Application of a reagent for detecting expression of lncRNA markers in preparation of oral squamous cell carcinoma diagnosis product or prognosis judgment product

Abstract

The application provides a kind of reagent for detecting the expression amount of lncRNA marker in the preparation of oral squamous cell carcinoma diagnosis product or prognosis product, it is related to the field of biological medicine.The lncRNA is DPY19L1P1, and its nucleotide sequence is shown as SEQ ID NO.1.The DPY19L1P1 can be used as a tumor molecular marker to design and synthesize specific detection reagent or kit, which is used for early auxiliary diagnosis of clinical oral squamous cell carcinoma, improves the diagnosis efficiency and prognosis efficiency of oral squamous cell carcinoma.The application also provides a kind of reagent for detecting the expression amount of lncRNA-DPY19L1P1 in sample and specific lncRNA-DPY19L1P1 primer and kit.The above-mentioned primer can specifically recognize DPY19L1P1 and detect the expression amount of DPY19L1P1 in tissue.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to application of a reagent for detecting expression of an lncRNA marker in preparation of a diagnosis product or a prognosis judgment product for oral squamous cell carcinoma. BACKGROUND

[0002] Long non-coding RNA (lncRNA) is a kind of endogenous non-coding RNA with a length of more than 200 nucleotides and lacking of complete open reading frame (ORF). Although lncRNA does not directly encode proteins, it plays a key role in gene expression regulation. More and more studies have shown that lncRNA can deeply participate in the occurrence and progression of tumors by regulating chromatin remodeling, transcriptional activity, RNA splicing and stability, and other mechanisms.

[0003] In the field of tumors, lncRNA has been confirmed to be able to affect the biological behaviors such as proliferation, apoptosis, migration and invasion of tumor cells, and also can regulate the expression of tumor-related genes at the epigenetic level. These lncRNAs have the potential to become anti-tumor drug targets and tumor biomarkers, providing new ideas and means for the diagnosis and treatment of cancer.

[0004] Oral squamous cell carcinoma (OSCC) is one of the most common malignant tumors in the head and neck, with high recurrence rate, high metastasis rate and poor prognosis. Although the comprehensive treatment means such as surgery, radiotherapy and chemotherapy are constantly improving, the overall five-year survival rate of OSCC patients is still less than 50%. At present, the molecular mechanism of its occurrence and development has not been fully elucidated.

[0005] In recent years, it has been found that a variety of lncRNAs are abnormally expressed in OSCC, and through interaction with DNA, RNA or protein, they regulate the expression of key cancer genes and tumor suppressor genes, thereby affecting the malignant phenotype of tumor cells. For example, some lncRNAs promote tumor proliferation and metastasis by regulating epigenetic modification or mRNA stability, and others can regulate the tumor immune microenvironment and participate in the drug resistance process.

[0006] Therefore, in-depth study of the mechanism of lncRNA in oral squamous cell carcinoma not only helps to reveal the molecular carcinogenic mechanism of OSCC, but also provides new molecular targets and technical paths for early diagnosis, prognosis evaluation and individualized treatment of the disease. At present, a large number of lncRNAs related to OSCC have not been discovered or systematically verified, and the existing technology still needs to be further improved and expanded. SUMMARY

[0007] In view of the above problems of the prior art, the application provides application of a reagent for detecting expression of an lncRNA marker in preparation of a diagnosis product or a prognosis judgment product for oral squamous cell carcinoma, the lncRNA being DPY19L1P1, which can be used as a marker for diagnosis and prognosis judgment of oral squamous cell carcinoma for specifically detecting oral squamous cell carcinoma.

[0008] To solve the above problems, the application provides the following technical solutions:

[0009] In a first aspect, the application provides application of a reagent for detecting expression of an lncRNA marker in preparation of a diagnosis product or a prognosis judgment product for oral squamous cell carcinoma, the lncRNA being DPY19L1P1, a nucleotide sequence of which is shown as SEQ ID NO. 1.

[0010] The marker DPY19L1P1 can be used for specific high expression in oral squamous cell carcinoma tissues, and does not have such specific high expression in normal tissues, and can be used as a tumor-specific molecular marker to design and synthesize a specific detection reagent or kit, which is used for early auxiliary diagnosis of clinical oral squamous cell carcinoma, and improves diagnosis efficiency and prognosis judgment efficiency of oral squamous cell carcinoma.

[0011] The diagnosis product for oral squamous cell carcinoma includes early diagnosis products, recurrence diagnosis products, and late diagnosis products for oral squamous cell carcinoma, such as a reagent for detecting expression level of DPY19L1P1 by reverse transcription PCR, real-time quantitative PCR, in-situ hybridization, or chip technology.

[0012] Optionally, the product includes a preparation.

[0013] Preferably, the preparation includes any one or a combination of a chip or a detection kit.

[0014] In a second aspect, the application further provides application of a reagent for detecting expression of the aforementioned lncRNA in a sample in preparation of a product with at least one of the following functions:

[0015] (1) predicting or assisting in predicting a postoperative recurrence-free survival rate of a patient with oral squamous cell carcinoma;

[0016] (2) predicting or assisting in predicting a postoperative overall survival rate of a patient with oral squamous cell carcinoma;

[0017] (3) predicting or assisting in predicting a tumor differentiation degree of a patient with oral squamous cell carcinoma, i.e., predicting or assisting in predicting a disease stage of the patient with oral squamous cell carcinoma, whether the patient is in an advanced stage.

[0018] Optionally, in the application, the product is a preparation, a chip or a detection kit.

[0019] According to the DPY19L1P1 sequence, a specific detection reagent (such as a primer, a DNA probe, etc.) is designed and synthesized, which can detect the expression level of DPY19L1P1 in the sample based on a quantitative PCR method and / or a high-throughput sequencing method and / or a probe hybridization method, or detect the expression level of a target gene regulated by DPY19L1P1 based on an immunological method, and use it as effective information for early diagnosis of oral squamous cell carcinoma.

[0020] The reagent for detecting the expression level of DPY19L1P1 in the chip includes a probe specifically recognizing the DPY19L1P1 gene; and the reagent for detecting the expression level of DPY19L1P1 in the kit includes a primer specifically amplifying the DPY19L1P1 gene or a probe specifically recognizing the DPY19L1P1 gene.

[0021] In a third aspect, the application further provides a detection primer pair for specifically amplifying the lncRNA, and the sequence of the primer pair is shown in SEQ ID NO. 2-3.

[0022] The detection primer pair of the application can specifically recognize DPY19L1P1 and detect the expression level of DPY19L1P1 in tissues, and provide effective information for the diagnosis or prognosis of clinical oral squamous cell carcinoma.

[0023] In a fourth aspect, the application further provides a kit comprising the detection primer pair.

[0024] The kit of the application comprises the primer pair which can specifically recognize DPY19L1P1 and detect the expression level of DPY19L1P1 in tissues, and has simple composition, convenient use, accurate quantification, stable and reliable detection results, and can improve the sensitivity and specificity of early diagnosis of clinical oral squamous cell carcinoma.

[0025] Preferably, the kit further comprises a polymerase chain reaction reagent and a reaction buffer thereof, dNTP, an internal reference primer and a fluorescent dye. The internal reference primer can be a specific detection primer of the GAPDH housekeeping gene. The fluorescent dye can be SYBR-Green dye.

[0026] Preferably, the kit further comprises an RNA extraction reagent and a cDNA reverse transcription reagent. The kit combined with a commonly used RNA extraction reagent and a general reverse transcription reagent can specifically detect the expression level of DPY19L1P1 in tissues, and is effectively used for early auxiliary diagnosis of oral squamous cell carcinoma.

[0027] The application further provides application of the detection primer pair or the kit.

[0028] The application further provides application of the agonist of the lncRNA gene in preparation of a pharmaceutical composition for preventing or treating oral squamous cell carcinoma.

[0029] The application has the following beneficial effects:

[0030] 1. The application first finds that the expression level of DPY19L1P1 is related to oral squamous cell carcinoma, and can be used as a specific molecular marker to design and synthesize specific detection reagents or kits for early auxiliary diagnosis of oral squamous cell carcinoma in clinic, and improve the diagnosis efficiency and prognosis judgment efficiency of oral squamous cell carcinoma.

[0031] 2. The application further provides primers for amplifying DPY19L1P1 and a kit containing the primers.

[0032] Through integrated analysis of the data of TCGA in UCSC Xena and GDC databases, it is found that the long non-coding RNA DPY19L1P1 is specifically highly expressed in oral squamous cell carcinoma tissues, and ROC curve analysis confirms its diagnostic value. Further, the high expression of DPY19L1P1 is significantly related to higher clinical stages and poorer histological grades, indicating that it can be used as a potential indicator for evaluating the malignant degree of tumor; the oral squamous cell carcinoma marker DPY19L1P1 is obtained, which is used for specifically detecting oral squamous cell carcinoma, and based on its carcinogenic effect, it provides a new research and development direction and theoretical support for preparing a drug for treating oral squamous cell carcinoma. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 Fig. 1A is a diagram of the expression difference analysis of DPY19L1P1 in oral squamous cell carcinoma tissues and normal tissues in Example 1; Fig. 1B is a ROC curve analysis of the value of DPY19L1P1 in the diagnosis of oral squamous cell carcinoma; and Figs. 1C and 1D are the correlation of the expression of DPY19L1P1 with clinical stages and histological grades.

[0034] Figure 2Fig. A is a graph showing the effect of knocking down DPY19L1P1 on reducing the proliferation of oral squamous cell carcinoma cells, as detected by CCK-8 assay in Example 2; Fig. B is a graph showing the effect of knocking down DPY19L1P1 on reducing the migration of oral squamous cell carcinoma cells after crystal violet staining, as detected by cell migration assay in Example 2; Fig. C is a graph showing the migration cells in the cell migration assay in Example 2; SS-NC is the control group, and SS-DPY19L1P1 is the DPY19L1P1 knockdown cell group. DETAILED DESCRIPTION

[0035] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of the present application. In the present application, unless specified, the devices and materials used are commercially available or commonly used in the art. The methods in the following embodiments are conventional methods in the art, unless otherwise specified.

[0036] Experimental reagents used in the embodiments:

[0037] 1. Reverse transcription kit: PrimerScript RT Reagent Kit (RR037A) from Takara Bio Technology (Beijing) Co., Ltd. TM -RT Reagent Kit except genomic cDNA first strand synthesis premix reagent (RR037A);

[0038] 2. qRT-PCR kit: SYBR Green Pro Taq HS premix qPCR reagent kit (AG11701) from Aikangrui Biological.

[0039] Example 1

[0040] Analysis of the expression level of DPY19L1P1 in oral squamous cell carcinoma tumor samples

[0041] In this example, DPY19L1P1 as a cancer tissue biomarker was obtained, and its expression level in cancer tissue and its correlation with survival rate were compared.

[0042] 1. Experimental method

[0043] The expression of DPY19L1P1 in oral squamous cell carcinoma tissues and its correlation with clinicopathology were analyzed using TCGA data from the UCSC Xena database (University of California Santa Cruz Xena, http: / / xena.ucsc.edu / ) and the GDC database (Genomic Data Commons Data Portal, https: / / portal.gdc.cancer.gov / ). Inclusion criteria were: 1) primary tumor, 2) adult patients; exclusion criteria were: 1) history of any other tumor or co-existing tumors, 2) incomplete clinical data or refusal of follow-up, 3) no accurate DPY19L1P1 expression, 4) no accurate tumor status, 5) no accurate clinical stage, 6) no accurate pathological stage, 7) no accurate histological grade. Patients were divided into high and low DPY19L1P1 expression groups based on the median expression value.

[0044] This invention obtains clinical data of oral squamous cell carcinoma patients from the TCGA database using the UCSC Xena and GDC databases, analyzes the expression level of DPY19L1P1 and its correlation with clinicopathological features, and clearly defines inclusion and exclusion criteria to ensure the accuracy and reliability of the analysis results. Therefore, the above analysis can serve as an effective method for assessing the survival rate and prognosis of cancer patients.

[0045] 2. Experimental Results and Analysis

[0046] (1) such as Figure 1 The results of A show that the expression level of DPY19L1P1 in cancer samples is higher than that in normal samples.

[0047] (2) ROC curve analysis showed its value in the diagnosis of oral squamous cell carcinoma. The area under the curve (AUC) was 0.7848, the sensitivity was 64.04%, and the specificity was 79.55%. Figure 1 B). Analysis of the relationship between DPY19L1P1 expression and clinicopathological features revealed that DPY19L1P1 expression levels were closely related to clinical stage and histological grade. Specifically, DPY19L1P1 expression levels were significantly elevated in patients with advanced clinical stage and poor histological differentiation. Figure 1 C, D).

[0048] This example demonstrates that DPY19L1P1 can serve as a biomarker, providing important clues and evidence for the diagnosis, treatment, and prognosis of tumors.

[0049] Example 2

[0050] Functional verification of DPY19L1P1

[0051] 1. Cell transfection

[0052] In a six-well plate, HN30 oral squamous cell carcinoma cells were inoculated at a cell number of 3.0 x 10 5 / mL, and 2 mL of complete medium containing 10% FBS was added, and when the cell density reached about 70%, transfection was performed.

[0053] The cell transfection comprises the following steps:

[0054] (1) Synthesis of siRNA

[0055] siRNA targeting human DPY19L1P1 gene was designed and synthesized, and the control was Smart Silencer-lncRNA (purchased from Guangzhou Ribo Biological Technology Co., Ltd.), and the sequence of DPY19L1P1 Smart Silencer (SEQ ID NO. 4).

[0056] (2) Preparation of siRNA diluent for human DPY19L1P1 gene:

[0057] Dilute 5 μL of the above siRNA (20 μM per strand) in 125 μL of serum-free medium DMEM, mix well, and stand at room temperature for 5 min.

[0058] Prepare Lipo8000 diluent: Dilute 4 μL of Lipo8000 in 125 μL of serum-free medium DMEM, mix well, and stand at room temperature for 10 min.

[0059] (3) Mix the above two diluents in equal volume at 1:1, and stand at room temperature for 20 min;

[0060] (4) Add the above mixture to the HN30 cell supernatant drop by drop, and quantitatively add 125 μL per well, and mix the plate gently;

[0061] (5) Incubate in a 37°C, 5% CO2 incubator for 6 h;

[0062] (6) Replace with 2 mL of complete medium containing 10% FBS DMEM, and culture the cells in each group at 37°C, 5% CO2 for 24 h, to obtain DPY19L1P1 knockdown cells, and collect the cells for subsequent experiments.

[0063] 2. Cell proliferation experiment

[0064] Cell proliferation experiment is a common tumor phenotype experiment, which is often used to evaluate and quantify the speed of tumor cell growth and replication. In this experiment, CCK-8 method was used to detect tumor cell proliferation, and CCK-8 Cell Counting Kit reagent kit from Vazyme company was used. The kit is based on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5(2,4-disulfophenyl)-2H-tetrazole monosodium salt) and is widely used in cell proliferation detection products. In this embodiment, the effect of DPY19L1P1 on the proliferation of oral squamous cell carcinoma cells was explored by CCK-8 method.

[0065] (1) Experimental method

[0066] ① The transfected cells in each group were treated with trypsin and counted with a cell counter. Then the transfected cells in each group were resuspended with an appropriate amount of complete culture medium to contain 1000 cells per 100 μl of cell suspension, and the transfected cells in each group were inoculated in a 96-well plate, each well containing 100 μl of cell suspension, and 3 replicate wells were set for each group. The wells without culture medium need to be sealed with phosphate buffered saline (PBS), and then the 96-well plate is placed in a 37℃, 5% CO2 incubator for culture;

[0067] ② After the cells adhere, 10 μl of CCK-8 reagent is added to the culture medium;

[0068] ③ The 96-well culture plate is placed in the incubator for 5 hours;

[0069] ④ After 0 hours, 24 hours, 48 hours, 72 hours, 96 hours and 120 hours after the cells adhere, 10 μl of CCK-8 reagent is added to the culture medium, and then the 96-well plate is returned to the incubator for further culture for 2 hours. Then the absorbance at 450 nm is measured using a microplate reader.

[0070] ⑤ Process the test data, with 0 hours, 24 hours, 48 hours, 72 hours, 96 hours and 120 hours as the abscissa, and the absorbance at 450 nm as the ordinate, to draw the cell growth curve.

[0071] (2) Experimental results and analysis

[0072] The results of the cell growth curve are shown in Figure 2 A, the proliferation of DPY19L1P1 knockdown cells is lower than that of the control group, and the experimental results show that knockdown of DPY19L1P1 significantly inhibits the proliferation ability of oral squamous cell carcinoma cells.

[0073] 3. Cell migration experiment

[0074] Cell migration experiment is used to simulate the ability of tumor cells to move in the external environment. Transwell chamber is an ideal model for evaluating the migration ability of cells. In this model, cells move from the upper layer to the lower layer of the chamber through a porous polycarbonate membrane with a diameter of 8 μm, which simulates the migration behavior of tumor cells.

[0075] (1) Experimental method

[0076] ① Take HN30 cells in good growth state for trypsin digestion. Wash the cells once with serum-free medium. Resuspend 5 x 10 4 cells in 150 μL of serum-free medium;

[0077] ②Seed the cell suspension in the upper layer of each Transwell chamber. Add 600 μL of complete medium containing 50% FBS to the lower layer of the Transwell chamber;

[0078] ③Place the Transwell chamber containing the cells in the cell culture incubator and incubate for 24 hours;

[0079] ④Fix the cells on the chamber membrane with 4% polyethylene glycol for 15 minutes. Stain the cells with crystal violet for 15 minutes, then gently rinse with water;

[0080] ⑤Gently wipe off the color with a cotton swab, take a photo of the cells on the lower surface of the polycarbonate membrane under a microscope, and perform statistical analysis.

[0081] (2) Experimental results and analysis

[0082] The electron microscopy results of the migration effect are shown in Figure 2 B, and the migration cell statistics are shown in Figure 2 C. The results show that compared with the control group, the number of cells that have crossed the porous polycarbonate membrane in the experimental group is significantly reduced, thus indicating that knockdown of DPY19L1P1 inhibits the migration ability of oral squamous cell carcinoma cells.

[0083] Example 3

[0084] Application of DPY19L1P1 as an oral squamous cell carcinoma detection marker in detecting the recurrence risk of oral squamous cell carcinoma and whether oral squamous cell carcinoma is advanced

[0085] The present embodiment provides a method for applying DPY19L1P1 as an oral squamous cell carcinoma detection marker in detecting the recurrence risk of oral squamous cell carcinoma and whether oral squamous cell carcinoma is advanced. The method is used to predict or assist in predicting the postoperative prognosis of the patient by detecting the expression level of lncRNA-DPY19L1P1 in the cancer tissue sample of the patient to be tested. The method comprises the following steps:

[0086] 1. Extraction of total RNA:

[0087] (1) Add 1 mL of TRIzol to the cell or tissue sample, shake well, and transfer to an RNase-free centrifuge tube. Let it stand on ice for 5 minutes.

[0088] (2) Add 300 μL of chloroform, shake well again, and let it stand on ice for 10 minutes. Centrifuge at 12000 g at 4°C for 15 minutes.

[0089] (3) Carefully transfer the supernatant to a new RNase-free EP tube, add an equal volume of isopropanol, and let it stand on ice for 15 minutes.

[0090] (4) Centrifuge again at 12000 g at 4°C for 15 minutes. Discard the supernatant and wash the precipitate with 75% ethanol and anhydrous ethanol twice.

[0091] (5) Centrifuge at 12000 g at 4°C for 5 minutes, discard the supernatant, and dry the precipitate at room temperature until it becomes transparent. Add 40 μL of DEPC water for dilution. Then, use a UV spectrophotometer to detect the concentration and purity of the RNA, and prepare cDNA by reverse transcription.

[0092] 2. qPCR detection of DPY19L1P1

[0093] Take 1 ng of cDNA for qPCR detection, and use ACTIN as an internal reference. According to the instructions of the kit (Taq ProUniversal SYBR qPCR Master Mix from vazyme), establish a qPCR reaction system with a final volume of 20 μL.

[0094] The reaction system includes 1 ng of the above cDNA, 10 μL of SYBR Green I, 0.8 μL of each upstream and downstream primer (concentration of 10 μmol / L), and the rest is DEPC water.

[0095] The sequences of the upstream and downstream primers are as follows:

[0096] DPY19L1P1-F: CAGCAAGGTCCACGGAGTAG (SEQ ID NO. 2)

[0097] DPY19L1P1-R: GGTAAACTCCCGTCTCCCAC (SEQ ID NO. 3)

[0098] The thermal cycling program of qPCR is as follows: 95°C pre-denaturation for 30 s, then 3-step reaction: 95°C denaturation for 5 s, 60°C annealing for 30 s, for 40 cycles.

[0099] The final detection result is calculated by 2-ΔΔCt The relative expression amount of the lncRNA-DPY19L1P1 is calculated.

[0100] 3. Analysis of the detection result

[0101] The postoperative prognosis of the patient to be tested can be predicted or assisted in predicting by detecting the expression amount of the lncRNA-DPY19L1P1 in the cancer tissue sample of the patient to be tested, and the judgment criteria are as follows:

[0102] The recurrence-free survival rate of the patient to be tested in the high expression amount group is lower than that of the patient to be tested with the conventional expression amount, and also lower than that of the patient to be tested in the low expression amount group; and / or, the overall survival rate of the patient to be tested in the high expression amount group is lower than or equal to that of the patient to be tested with the conventional expression amount, and also lower than that of the patient to be tested in the low expression amount group.

[0103] Alternatively, the expression level of the lncRNA-DPY19L1P1 gene measured by the above method can also be used as an intermediate result, and by combining other clinical diagnosis results, a more reference result of recurrence risk and whether the oral squamous cell carcinoma is in the late stage can be obtained, and used as one of the reference information for the patient's clinical treatment plan.

[0104] It can be understood that for those skilled in the art, the technical solutions of the present application and the concept of the present application can be replaced or changed equivalently, and all these changes or replacements shall belong to the protection scope of the claims attached to the present application.

Claims

1. The application of a reagent for detecting the expression level of lncRNA markers in the preparation of diagnostic products for oral squamous cell carcinoma, characterized in that, The lncRNA is DPY19L1P1, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The product is a formulation.

3. The application according to claim 2, characterized in that, The formulation includes any one or a combination of a chip or a test kit.

4. The application according to claim 1, characterized in that, The reagents are primer pairs used for the specific amplification of lncRNA, and the sequences of the primer pairs are shown in SEQ ID NO.2~3.

5. The application according to claim 4, characterized in that, The product is a kit that includes a detection primer pair.

6. The application according to claim 5, characterized in that, The kit includes polymerase chain reaction reagents and their reaction buffer, dNTPs, internal reference primers, and fluorescent dyes.

7. The application according to any one of claims 5 or 6, characterized in that, The kit also includes RNA extraction reagents and cDNA reverse transcription reagents.

Images