and thoroughly soak them with water. Cover the soybean seedlings with a transparent plastic cup to maintain humidity. Place the soybean seedlings in an artificial incubator (25℃, 16 h light / 8 h dark) for cultivation.

[0036] (3) Phenotypic identification of overexpression transgenic soybean seeds (seed oil content, protein content) The selected overexpression transgenic lines were propagated in a greenhouse and planted in a 1:1 ratio of vermiculite and nutrient soil, grown at 25°C under 12-hour light / 12-hour dark conditions. The growth and development of the overexpression transgenic soybean lines and their phenotypic traits were observed and recorded. Mature T2 generation seeds were harvested, and the oil and protein content of the overexpression transgenic soybean seeds were measured using near-infrared reflectance (NIR) spectroscopy with an NIRS DA1650 analyzer (Perten Instruments, Sweden). The results showed that compared with the recipient soybean seed Tianlong, the protein content of all seven overexpression lines was increased, by approximately 4.05%–6.12%, with the overexpression line OE-36 showing the largest increase (6.12%). The oil content of the six overexpression lines was decreased, by approximately 1.07%–4.75%, with the overexpression line OE-25 showing the largest decrease (4.75%). This indicates that the gene can be introduced into soybean plants as a target gene, improving the protein composition of soybean grains and enhancing seed quality. Figure 6 , Figure 7 ).

Claims

1. Soybean GmCIPK3 protein encoding gene GmCIPK3 Application of genetic engineering in increasing soybean seed protein content and improving soybean seed protein quality phenotype; the soybean GmCIPK3 protein encoding gene. GmCIPK3 The nucleotide sequence is shown in SEQ ID NO.

1.

2. Contains the soybean GmCIPK3 protein encoding gene. GmCIPK3 The application of the recombinant expression vector in improving soybean seed protein content and quality through genetic engineering; the soybean GmCIPK3 protein encoding gene described herein. GmCIPK3 The nucleotide sequence is shown in SEQ ID NO. 1.

Images