Application of betula platyphylla BpmiR156C gene in regulating and controlling plant height of betula platyphylla

Abstract

The invention provides application of a white birch BpmiR156C gene in regulating and controlling the plant height of white birch, and belongs to the technical field of plant genetic engineering. The plant height of the white birch is regulated and controlled through high expression of the white birch BpmiR156C gene, the plant height of the white birch is influenced, then forest plants are promoted to cope with biological and abiotic stress, and cultivation of high-quality forest trees is guaranteed.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the birch BpmiR156C gene in regulating the growth rate of birch plants. Background Technology

[0002] Precise regulation of plant height is one of the core objectives of high-yield crop breeding, and miR156 has been extensively studied as a molecular tool. miR156 is a core regulator of the plant age pathway, highly expressed in the juvenile stage and gradually declining with age. Recent studies have shown that the conserved miR156-SPL molecular module, as a core hub of the age pathway, regulates plant height formation at multiple levels by integrating developmental timing signals and environmental responses.

[0003] Its mechanism of action is mainly manifested as follows: In herbaceous plants, miR156 targets the SPL transcription factor, dynamically mediating the synthesis and degradation of cytokinins, auxins, and strigolactones. For example, in switchgrass (Panicum virgatum), overexpression of miR156 leads to upregulation of the CK oxidase gene PvCKX4, degrading cytokinins (iP type), inhibiting stem elongation, and resulting in shorter switchgrass plants. In rice, miR156f overexpression results in short stems and multiple tillers, while inhibition of miR156f (MIM156fOE) increases plant height and reduces tillering in rice (Oryzasativa L.), thus balancing tillering and stem elongation. In addition, in Arabidopsis thaliana, SPL10 promotes anisotropic growth and elongation of basal leaf cells, driving the transformation of young round leaves into mature elliptical leaves, indirectly affecting the overall plant architecture. In potato (Solanum tuberosum), the expression of stu-miR156 in miR156STTM (Short Tandem Target Mimic) transgenic plants was suppressed, while the expression of the target gene SPL9 was upregulated, and the growth and development of the transgenic material were inhibited to some extent.

[0004] In woody plants, the miR156 module can further couple light signals (phyB-PIF) and juvenile transition processes (such as MdSPL14-MdCKX5) to regulate shoot apical dormancy and cell proliferation. In poplar (Populus L.), under short-day conditions, the phytochrome phyB signal decreases, the PIF8 protein inhibits miR156 expression, and SPL16 / 23 is released. SPL16 / 23 directly inhibits the flowering gene FT2 and activates the branching repressor BRC1, promoting apical bud dormancy and halting stem elongation. In apple (Maluspumila Mill), mdm-miR156a decreases, releasing MdSPL14. MdSPL14 interacts with MdWRKY24 to inhibit the cytokinin-degrading enzyme gene MdCKX5, accumulating CK to promote cell proliferation, increasing leaf size, and indirectly increasing apple plant height. This multidimensional, species-specific regulatory network not only elucidates the molecular basis of plant height formation but also provides key targets for designing ideal plant types and overcoming yield bottlenecks. In-depth exploration of the dynamic mechanisms of miR156-SPL's interaction with the environment will become an important direction for future intelligent breeding.

[0005] Currently, research on the miR156 gene is mostly focused on herbaceous plants such as Arabidopsis thaliana and rice. The function of the birch BpmiR156 gene in birch, a perennial woody plant with a relatively long juvenile stage, is still unclear, and the function of the birch BpmiR156C gene in regulating the growth of birch plant height has not been investigated. Summary of the Invention

[0006] The purpose of this invention is to provide an application of the birch BpmiR156C gene in regulating plant height. By regulating the expression of the birch BpmiR156C gene, the plant height of birch plants can be affected, thereby promoting the response of forest plants to biotic and abiotic stresses and ensuring the cultivation of high-quality forest trees.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides an application of the birch BpmiR156C gene in regulating the height of birch plants.

[0009] Preferably, the height of birch trees is increased by overexpressing the birch BpmiR156C gene.

[0010] Preferably, the nucleotide sequence of the BpmiR156C gene is shown in SEQ ID NO.1.

[0011] This invention also provides an application of a recombinant plasmid containing the birch BpmiR156C gene in regulating the growth rate of birch plants.

[0012] Beneficial effects

[0013] The BpmiR156C gene-overexpressing transgenic birch plants provided by this invention can be used to discover downstream regulatory genes and enrich the regulatory pathways of plants in response to abiotic stress. The BpmiR156C gene-overexpressing birch plants obtained in this invention enhance birch plant height and can be used to cultivate high-quality forest trees. Furthermore, the examples also show that the BpmiR156C gene participates in the physiological process of birch plant height development; compared with wild-type plants, the overexpressing lines are significantly taller. Attached Figure Description

[0014] Figure 1 This is an image showing the electrophoresis results of the BpmiR156C gene in Example 1;

[0015] Figure 2 This is a diagram showing the alignment results of pre-miR156c with the predicted sequence in Example 1;

[0016] Figure 3 This is a comparison diagram of the birch BpmiR156C transgenic plant and the wild-type plant in Example 2;

[0017] Figure 4 This is a statistical analysis chart of the plant height of BpmiR156C transgenic plants and wild-type plants in Example 2. Detailed Implementation

[0018] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0019] Example 1

[0020] To obtain the original transcript sequence of pre-miR156c, upstream and downstream sequences of pre-miR156c were searched in the Birch Genome Database. Then, approximately 200 bp flanking sequences were added to both sides of the pre-miR156c sequence to obtain the original transcript pri-miR156c. The amplification primers were designed using Primer 5.0 software as follows:

[0021] pre-miR156cF:5'-GACAATTTAGTACAGGCAC-3'(SEQ ID NO.2)

[0022] pre-miR156cR:5'-GCTAGAGAGAGAATGGTTGC-3'(SEQ ID NO.3)

[0023] The full-length BpmiR156C gene was cloned using primers, and the electrophoresis results are as follows: Figure 1As shown, pre-miR156c is the original transcription. The pre-miR156c sequence is compared with the predicted sequence (e.g., ...). Figure 2 As shown in the figure, the sequence in the box is pre-miR156c.

[0024] The nucleotide sequence of the BpmiR156C gene is shown in SEQ ID NO.1:

[0025] GCAACCATTCTCTCTCTAGCTTTCTGATGCTATATAAAGCGCAACAGACCCTTCATCTCTTCTCACAACAAAAACACAAGCTAGCTTTGCTTCTAAGATCATGAAGCAGGCTGTTGGGGTTTGGGGGAAGATAGAGCAGAAGATCAGTAGCGGCCGCGCCGATCCTAGTTTTTTCTTTTTATGGAAGAGTAATCTCAAGGGTAAGGGAGGTGACAGAAGAGAGTG AGCACACATGGTATTTCTTGCATGCCGTGTTCATGCTTGAATCTCTGCGTGCTTACTCTCTATCTGTCGTCCCCACCACCACCATCTCTCTCTCTCTCTGTAAATTGTTTCCATGCCTTTGTCGAGTGCGTCCATATATGTGTTTGTGTGTGTTAATTAGAAAAAGGGAAGGGGGAATTAGGAAGGGGGACTGGCTGGGTTTAGTTTTATGTGTGCCTGTACTAAATTGTC

[0026] The obtained gene was ligated into the pROKII vector, and then the above expression vector pROKII-miR156C was transformed into birch using the leaf disc transformation method to obtain pROKII-miR156C transgenic birch plants (hereinafter referred to as BpmiR156C in this invention).

[0027] Stem segments with apical buds, 3 cm long, were cut from the top of BpmiR156C transgenic birch tissue culture seedlings and wild-type birch (WT) tissue culture seedlings and inserted into WPM rooting medium for 30 days. The WPM rooting medium system used distilled water as a solvent and included 2.14 g / L WPM powder, 20 g / L sucrose, 0.56 g / L calcium salt, 0.4 mg / L IBA, and 8 g / L plant agar. The pH was adjusted to 5.8 with 5M NaOH and dispensed into 100 mL bottles.

[0028] Transgenic and wild-type tissue culture seedlings grown under normal culture conditions for 30 days were transplanted into a mixture of black soil, vermiculite, and peat moss in a 1:1:1 ratio (Note: the culture medium on the roots of the tissue culture seedlings must be thoroughly rinsed off before transplanting). The seedlings were then cultured indoors until they stabilized (surviving and growing normally after being transplanted from the culture medium to the soil substrate). Once the birch seedlings had stabilized, they were transferred to larger soil pots and moved outdoors (to their natural environment) for further cultivation.

[0029] Example 2

[0030] The birch BpmiR156C transgenic plants and wild-type plants from Example 1 were tracked and observed. The overall growth of the transgenic BpmiR156C plants was observed and statistically analyzed. The birch BpmiR156C transgenic plants and wild-type plants were compared under normal conditions. (e.g.) Figure 3 (As shown).

[0031] Statistical analysis was performed on the plant height of transgenic BpmiR156C plants and wild plants, and the results are as follows: Figure 4 As shown, the BpmiR156C gene overexpression lines are taller than the wild type.

[0032] As can be seen from the above embodiments, the transgenic birch plants overexpressing the BpmiR156C gene, which are involved in the growth of birch plant height, provided by the present invention have significantly increased plant height, that is, enhancing the expression of the BpmiR156C gene in birch plants increases the plant height of birch.

[0033] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of a birch BpmiR156C gene in regulating the growth rate of birch plants.

2. The application as described in claim 1, characterized in that, The height of birch trees was increased by overexpressing the birch BpmiR156C gene.

3. The application as described in claim 1, characterized in that, The nucleotide sequence of the BpmiR156C gene is shown in SEQ ID NO.

1.

4. Application of a recombinant plasmid containing the birch BpmiR156C gene in regulating the growth rate of birch plants.

Images