SNP (Single Nucleotide Polymorphism) molecular marker related to color characters of cockscombs and skin of Anyi tile grey chicken and application of SNP molecular marker

By developing SNP molecular markers related to the comb and skin color of Anyiwa Grey chickens, and using nucleotide sequence mutations to identify comb and skin color, the problem of impurity in Anyiwa Grey chicken populations has been solved. This has enabled accurate identification and breeding of comb and skin color, meeting consumer demand and promoting the development of chicken breeds.

CN120989254AActive Publication Date: 2025-11-21JIANGXI AGRICULTURAL UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511236506.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-01
Publication Date
2025-11-21
Estimated Expiration
2045-09-01

AI Technical Summary

Technical Problem

The comb and skin color phenotypes of Anyi Wa Grey chickens are not pure, which leads to false impressions, affects the development of the breed, and consumers have different needs. Current technology makes it difficult to accurately identify and breed Anyi Wa Grey chicken strains with different comb and skin colors.

Method used

To develop a SNP molecular marker associated with the comb and skin color of Anyi Wah Grey chickens, primer sets were designed for PCR amplification and sequencing by T/C mutation at the 233rd base of a specific nucleotide sequence to identify comb and skin color traits and provide a reliable genetic reference.

Benefits of technology

It enables accurate identification and classification of the comb and skin color of Anyi Wahui chickens, meeting consumer demand and promoting the development of chicken breeds and strain breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989254A_ABST
    Figure CN120989254A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to color characters of a cockscomb and skin of an Anyi tile grey chicken and application of the SNP molecular marker, and belongs to the technical field of poultry breeding. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, and T / C mutation exists at the 233rd basic group of the nucleotide sequence as shown in SEQ ID NO.1. The invention also provides a specific primer group for detecting the SNP molecular marker and a specific detection method. The molecular marker provided by the invention can accurately identify Anyi tile-gray chicken red-crown and yellow-skin individuals and purple-gray-crown and purple-gray-skin individuals, and can provide reliable reference for breeding Anyi tile-gray chicken strains with different crown colors and skin colors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of poultry breeding technology, and in particular to a SNP molecular marker related to the comb and skin color traits of Anyi Wa Grey Chicken and its application. Background Technology

[0002] Comb color and skin color are both important appearance traits of domestic chickens, and are among the main appearance criteria consumers use to select commercial chickens. The Anyi Wahui chicken, a local Chinese chicken breed originating in Jiangxi Province, currently exhibits two appearances: "three gray and red comb" (gray feathers, gray legs, gray beak, and red comb) and "five gray" (gray feathers, gray legs, gray beak, purplish-gray comb, and gray skin). Two different comb and skin color phenotypes can create the illusion of impurity in the Anyi Wahui chicken population, which is detrimental to its development. Furthermore, different consumers have different preferences for different comb and skin colors. If the molecular mechanisms and genetic patterns of different comb and skin colors in the Anyi Wahui chicken can be analyzed, commercial Anyi Wahui chickens with different comb and skin colors can be obtained, which would greatly satisfy consumer demand and promote the development of the Anyi Wahui chicken breed.

[0003] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. They are bimorphic markers characterized by abundant loci, wide distribution, high genetic stability, representativeness, and convenient and rapid detection. SNP molecular markers utilize unique, breed-specific SNP loci in an individual's genomic DNA to identify genotypes with different locus combinations, resulting in more objective and accurate identification results. Therefore, developing an SNP molecular marker based on SNPs that relates to the comb and skin color of the Anyi Wa Grey chicken is urgently needed. Summary of the Invention

[0004] The purpose of this invention is to provide a SNP molecular marker related to the comb and skin color traits of Anyiwa Grey chickens and its application, in order to solve the problems existing in the prior art. The molecular marker provided by this invention can accurately identify Anyiwa Grey chickens with red combs and yellow skin, and those with purple-grey combs and purple-grey skin, providing a reliable reference for breeding Anyiwa Grey chicken strains with different comb and skin colors.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] In a first aspect, the present invention provides an SNP molecular marker related to the comb and skin color traits of Anyiwa Grey Chicken, the nucleotide sequence of which is shown in SEQ ID NO.1, and a T / C mutation is present at the 233rd base of the nucleotide sequence shown in SEQ ID NO.1.

[0007] Preferably, the genotype of the molecular marker is TT or TC.

[0008] Preferably, if the molecular marker genotype is TT, the Anyiwa Grey Chicken has a red comb and yellow skin; if the molecular marker genotype is TC, the Anyiwa Grey Chicken has a purplish-gray comb and purplish-gray skin.

[0009] Secondly, the present invention also provides a primer set for detecting the SNP molecular marker, the nucleotide sequence of which is shown in SEQ ID NO.2-3.

[0010] Thirdly, the present invention also provides the application of the SNP molecular marker or the primer set in any of the following:

[0011] (1) Identify the characteristics of the comb and skin color of Anyi Wahui chickens;

[0012] (2) Breeding different comb and skin colors of Anyi Wahui chickens;

[0013] (3) Screening for new breeds related to the comb and skin color traits of Anyi Wa Grey Chicken.

[0014] Fourthly, the present invention also provides a product for identifying the comb and skin color characteristics of Anyi Wa Grey Chicken, including the aforementioned primer set.

[0015] Fifthly, the present invention also provides for the use of the described product in any of the following:

[0016] (1) Identify the characteristics of the comb and skin color of Anyi Wahui chickens;

[0017] (2) Breeding different comb and skin colors of Anyi Wahui chickens;

[0018] (3) Screening for new breeds related to the comb and skin color traits of Anyi Wa Grey Chicken.

[0019] In a sixth aspect, the present invention also provides a breeding method related to the comb and skin color traits of Anyi Wa Grey Chickens, comprising the following steps:

[0020] Extract genomic DNA from the chicken to be tested and perform whole-genome sequencing or PCR amplification using the primer set and then sequencing. Determine the comb and skin color traits of Anyi Wa Grey Chicken based on the genotype of the SNP loci.

[0021] If the genotype is TT, the Anyi Wa Grey Chicken will have a red comb and yellow skin.

[0022] If the genotype is TC, the comb color of the Anyi Wa Grey Chicken is purplish-gray, and the skin color is purplish-gray.

[0023] Preferably, the PCR amplification reaction system consists of 15 μL 2×Rapid Taq Master Mix, 1.2 μL 10 μM primer F, 1.2 μL 10 μM primer R, 0.6 μL template DNA, and 12 μL ddH2O, for a total of 30 μL.

[0024] Preferably, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, for 35 cycles; 72℃ complete extension for 5 min.

[0025] The present invention discloses the following technical effects:

[0026] This invention provides a SNP molecular marker related to the comb and skin color of Anyi Wah Grey chickens. The SNP molecular marker provided by this invention can be used to detect the comb and skin color traits of Anyi Wah Grey chickens, or to breed Anyi Wah Grey chickens with red combs and yellow skin, and purple-gray combs and purple-gray skin, to meet the needs of different consumers and greatly promote the development of Anyi Wah Grey chickens. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 Manhattan plot for genome-wide association analysis;

[0029] Figure 2 First-generation sequencing peak diagrams of SNP loci corresponding to different comb and skin colors of An'yi Wa Grey Chickens;

[0030] Figure 3 The results of genotype frequency verification for different comb and skin colors of Anyi Wa Grey Chickens are shown in the figure. Detailed Implementation

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0036] SEQ ID NO.1: TAGGAAGGGCAAAGTTGACCGTATTGAAGCTTAAAAGAAGATAAGA CGTAAGACTTATATGGGAAGAAAGAGACTCTCATCAAAGGAATTGGGACTTCTGGAAGCTGTGGGCCTGATTCTCAGTTGCACTGATTATCAACTTATTTGTTTGTGCTGCATATTACCTATGAAATGGTACAGGTTTTGTACATCTATTTGAGGAATCTGCTTCTGTTTATCGGAGAAAAAAAAA[T / C]GCTTGTTTTCTGTTTTTCGAGCAGCTGTGGAGGCAGATTCCCAAGAGAC TGGAAGCAAGTTGATCCAATCTATACTATTTTACAACTTTTACTTTAGATTTAACTTCCCA GATTCCATTTTCTGTTTCCGTTTCCAAATCGTTAGGATGGATGGGTACTTCCAAACATCTT GAGGGCTTTTAGGCT;

[0037] In this context, the bases in parentheses and bolded represent mutation sites.

[0038] Example 1: Screening of SNP molecular markers

[0039] 1. Laboratory animals

[0040] The experimental chickens used in this invention are Anyi Wahui chickens, a local breed from Jiangxi Province that are included in the National Livestock and Poultry Genetic Resources Catalogue (there are two phenotypes: red comb and yellow skin, and purple comb and purple skin). They all come from the Anyi Wahui Chicken Provincial Conservation Farm (now managed by Jiangxi Guowei Livestock and Poultry Co., Ltd.).

[0041] 2. Experimental Methods

[0042] Thirty Anyi Wagyu chickens (10 with red combs and yellow skin, and 20 with purple combs and purple skin) were used as research subjects. Two mL of wing vein blood was collected from these samples. DNA was extracted using the conventional phenol-chloroform method. After quality and concentration testing, the qualified DNA samples were sent to Shanghai Paisennuo Biotechnology Co., Ltd. 10× next-generation resequencing was performed using the Illumina NovaSeq sequencing platform. The sample sequences were aligned to the reference genome using BWAv0.7.17 software with GenomeassemblyGRCg6a (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000002315.6 / ) as the reference genome. Subsequent operations were performed using samtoolsv1.6 and GATKv4.2.0.0 software to obtain unfiltered VCF files. Using GATKv4.2.0.0 software with QD<2.0, MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, and ReadPosRankSum<-8.0 as filtering parameters, a preliminary VCF file was obtained. Using PLINKv1.90 software with geno0.1 and maf0.05 parameters, SNPs with a deletion rate greater than 10% and a minor allele frequency of less than 5% were filtered out to obtain the final filtered SNP dataset. A total of 12,299,085 high-quality loci were obtained for subsequent analysis.

[0043] 3. Genome-wide association study (GWAS)

[0044] The filtered VCF files, containing a total of 12,299,085 SNP loci, were analyzed using a mixed linear model with GEMMA software, employing the red crown / yellow skin and purple / grey crown / purple skin phenotypes. Significant SNPs were annotated using Annovar software with a significance threshold of -log10(0.05, 0.01 / SNP count) = 8.39 / 9.09. The results indicate that a large number of SNPs were annotated to the relevant regions of the EDN3 gene. Figure 1 ).

[0045] This invention discovered that the SNP site 1552 bp upstream of the EDN3 gene is highly correlated with the comb and skin color of Anyiwa Grey Chicken. This SNP molecular marker site is located at the 233rd base of the sequence shown in SEQ ID NO.1, at the 10818413th base on chromosome 20 of the GRCg6a version of the Red Junglefowl reference genome, and has a T / C mutation.

[0046] When the genotype is TT, the Anyi Wa Grey Chicken has a red comb and yellow skin; when the genotype is TC, the Anyi Wa Grey Chicken has a purplish-gray comb and purplish-gray skin.

[0047] Example 2: Large-scale population validation of the effects of SNP loci on the comb and skin color of Anyi Wah Grey chickens.

[0048] Primers were designed based on the sequence information of SEQ ID NO.1, and the primer information is shown in Table 1.

[0049] Table 1. Primer sequences, Tm values, annealing temperatures, and fragment lengths for PCR amplification.

[0050]

[0051]

[0052] Ninety-seven Anyi Wahui chickens (red-combed yellow-skinned, n=41; purple-combed purple-skinned, n=56) were collected from the Anyi Wahui Chicken Breeding Farm. Simultaneously, from the above population, 27 individuals (red-combed yellow-skinned, n=5; purple-combed purple-skinned, n=22) were obtained by crossing individuals with the known locus genotype TC with purple-combed purple-skinned individuals; 17 individuals (red-combed yellow-skinned, n=8; purple-combed purple-skinned, n=9) were obtained by crossing individuals with the known locus genotype TC with purple-combed purple-skinned individuals and individuals with the genotype TT with red-combed yellow-skinned individuals; and 17 individuals (red-combed yellow-skinned, n=17; purple-combed purple-skinned, n=0) were obtained by crossing individuals with the known locus TT with red-combed yellow-skinned individuals.

[0053] Two mL of blood was collected from the subwing vein of 158 individuals. Blood DNA was extracted using the standard phenol-chloroform method. PCR was performed using the Novizan 2×RapidTaqMasterMix kit with primers listed in Table 1, following a thermal cycling protocol of 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 15 s, 35 cycles, and a final extension at 72°C for 5 min. The PCR reaction mixture consisted of: 15 μL 2×RapidTaqMasterMix, 1.2 μL primer F (10 μM), 1.2 μL primer R (10 μM), 0.6 μL template DNA, and 12 μL ddH2O, for a total of 30 μL. The PCR products were subjected to agarose gel electrophoresis. Samples with correctly amplified bands were sent to Qingke Biotechnology Co., Ltd. for first-generation sequencing. The peak diagram of the first-generation sequencing results is shown below. Figure 2 As shown, the results indicate that the genotype at this locus was TT for all red-crowned yellow-skinned individuals, and TC for all purple-gray-crowned purple-gray-skinned individuals.

[0054] Genotype frequencies were statistically analyzed in 158 individuals from the Anyi Wa Grey Chicken red-combed group and the Anyi Wa Grey Chicken purple-grey comb and purple-grey skin group. The results are as follows: Figure 3As shown in the figure. The results showed that among the 158 Anyi Wahui chicken individuals, 71 individuals had red combs and yellow skin, all of which were of the TT genotype; and 87 individuals had purple combs and purple skin, all of which were of the TC genotype.

[0055] The hybridization pattern of TT and TC genotype individuals was selected, and the ratio of TT to TC genotypes in the offspring was approximately 1:1. After large-scale verification, it was found that there were no CC genotype individuals in the Anyiwa Grey Chicken population. It is speculated that the CC genotype is lethal in the Anyiwa Grey Chicken population. It is expected that this hybridization pattern will improve the hatching rate of Anyiwa Grey Chickens.

[0056] The results above show that the SNP molecular marker Chr20:10818413 provided by this invention corresponds to the following Anyi Wah Grey chickens: the TT genotype corresponds to a red-combed, yellow-skinned individual, and the TC genotype corresponds to a purple-grey-combed, purple-grey-skinned individual. The SNP sites of the provided molecular markers can be used for genotyping of Anyi Wah Grey chickens, effectively distinguishing their comb and skin color, and providing new molecular markers for screening comb and skin color traits in Anyi Wah Grey chickens.

[0057] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with the comb and skin color traits of the Anyi Wa Grey Chicken, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and a T / C mutation exists at the 233rd base of the nucleotide sequence shown in SEQ ID NO.

1.

2. The SNP molecular marker according to claim 1, characterized in that, The molecular marker has a genotype of TT or TC.

3. The SNP molecular marker according to claim 1, characterized in that, If the molecular marker genotype is TT, then the Anyiwa Grey Chicken has a red comb and yellow skin; if the molecular marker genotype is TC, then the Anyiwa Grey Chicken has a purplish-gray comb and purplish-gray skin.

4. A primer set for detecting the SNP molecular marker as described in claim 1, characterized in that, The nucleotide sequences of the primer set are shown in SEQ ID NO.2-3.

5. The use of the SNP molecular marker as described in any one of claims 1-3 or the primer set as described in claim 4 in any one of the following: (1) Identify the characteristics of the comb and skin color of Anyi Wahui chickens; (2) Breeding different comb and skin colors of Anyi Wahui chickens; (3) Screening for new breeds related to the comb and skin color traits of Anyi Wa Grey Chicken.

6. A product for identifying the color characteristics of the comb and skin of Anyi Wahui chickens, characterized in that, Includes the primer set as described in claim 4.

7. The application of the product as described in claim 6 in any of the following: (1) Identify the characteristics of the comb and skin color of Anyi Wahui chickens; (2) Breeding different comb and skin colors of Anyi Wahui chickens; (3) Screening for new breeds related to the comb and skin color traits of Anyi Wa Grey Chicken.

8. A breeding method related to the comb and skin color traits of Anyi Wa Grey Chicken, characterized in that, Includes the following steps: Extract genomic DNA from the chicken to be tested and perform whole-genome sequencing, or perform PCR amplification using the primer set described in claim 4 and then sequence the genome. Determine the comb and skin color traits of Anyi Wa Grey Chicken based on the genotype of the SNP site. If the genotype is TT, the Anyi Wa Grey Chicken will have a red comb and yellow skin. If the genotype is TC, the comb color of the Anyi Wa Grey Chicken is purplish-gray, and the skin color is purplish-gray.

9. The breeding method according to claim 8, characterized in that, The PCR amplification reaction system consisted of 15 μL 2×Rapid Taq Master Mix, 1.2 μL 10 μM primer F, 1.2 μL 10 μM primer R, 0.6 μL template DNA, and 12 μL ddH2O, for a total of 30 μL.

10. The breeding method according to claim 8, characterized in that, The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, cycled 35 times; 72℃ complete extension for 5 min.

Citation Information

Patent Citations

  • Molecular marker related to gray feather character of Anyi tile grey chicken and application of molecular marker

    CN116949189A

  • Molecular marker combination for identifying Anyi tile grey chicken variety and application of molecular marker combination

    CN117327798A

  • SNP (Single Nucleotide Polymorphism) molecular marker for identifying variety of Anyi Huayuan chicken and application of SNP molecular marker

    CN118147317A