Application of rice OsNAR1 gene or protein coded by rice OsNAR1 gene in regulation and control of resistance of rice to magnaporthe oryzae

Abstract

The invention discloses application of a rice OsNAR1 gene or a protein coded by the rice OsNAR1 gene to regulation and control of resistance of rice to pyricularia oryzae, and relates to the technical field of prevention and control of pyricularia oryzae. The CDS nucleotide sequence of the rice OsNAR1 gene is as shown in SEQ ID No. 2. Research finds that the rice gene OsNAR1 plays an important role in the rice blast resistance process of rice, the number of disease spots on leaves of a gene deletion mutant is smaller, the gene can be used for screening to obtain rice blast bacteria resistant rice strains, the expression quantity of basic resistance marker genes in the gene deletion mutant is remarkably increased, and the expression quantity of the basic resistance marker genes in the gene deletion mutant is remarkably increased. The expression of the basic resistance gene is negatively regulated by the OsNAR1, and the rice blast can be prevented and controlled.

Description

Technical Field

[0001] This invention relates to the field of rice blast control technology, and particularly to rice OsNAR1 Application of genes or their encoded proteins in regulating rice resistance to rice blast fungus. Background Technology

[0002] Rice is a staple food source for more than half the world's population, and its stable production is directly related to global food security. Rice blast is caused by a fungus. Magnaportheoryzae Rice blast is a serious disease that can occur at different stages and parts of rice growth and development, mainly manifesting as leaf blast, neck blast, and grain blast. The rice blast fungus primarily reproduces asexually in the field and completes its infection cycle, impacting rice production worldwide.

[0003] Currently, little is known about novel agents for the effective control of rice blast. However, by utilizing disease-resistance genes, the resistance of rice varieties to this pathogen can be significantly enhanced, thereby reducing yield losses caused by rice blast. For example, patent applications with publication numbers CN115109797A and CN115109786A both utilize disease-resistance genes to improve rice's resistance to rice blast fungus. Discovering and applying disease-resistance genes to improve rice's resistance to rice blast has significant practical implications in agricultural production and is particularly important for addressing potential future challenges.

[0004] Iron-sulfur clusters (Fe-S clusters) are a class of important cofactors ubiquitous in organisms, participating in the function of key enzymes and proteins in various life processes. They mainly exist in two forms: [2Fe-2S] and [4Fe-4S], playing indispensable roles in multiple biological processes such as electron transport, gene expression regulation, and environmental sensing. The synthesis of iron-sulfur clusters is a complex and finely regulated process involving multiple steps and specific proteins. Nar1 is an iron / sulfur (Fe / S) protein, and cell biology and biochemistry studies have identified two magnetically coupled [4Fe–4S] clusters in Nar1 of yeast and plants. The assembly of the C-terminal Fe / S cluster in yeast Nar1 depends on the N-terminal cluster. The absence of Nar1 severely affects the maturation of all studied cytoplasmic and nuclear Fe / S proteins, while mitochondrial Fe / S proteins are unaffected. Similar results have recently been obtained in the human Nar1 homolog IOP1 and Chlamydomonas Nar1. In Arabidopsis thaliana, NAR1 is essential for the function of both the gametophyte and zygote. In the female gametophyte, NAR1 is essential for the transcriptional activation of certain imprinted genes and for appropriate abiotic stress responses in vegetative tissues. However, the biological function of NAR1 in rice remains unclear. Summary of the Invention

[0005] This invention has discovered that rice OsNAR1 The gene is associated with the immune response of rice to rice blast, and overexpression of it is important to understand its significance. OsNAR1 After gene deletion, rice's defense against rice blast fungus is reduced; while knockout or silencing... OsNAR1 Genes can enhance rice's resistance to rice blast fungus, and basic resistance marker genes... OsKS4 and OsPR1A The expression levels were significantly upregulated in knockout plants, and it can be used as a drug to control rice blast.

[0006] The technical solution of the present invention is as follows: This invention provides rice OsNAR1 The application of genes or their encoded proteins in regulating resistance to rice blast fungus, wherein the rice OsNAR1 The CDS nucleotide sequence of the gene is shown in SEQ ID No. 2, rice. OsNAR1 The amino acid sequence of the gene or the protein it encodes is shown in SEQ ID No. 1.

[0007] This invention also provides rice OsNAR1 The application of genes or their encoded proteins in the preparation of drugs against rice blast fungus, rice OsNAR1 The nucleotide sequence of the gene CDS is shown in SEQ ID No. 2, rice. OsNAR1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 1.

[0008] Compared with the expression levels of markers in the wild type, the expression levels of basal resistance marker genes OsKS4 and OsPR1A Knocking out the plant ( Osnar1-3 , Osnar1-17 The expression levels of OsNAR1 were significantly upregulated, indicating that OsNAR1 negatively regulates the expression of basal resistance genes.

[0009] This invention also provides a method for regulating the resistance of rice to rice blast fungus. When it is necessary to reduce the resistance of rice to rice blast fungus, the method involves adding ingredients from rice... OsNAR1 Gene overexpression; when it is necessary to improve the resistance of rice to rice blast fungus, the gene overexpression in rice is... OsNAR1 Gene silencing or knockout; rice OsNAR1 The nucleotide sequence of the gene CDS is shown in SEQ ID No. 2.

[0010] This invention also provides rice OsNAR1 The application of genes in rice breeding involves selecting silent or knockout rice varieties. OsNAR1 Rice plants that have been genetically modified to obtain rice lines resistant to rice blast fungus, rice OsNAR1The CDS nucleotide sequence of the gene is shown as SEQ ID No. 2.

[0011] and rice OsNAR1 The application of the protein coded by the gene in rice breeding is to screen rice OsNAR1 The rice plant with low or no expression of the protein coded by the gene obtains a rice strain resistant to Magnaporthe oryzae, and the rice OsNAR1 The amino acid sequence of the protein coded by the gene is shown as SEQ ID No. 1.

[0012] The application further provides an anti-Magnaporthe oryzae medicine, and the active ingredient comprises a nucleic acid molecule with the nucleotide sequence shown as SEQ ID No. 3 for knocking out or silencing the gene of rice OsNAR1 The CDS nucleotide sequence of the gene is shown as SEQ ID No. 2.

[0013] The application further provides the application of the anti-Magnaporthe oryzae medicine in preventing and treating Magnaporthe oryzae infection.

[0014] The application further provides a transgenic rice resistant to Magnaporthe oryzae, and the gene of rice OsNAR1 is silenced or knocked out, and the rice OsNAR1 The CDS nucleotide sequence of the gene is shown as SEQ ID No. 2.

[0015] The specific method for constructing the transgenic rice resistant to Magnaporthe oryzae comprises the following steps. (1) constructing a gene silencing or knocking out vector, wherein the gene silencing or knocking out vector is a plant expression vector with a sequence for silencing or knocking out the gene; OsNAR1 (2) introducing the gene silencing or knocking out vector in step (1) into the cells of the strawberry to silence or knock out the gene, and culturing the transgenic rice plant. OsNAR1 (3) obtaining the transgenic rice plant resistant to Magnaporthe oryzae.

[0016] Preferably, the target sequence for the gene knockout is shown as SEQ ID No. 3.

[0017] The application finds that the gene of rice OsNAR1 plays an important role in the process of rice resistance to Magnaporthe oryzae, the number of lesions on the leaves of the gene deletion mutant is less, the gene can be used for screening to obtain a rice strain resistant to Magnaporthe oryzae, and the expression amount of the basic resistance marker gene in the gene deletion mutant is significantly up-regulated, indicating that OsNAR1 negatively regulates the expression of the basic resistance gene, and can be used for preventing and treating rice blast. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 to detect the expression amount of the gene in the transformed plant by quantitative PCR. OsNAR1

[0019] ​​Figure 2 The results of OsNAR1 in rice blast resistance; wherein A is the lesion situation on the leaves of plants of different treatments; B is the lesion area on the leaves of plants of different treatments; C is the detection results of fungal biomass in the leaves of plants of different treatments.

[0020] Figure 3 The results of OsNAR1 negative regulation of rice basal resistance; wherein A is the basal resistance marker gene OsKS4 The expression level of knockout plants; B is the basal resistance marker gene OsPR1A The expression level of knockout plants; wherein * indicates p<0.05. DETAILED DESCRIPTION

[0021] Example 1 Rice OsNAR1 Obtaining of gene knockout mutants.

[0022] Using the amino acid sequence of Arabidopsis thaliana NAR1, the homologous protein OsNAR1 was identified by BLASTP in the rice genome database. The amino acid sequence of rice OsNAR1 protein is shown as SEQ ID No. 1. The gene sequence (CDS sequence) of the gene is shown as SEQ ID No. 2. We obtained the knockout mutants of the target gene by CRISPR / Cas9 technology, thereby obtaining OsNAR1 the knockout mutants of the target gene. OsNAR1

[0023] The construction steps of the knockout vector are as follows: (1) First, according to the gene number of OsNAR1, download its reference sequence in Nipponbare “https: / / rice.uga.edu / cgi-bin / ORF_infopage.cgi?orf=LOC_Os03g53750”, determine the target site (coding sequence is AGTGAGCACAAATCCTCCAGAGG) and design the adapter primers OsNAR1cas9-F / R. The primer sequences are as follows: OsNAR1 OsNAR1cas9-F: GTGAGCACAAATCCTCCAGGTTTTAGAGCTAGAAAT; OsNAR1cas9-R: CTGGAGGATTTGTGCTCACTGCCACGGATCATCTG; (2) gRNA expression cassette amplification (two rounds of nested PCR amplification): The PCR reaction system is as follows: ​​The sequence of the first round of PCR amplification primer U-F / gRNA-R is as follows: U-F: 5'-CTCCGTTTTACCTGTGGAATCG-3'; gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

[0024] The first round of PCR amplification reaction conditions are shown in Table 1: Table 1 After amplification, the product obtained by the first round of amplification is diluted 10 times as a template for the second round of amplification.

[0025] The second round of PCR amplification reaction system is as follows: The sequence of the second round of PCR amplification primer is as follows: Uctcg-B1': 5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3'; gRcggt-BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3'.

[0026] The second round of PCR amplification reaction conditions are shown in Table 2: Table 2 After amplification, the product is electrophoresed, and the second round of amplification product is purified and its concentration is determined.

[0027] (3) Cutting and connecting simultaneously: About 20 ng of the purified product in step (2) is taken, and about 20 ng of uncut pYLCRISPR / Cas9 -MH plasmid is added, and 10 U of I enzyme is used in a 15 μL reaction system for 10 min of enzyme cutting at 37°C. Bsa

[0028] After enzyme cutting, 1.5 μL of 10x T4 ligase buffer and 35 U of T4 ligase are added to the system, and the PCR reaction system is shown in Table 3: Table 3 The plasmid after ligation is transformed into E. coli by a heat shock method E.coli , and positive clones are selected for detection. After sequencing, the plasmid is sent to Wuhan Boyuan Biotechnology Co., Ltd. for callus transformation, and TP309 strain is used as a background to obtain rice OsNAR1 ​Knockout mutants Osnar1 The DNA sequence around the target site of the transformed plants was amplified by PCR and confirmed as knockout mutants after sequencing Osnar1 -3 and Osnar1 -17.

[0029] Example 2 Rice OsNAR1 Obtaining of overexpression plants.

[0030] By primer amplification OsNAR1 The genomic sequence before the start codon to the stop codon was ligated to the pCAMBIA1390 vector, and the Ubi promoter was used to drive the overexpression of OsNAR1. The constructed vector was transformed into wild-type rice TP309, and the total RNA of the transformed plants was extracted and reverse transcribed, followed by quantitative PCR detection of the expression level of OsNAR1 , and the overexpression plants OsNAR1-OE-4 and OsNAR1-OE-12 were determined as overexpression plants Figure 1 ).

[0031] The primer sequences are as follows: OsNAR1-OX-F: gta ctt ctc tgc act agg tac cat ggc gtc gtc gtc gtc g, OsNAR1-OX-R: tct tag aat tcc cgg gga tcc tca cca att ctg caa ctg cg.

[0032] Example 3 Spray inoculation of rice OsNAR1 knockout mutants and overexpression mutant plants.

[0033] In order to clarify the role of OsNAR1 in rice blast resistance, we inoculated wild-type rice TP309, gene deletion mutant Osnar1 and overexpression plant OsNAR1-OE by spray inoculation.

[0034] The specific steps are as follows: the rice blast fungus was cultured on tomato oat medium for 7 days, and the conidia of the rice blast fungus were collected, and the concentration was adjusted to 1 x 10 6 / mL. The spore solution was sprayed on the rice seedlings cultured to 4 leaf stage, and after 2 days of dark treatment, it was placed in a culture box with 12 hours of darkness / 12 hours of light alternation. After 5 days of treatment, the lesion on the leaf was observed.

[0035] The experimental results show that, compared with wild-type TP309, the gene deletion mutant Osnar1Fewer lesions were observed on the leaves of plants expressing OsNAR1-OE, while more lesions were observed on the leaves of plants expressing OsNAR1-OE. The lesion area statistics were consistent with the observations. Figure 2 A). Further analysis of fungal biomass in the leaves yielded results consistent with the lesion statistics. Figure 2 B), the above results indicate that OsNAR1 negatively regulates rice blast resistance.

[0036] Example 4 OsNAR1 Negative regulation of basic resistance in rice.

[0037] To investigate the genes that negatively regulate rice blast resistance using OsNAR1, we compared wild-type plants TP309 and... OsNAR1 Expression of disease resistance genes in gene deletion mutant plants.

[0038] The specific experimental steps are as follows: First, inoculate with TP309 rice seedlings that are four weeks old. Osnar1 -3 and Osnar1 -17 plants were inoculated, and total RNA was extracted from leaves 12 hours later and reverse transcribed. Genes of basic resistance markers were detected by qPCR. OsKS4 (LOC_Os04g10060) and OsPR1A The expression level of (LOC_Os07g03710) in rice OsUbiquitin Gene expression levels are used as internal controls.

[0039] The primer sequences are as follows: OsKS4-F:TTTGAGGTCTTTAGCGACAGAT, OsKS4-R: TATAGTTGGTCCCAATGCGAAT; OsPR1A-F:GGCCAATCTCCCTACTGATTAA, OsPR1A-R:GCATAAACACGTAGCATAGCAT; OsUbiquitin-F:AAGAAGCTGAAGCATCCAGC, OsUbiquitin-R: CCAGGACAAGATGATCTGCC.

[0040] Analysis of the experimental results revealed that, compared with the expression levels of markers in the wild type, the expression levels of basal resistance marker genes were significantly lower. OsKS4 and OsPR1A exist Osnar1 -3 and Osnar1 The expression level was significantly upregulated in all -17 plants. Figure 3 This indicates that OsNAR1 negatively regulates the expression of basal resistance genes.

Claims

1. Rice OsNAR1 The application of genes or their encoded proteins in regulating resistance to rice blast fungus, wherein the rice OsNAR1 The CDS nucleotide sequence of the gene is shown in SEQ ID No. 2, rice. OsNAR1 The amino acid sequence of the gene or the protein it encodes is shown in SEQ ID No.

1.

2. Rice OsNAR1 The gene or the protein coded by the gene is used for preparing a medicine against Magnaporthe grisea. OsNAR1 The CDS nucleotide sequence of the gene is shown as SEQ ID No.

2. OsNAR1 The amino acid sequence of the protein coded by the gene is shown as SEQ ID No.

1.

3. A method for modulating resistance of rice to Magnaporthe grisea, characterized by, When it is needed to reduce the resistance of rice to Magnaporthe grisea, the gene in rice is overexpressed; when it is needed to increase the resistance of rice to Magnaporthe grisea, the gene in rice is silenced or knocked out. OsNAR1 OsNAR1 The CDS nucleotide sequence of the gene in rice is shown as SEQ ID No.

2. OsNAR1 The CDS nucleotide sequence of the gene in rice is shown as SEQ ID No. 2.​ 4. Oryza sativa OsNAR1 The application of the gene in rice breeding, by screening rice plants with silenced or knocked-out rice OsNAR1 The application of the gene in rice breeding, by screening rice plants with silenced or knocked-out rice OsNAR1 The CDS nucleotide sequence of the gene is shown as SEQ ID No.

2.

5. Oryza sativa OsNAR1 application of the protein encoded by the gene to rice breeding, by screening rice plants OsNAR1 obtaining a rice strain resistant to Magnaporthe grisea from a rice plant in which the protein encoded by the gene is expressed at a low level or not expressed, rice OsNAR1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

1.

6. An anti-Magnaporthe grisea agent, characterized by comprising the compound of claim 1. The active ingredients include nucleic acid molecules having the nucleotide sequence shown as SEQ ID No. 3 for knocking out or silencing the water rice OsNAR1 gene.

7. The anti-Magnaporthe grisea medicament of claim 6 for use in the prevention and treatment of Magnaporthe grisea infection in rice.

8. A method for constructing transgenic rice resistant to rice blast fungus, characterized in that, Silencing or knocking out the gene in rice OsNAR1 The CDS nucleotide sequence of the gene in rice is shown as SEQ ID No.

2. OsNAR1 The CDS nucleotide sequence of the gene in rice is shown as SEQ ID No.

2.

9. The method for constructing transgenic rice resistant to rice blast fungus as described in claim 8, characterized in that, comprising the steps of: (1) constructing a gene silencing or knock-out vector, which is a plant expression vector with a sequence for silencing or knocking out a gene; OsNAR1 a gene; (2) introducing the gene silencing or knock-out vector of step (1) into the cells of the strawberry to obtain OsNAR1 gene silencing or knock-out, and culturing the transgenic rice plant.

10. The method for constructing transgenic rice resistant to rice blast fungus as described in claim 9, characterized in that, The target sequence for the gene knockout is shown as SEQ ID No. 3.

Images