Application of BnaPDS5D gene in regulation and control of oil content of rape

Abstract

The invention discloses application of a BnaPDS5D gene in regulation and control of the oil content of rape, and belongs to the technical field of gene engineering and biology. The invention further discloses a method for increasing the oil content of the oilseed rape. A CRISPR / Cas9 gene editing vector of the BnaPDS5D gene is transformed into a genome of the rape by using an agrobacterium-mediated genetic transformation method, a rape variety with gene function deletion is obtained by using a CRISPR / Cas9 gene editing technology, and the accumulation of the oil content of the rape is negatively regulated by the BnaPDS5D gene by measuring the oil content of a mutant material. The oil content of the mutant material is obviously increased compared with that of a wild type. According to the invention, more gene editing targets are provided for creating high-oil-content rape varieties, and meanwhile, important technical support is also provided for developing BnaPDS5D gene function research.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and biotechnology, and relates to... BnaPDS5D The present invention relates to the application of genes in regulating the oil content of rapeseed, and also to a method for increasing the oil content of rapeseed. Background Technology

[0002] Brassica napus L., a globally important oilseed crop, plays a crucial role in edible oil supply and industrial raw materials. According to the Food and Agriculture Organization of the United Nations (FAO, 2024), global annual rapeseed oil production exceeds 30 million tons, accounting for more than 20% of total edible vegetable oil production. Oil content is the most important quality trait of Brassica napus. In organisms, the first step in fatty acid synthesis is the carboxylation of acetyl-CoA by acetyl-CoA carboxylase (ACCase) to malonyl-CoA. Then, fatty acid synthases use malonyl-CoA as a substrate, adding two carbons in each cycle to synthesize an acyl carbon chain until a 16- to 18-carbon saturated fatty acid is synthesized. In the field of genetic engineering, past research has focused on key enzymes (such as acetyl-CoA carboxylase and glycerol-3-phosphoacyltransferase) or transcription factors (such as WRI1, LEC1, and FUS3) that regulate the lipid synthesis pathway. For example, overexpression of WRI1 can activate genes related to fatty acid synthesis, which can increase the oil content of rapeseed seeds by 5% to 8%.

[0003] Existing research on the mutation effects of some conserved genes in Brassica napus is still insufficient. Discovering genes that can specifically increase the oil content of Brassica napus seeds and elucidating their mechanisms of action are of great practical significance for breaking through existing technological bottlenecks and breeding new varieties of rapeseed with high oil content.

[0004] In Arabidopsis thaliana, AT1G80810 has been identified as one of five Precocious Dissociation of Sisters 5 (PDS5) genes (Pradillo et al., 2015). PDS5 family genes are widely distributed in eukaryotes and play a crucial role in controlling the adhesion loops responsible for proper chromosome segregation during chromosome separation in vertebrates and yeast (Mirkovic and Oliveira, 2017; Misulovin et al., 2018; Tong and Skibbens, 2014). Single-gene knockout of three of the five PDS5 genes (including PDS5D) in Arabidopsis thaliana did not significantly reduce overall growth rate or seed yield (Pradillo et al., 2015). However, double, triple, and quadruple mutants showed significantly reduced seed yield, but the effect of PDS5D in multiple mutations was not significant, suggesting that the function of the PDS5D gene may differ from other PDS5 genes (Pradillo et al., 2015). Compared to other species, PDS5 plays a relatively minor role in Arabidopsis cell division. In Saccharomyces cerevisiae, different PDS5 mutants exhibit varying defects in chromosome adhesion. The PDS5-1 and PDS5-101 mutants can load DNA into the adhesion loop but fail to maintain adhesion between sister chromatids; while the PDS5-99 mutant has problems loading chromosomes into the adhesion loop, but once successful, it can maintain adhesion (Chan et al., 2013; Hartman et al., 2000; Paniza et al., 2000; Tong and Skibbens, 2014). This suggests that the PDS5 gene plays a specific role at different stages of chromosome adhesion in yeast.

[0005] Furthermore, the adhesion complex not only acts on the centromere but also binds to chromosome arms to participate in homologous pairing, regulating homologous recombination (HR) and double-strand break (DSB) repair in Arabidopsis and other organisms. During meiosis, it can assist in DSB repair during synapsis and recombination. PDS5 regulators are also involved in post-replication chromosome condensation; related interacting factors (such as Mcd1p, which promotes condensation, and Wpl1p, which inhibits condensation) have been found in yeast, but their regulatory mechanisms remain unclear. Summary of the Invention

[0006] The purpose of this invention is to provide a method for increasing the oil content of rapeseed, which involves knocking out a sister chromatid cohesion protein cofactor. BnaPDS5D This invention not only provides more gene editing targets for creating rapeseed varieties with high oil content, but also facilitates the development of... BnaPDS5D Gene function research, especially on the regulatory mechanism of oil content in rapeseed, has provided important technical support.

[0007] BnaPDS5D The gene's function is closely related to lipid droplet formation and lipid storage processes, and its encoded product plays a role in lipid accumulation. This gene is located on chromosomes C06 (BnaC06G0468700WE), A07 (BnaA07G0370600WE), A07 (BnaA07G0220800WE), and C06 (BnaC06G0273000WE) of Brassica napus, and is named accordingly. BnaC06.PDS5D, BnaA07.PDS5D, BnaA07.PDS5D-1, BnaC06.PDS5D-1 The nucleotide sequences of the gene are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively, and consist of 2880-3351 bp.

[0008] When obtaining mutants of the gene, Agrobacterium-mediated genetic transformation is used. BnaPDS5D The CRISPR / Cas9 gene editing vector was transformed into the rapeseed genome, and the gene was obtained using CRISPR / Cas9 gene editing technology. BnaPDS5D Rapeseed varieties with functional deficiencies.

[0009] Among them, the BnaPDS5D The method for constructing CRISPR / Cas9 gene editing vectors includes the following steps: 1) Screen gene editing targets and design primers based on the gene sequence; 2) Using pCBC-DT1T2 plasmid as a template, PCR amplification was performed using the designed primers; 3) The PCR product was ligated with pKSE401 plasmid by enzyme digestion; 4) Transform E. coli competent cells, screen for positive clones and sequence them. The vector with correct sequencing is the... BnaPDS5D CRISPR / Cas9 gene editing vectors.

[0010] Furthermore, the sequences of the gene editing target sites are: sgRNA1: ACTGTTTTTGAAACTCCCAAGG; sgRNA2: GAGCGTGTTGCATTGACAAGGG.

[0011] Furthermore, the primer sequence is as follows: DT1-BsF: ATATATGGTCTCGATTGACTGTTTTTGAAACTCCCAGTT DT1-F0: TGACTGTTTTTGAAACTCCCAGTTTTAGAGCTAGAAATAGC DT2-R0: AACTTGTCAATGCAACACGCTCCAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAACTTGTCAATGCAACACGCTCCAA.

[0012] Next, by measuring the oil content of the mutant material, it was found that... BnaPDS5D The gene negatively regulates the accumulation of oil content in rapeseed, and the oil content of the mutant material is significantly higher than that of the wild type.

[0013] The beneficial effects of this invention are: This invention provides more gene editing targets for creating rapeseed varieties with high oil content, which is beneficial to improving the efficiency of new rapeseed germplasm creation and breeding, and reducing production costs.

[0014] This invention has been preliminarily verified through a function loss test. BnaPDS5D The gene function was analyzed, confirming that this gene plays an indispensable role in regulating the oil content of rapeseed, thus providing a basis for further research. BnaPDS5D Gene regulatory mechanisms provide important technical support. Attached Figure Description

[0015] Figure 1 The CRISPR / Cas9 system was presented. BnaPDS5 Gene editing effectiveness. The designed sgRNA1 targeting gene. BnaC06.PDS5D and BnaA07.PDS5D sgRNA2 target genes BnaA07.PDS5D-1 and BnaC06.PDS5D-1 The mutation was successfully induced. Compared to the wild-type reference sequence (Reference1, Reference2), in CR4, BnaA07.PDS5D-1 A -5bp deletion occurred, while three other homologous genes showed +1bp insertions; in CR5, BnaC06.PDS5D , BnaA07.PDS5D A -2bp deletion occurred. BnaC06.PDS5D-1 , BnaA07.PDS5D-1 -2bp and -6bp deletions were observed, respectively.

[0016] Figure 2 This paper presents the observation results of lipid droplets in gene-edited rapeseed leaves. The lipid droplets in the rapeseed leaves were subjected to BODIPY staining and photographed using a laser lamina confocal microscope. The number of lipid droplets in each microscopic image was counted. The results showed that the number of lipid droplets in the two mutants (CR4 and CR5) was greater than that in the wild type (WT). Each line contained three different individuals, and a total of 12 images (193μm*193μm) were obtained. * indicates that the images were obtained in Student's t-test. P<0.05. Detailed Implementation

[0017] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods not described in detail in the following embodiments are generally performed according to conventional methods or methods described in the reference book "Molecular Cloning: A Laboratory Guide" (New York: Cold Spring Harbor Laboratory, 1989), or according to the methods recommended in the manufacturer's operating manual.

[0018] Example 1: BnaPDS5D- Construction of CRISPR vectors Creating rapeseed using the sgRNA-Cas9 system developed by Chen Qijun's team at the College of Biological Sciences, China Agricultural University BnaPDS5D Mutants. The experimental procedures are as follows: (1) Log in to the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html Screening for target genes sgRNA1: ACTGTTTTTGAAACTCCCAAGG and sgRNA2: GAGCGTGTTGCATTGACAAGGG. sgRNA1 targets specific genes. BnaC06.PDS5D and BnaA07.PDS5D It is located on the fourth exon of both genes. sgRNA2 targets genes. BnaC06.PDS5D-1 and BnaA07.PDS5D-1 It is located on the second exon of these two genes.

[0019] The first 19-nt target sequence was designed as primer DT1-F0 / DT1-BsF; the complementary sequence of the other 19-nt target was designed as primer DT2-R0 / DT2BsR.

[0020] (2) Design primers DT1-BsF: ATATATGGTCTCGATTGACTGTTTTTGAAACTCCCAGTT DT1-F0: TGACTGTTTTTGAAACTCCCAGTTTTAGAGCTAGAAATAGC DT2-R0: AACTTGTCAATGCAACACGCTC CAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAACTTGTCAATGCAACACGCTCCAA (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. DT1–BsF and DT2-BsR were at normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20-fold. The amplification system was as follows: 2×I-5™ 2×High-Fidelity Master Mix 25μL DT1-BsF (10 μmol / L) 2 μL DT2-BsR (10 μmol / L) 2 μL DT1-F (0.5 μmol / L) 2 μL DT2-R0 (0.5 μmol / L) 2 μL 3 μL of pCBC-DT1T2 plasmid ddH2O 14μL PCR amplification program: 98℃ total denaturation for 1 min; 98℃ denaturation for 15 sec, 56℃ annealing for 25 sec, 72℃ extension for 25 sec, 34 circles; 72℃ total extension for 5 min.

[0021] (4) Purify and recover the PCR product, and establish the following restriction-ligation system: PCR fragment 2μL pKSE4012μL 10×NEB T4 Buffer 1.5μL 10×BSA 1.5μL BsaI (NEB) 1μL T4Ligase (NEB) / High concentration 1μL ddH2O 6μL Reaction conditions: 5 hours at 37℃, 5 minutes at 50℃, 10 minutes at 80℃.

[0022] (5) Transformation of *E. coli* DH5α: Transform 5 μL of *E. coli* competent cells, screen using Kans plate, identify positive clones by PCR and sequence them. The correctly sequenced vector is the... BnaPDS5D CRISPR vectors.

[0023] (6) The correctly constructed recombinant plasmid vector was introduced into Agrobacterium strain GV3101, and positive single clones were selected and stored at -80℃. The introduction method is as follows: a. Cleaning the electric rotary cup: First wash with pure water, then wash with ultrapure water, discard the water, then wash with anhydrous ethanol (use a 1ml pipette tip to blow and rinse), discard the anhydrous ethanol, and place it on a clean bench to air dry; b. Take 20 μl of Agrobacterium competent cells GV3101; c. Take 0.8 μl of the correctly constructed recombinant plasmid and add it to 20 μl of competent cells. Gently aspirate and mix to avoid generating air bubbles. d. Place the washed and dried electric rotary cup in ice to pre-cool it, and then pump the above mixture in against the cup wall; e. Adjust the voltage of the electric rotary instrument to 1800V; f. Remove the electric rotary cup from the ice and wipe the outside of the electric rotary cup clean with absorbent paper; g. Place the electric rotary cup into the instrument, press the "push" button twice in succession, and you will hear a "beep" sound after a few seconds, indicating success; h. After successful electroporation, add 400 μl of antibiotic-free LB to the electroporation cup, aspirate a few times, and transfer to a sterile centrifuge tube; i. Activate at 28℃ for about 2 hours, take 100μl and spread it on the plate containing the double antibody, seal it with sealing film, invert it and incubate at 28℃ for 2 days, and then pick up the spots for detection.

[0024] (7) Agrobacterium colony detection Colonies were selected and cultured in double-antibiotic LB medium at 28°C for 2 hours. An appropriate amount of bacterial solution was taken for PCR detection, and the positive Agrobacterium solution was preserved.

[0025] Example 2 Genetic Transformation Experiment (1) Genetic transformation of rapeseed For the built BnaPDS5D - Genetic transformation of rapeseed using CRISPR vectors was performed using Agrobacterium-mediated transformation. The recipient for rapeseed transformation in this invention was Brassica napus (Westar). For detailed operation procedures, please refer to the reference: An efficient Agrobacterium-mediated transformation method using hypocotylas explants for Brassica napus. ① Seeds of the Brassica napus cultivar 'Westar' were sterilized and sown in MS culture boxes and cultured in the dark in a culture room; ② The constructed Agrobacterium-mediated transformation solution expressing the CRISPR / Cas9 gene editing vector was cultured overnight in a shaker at 28°C, the solution was collected, and the hypocotyls were infected; ③ The transformed materials were identified by PCR and planted in an experimental field.

[0026] (2) Identification of CRISPR-transformed single plants CRISPR-transformed rapeseed plants were sequenced and screened for mutants. First, the Cas9 protein was identified using primers Cas9-570-F (5'-AGACCGTGAAGGTTGTGGAC-3') and Cas9-570-R (5'-TAGTGATCTGCCGTGTCTCG-3'). Cas9 protein-positive plants underwent specific amplification of the target gene and sequencing identification.

[0027] The method for specific amplification of the target gene is as follows: specific amplification is performed using primers PDS5D-F (5'-ATCGAACTTGTTAATTTGGTGGAAG-3) and PDS5D-R (5'-CCTTTCTTGATTTTTCATCTATCGC-3'), respectively. BnaC06.PDS5D and BnaA07.PDS5 D; Specific amplification was performed using primers A07.PDS5D-1-F (5'-GGGTTCTACAAATTACGATTAGGG-3') and A07.PDS5D-1-R (5'-TCATTTGATCATCACCGTAAGG-3'), respectively. BnaA07.PDS5D-1 Specific amplification was achieved using primers C06.PDS5D-1-F (5'-CCTCCTTCTTCAACTGACGAGC-3') and C06.PDS5D-1-R (5'-CGAAACATTCGTAGAATGAGGTC-3'). BnaC06.PDS5D-1 .

[0028] The PCR system consisted of: Easy Taq polymerase 0.15 μL, 10 mM dNTP 0.4 μL, 10× buffer 2 μL, DNA template 2 μL, F primer 2 μL, R primer 2 μL, and ddH2O added to a final volume of 20 μL. PCR conditions were: 94℃ total denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, 32 circles; and 72℃ total extension for 5 min.

[0029] The amplified target fragment was sequenced using PCR products, and the sequencing results were analyzed using SnapGene software to determine the editing status of the target sites. The sequencing results showed that... BnaPDS5D Multiple edited mutant independent lines CR4 and CR5 ( Figure 1 ).

[0030] Example 3: Determination of lipids in rapeseed (1) Lipid droplets in rapeseed seedling leaves were photographed using a laser confocal microscopy (CLSM). The lipid droplets in the leaves could be stained with BODIPY. The BODIPY was excited using a 488 nm laser, and the emission signal at 500-540 nm (BODIPY) was collected. The number of lipid droplets in a given microscopic image was counted using the ImageJ software counting function.

[0031] The number of lipid droplets was found to be greater in the two mutant plants than in the wild-type plants. Each spot represents a photomicrograph of the corresponding plant line. Figure 2 ).

[0032] (2) The oil content of rapeseed seeds was determined by near-infrared spectroscopy. Near-infrared spectroscopy was used to analyze the quality of rapeseed seeds harvested at maturity, obtaining data on seed oil content. The instrument was provided by the National Rapeseed Engineering Technology Research Center of Huazhong Agricultural University. Each line consisted of three different individual plants.

[0033] The oil content results showed that the oil content of the receptor background material Westar was 42.90±2.13, while the oil contents of the mutant materials CR4 and CR5 were 45.46±0.85 and 46.00±0.58, respectively. The oil content of the two mutants was significantly higher than that of the wild type by about 2.5-3.1 percentage points (P<0.05).

[0034] (3) Fatty acid analysis was performed on rapeseed seeds harvested at maturity using gas chromatography-flame ionization detector (GC-FID) to obtain seed oil content data. The instrument was provided by the National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University. Each line had 3 different individual plants.

[0035] Oil content results showed that the oil content of the receptor background material Westar was 46.16±1.19, while the oil contents of the mutant materials CR4 and CR5 were 48.60±1.26 and 50.35±1.17, respectively. The oil content of the two mutants was significantly higher than that of the wild type by approximately 2.5-4.2 percentage points (P<0.05). The trends of oil content measurements in rapeseed seeds by near-infrared spectroscopy and gas phase GC-MS were consistent.

[0036] In summary, genes BnaPDS5D It plays an important role in regulating the oil content of rapeseed.

[0037] Appendix: Explanation of the sequence list SEQ ID NO:1: BnaC06.PDS5D The nucleotide sequence of a gene; SEQ ID NO:2: BnaA07.PDS5D The nucleotide sequence of a gene; SEQ ID NO:3: BnaA07.PDS5D-1 The nucleotide sequence of a gene; SEQ ID NO:4: BnaC06.PDS5D-1 The nucleotide sequence of a gene.

Claims

1. A method for increasing the oil content of rapeseed, characterized in that: Using Agrobacterium-mediated genetic transformation to BnaPDS5D A CRISPR / Cas9 gene-editing vector was transformed into the genome of rapeseed, and rapeseed varieties with gene loss of function were obtained using CRISPR / Cas9 gene-editing technology. BnaPDS5D The nucleotide sequence of the gene is shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:

4.

2. The method for increasing the oil content of rapeseed as described in claim 1, characterized in that, The BnaPDS5D The method for constructing CRISPR / Cas9 gene editing vectors includes the following steps: 1) Screen gene editing targets and design primers based on the gene sequence; 2) Using pCBC-DT1T2 plasmid as a template, PCR amplification was performed using the designed primers; 3) The PCR product was ligated with pKSE401 plasmid by enzyme digestion; 4) Transform E. coli competent cells, screen for positive clones and sequence them. The vector with correct sequencing is the... BnaPDS5D CRISPR / Cas9 gene editing vectors.

3. The method for increasing the oil content of rapeseed as described in claim 2, characterized in that: The sequences of the gene editing targets are: sgRNA1: ACTGTTTTTGAAACTCCCAAGG; sgRNA2: GAGCGTGTTGCATTGACAAGGG.

4. The method for increasing the oil content of rapeseed as described in claim 3, characterized in that: The primer sequence is as follows: DT1-BsF: ATATATGGTCTCGATTGACTGTTTTTGAAACTCCCAGTT DT1-F0: TGACTGTTTTTGAAACTCCCAGTTTTAGAGCTAGAAATAGC DT2-R0: AACTTGTCAATGCAACACGCTC CAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAACTTGTCAATGCAACACGCTCCAA.

Images