Application method of using ERC1 gene as cattle superovulation character molecular marker

Abstract

The invention discloses an application method of using an ERC1 gene as a cattle superovulation character molecular marker, and belongs to the technical field of animal character detection gene engineering. The length of the nucleotide sequence of the ERC1 gene segment is 520bp, and a c-t base mutation exists at the 293bp position. The mutation site is used as a molecular marker, the genotype is judged through sequence determination, the genotype can be associated with the excellent ovulation character of the cattle, and the ovulation performance of individuals with different genotypes is remarkably different. According to the invention, a specific primer is utilized to obtain an ERC1 gene part segment related to the excellent superovulation character of cattle, and a specific SNP site in the segment is taken as a molecular marker, so that a theoretical basis and specific application are provided for marker-assisted selection of cattle.

Description

TECHNICAL FIELD

[0001] The application provides an application method of using an ERC1 gene as a molecular marker of a superovulation trait of a cow, and particularly relates to cloning of a cow ERC1 gene fragment and application of the cow ERC1 gene fragment in marker-assisted selection of the cow, and belongs to the technical field of animal trait detection and genetic engineering. BACKGROUND

[0002] Superovulation can obtain more transplantable high-quality embryos, and maximize the use of excellent breeding stock. Superovulation combined with embryo transfer technology not only can fully exert the breeding value of female excellent individuals, but also can effectively accelerate the process of genetic improvement of livestock. However, the effect of superovulation is affected by many factors, such as the dosage and treatment time of hormones, superovulation season and changes in external environment, and as the most basic influencing factor of superovulation, the genetic factors of individuals also seriously limit the effect of superovulation.

[0003] A large number of studies have shown that the genetic polymorphism of individuals is closely related to the production and reproductive ability of animals. In genetic polymorphism, single nucleotide polymorphism (SNP) is widely used in related scientific research of livestock and poultry (Uimari et al., 2011; Yadav et al., 2021). Many studies have found that the SNP of a gene has an important regulatory effect on the reproductive traits of livestock and poultry, which also includes the effect of superovulation (Yang et al., 2010).

[0004] Previous studies have shown that ERC1 is related to cognitive impairment (Cong et al., 2020), and other studies have found that ERC1 is related to animal meat quality and carcass traits (Wimmers et al., 2007), and in the field of reproduction, the SNP of ERC1 was found to be closely related to complete molar pregnancy (Yu et al., 2017), but whether it affects superovulation and the subsequent effect of embryo transfer is still unclear. SUMMARY

[0005] The application provides an application method of using an ERC1 gene as a molecular marker of a superovulation trait of a cow, and particularly relates to cloning of a cow ERC1 gene fragment and application of the cow ERC1 gene fragment in marker-assisted selection of the cow, and belongs to the technical field of animal trait detection and genetic engineering.

[0006] The application provides an application method of using an ERC1 gene as a molecular marker of a superovulation trait of a cow, and particularly relates to cloning of a cow ERC1 gene fragment and application of the cow ERC1 gene fragment in marker-assisted selection of the cow, and belongs to the technical field of animal trait detection and genetic engineering.

[0007] The base mutation of c-t at the 293th site in the obtained ERC1 gene fragment is as shown in Table SEQ ID NO:1, which causes the generation of single nucleotide polymorphism (SNP) of the gene.

[0008] The method for screening the molecular marker suitable for the superovulation trait of a cow comprises the following steps: The specific primers are designed as follows: Forward primer ERC1-fwd (SEQ ID NO:2): aatacatcacagtgccgacag; Reverse primer ERC1-rev (SEQ ID NO:3): ttctcagatacctgcgatttcc; The genomic DNA is extracted from the blood of a cow and subjected to PCR amplification. Since the base mutation of c-t exists at the 293th site of the DNA sequence of the PCR product fragment, the SNP polymorphism is generated, and the specific genotype can be determined by using sequence determination. The different genotypes shown by the detection results are subjected to association analysis with the superovulation trait of a cow, and the results show that the individual with the specific genotype will obtain better superovulation effect.

[0009] The present application is described in detail as follows: I. Cloning of the ERC1 gene fragment of a cow A pair of specific primers is designed by using biological software Oligo6.0. The PCR reaction conditions are established, and the specific conditions are as follows: Forward primer: ERC1-fwd (SEQ ID NO:2): aatacatcacagtgccgacag; Reverse primer: ERC1-rev (SEQ ID NO:3): ttctcagatacctgcgatttcc; The 2× chemical dye method quantitative PCR premix of Monabio Technology Co., Ltd. is selected for PCR amplification, and the specific reaction system is as follows: 2× MonAmp™ ChemoHS qPCR Mix (provided in the product packaging box) 10.0 μl, 0.5 μl of the forward primer and the reverse primer (the concentration of each is 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng of DNA), and 8.5 μl of double distilled water. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, a total of 35 cycles; and 72℃ final extension for 5 minutes.

[0010] II. Sequence determination of the PCR product and determination of the genotype The primer ERC1-fwd and ERC1-rev are used to amplify the bovine genomic DNA to obtain a specific 520bp amplified fragment Figure 1 and SEQ ID NO: 1). The sequencing result shows that, in the 520bp fragment, due to the c-t mutation at the 293rd position, different genotypes CC, CT and TT are generated, wherein the CC type individual is homozygous for c base at the 293rd position; the CT type individual is heterozygous for c / t at the 293rd position; and the TT type individual is homozygous for t base at the 293rd position Figure 2 ).

[0011] III. Marker trait association analysis The trait association analysis is performed by using the experimental population as the experimental object, and the following model is established by using the One-Way ANOVA process of the SPSS22.0 software to perform the trait association analysis: The statistical analysis model is Y ij = μ + G i + e j ; wherein Y ij is the production performance phenotype value of the observed individual; μ is the least square mean of the production performance; G i is the effect value of the genotype on the production performance; and e j is the random residual corresponding to the observation value.

[0012] The positive effect of the present application is that, by performing the association analysis on the ERC1 gene genetic polymorphism and the bovine superovulation trait, the SNP at the special site of ERC1 and the accurate identification method thereof are determined, and the influence of the genetic polymorphism at the site on the bovine superovulation is determined, which is helpful to use the same as an important molecular marker for the auxiliary selection of the bovine in-vivo embryo production and reproductive performance and apply the same to the bovine genetic improvement. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 is the detection result of the ERC1 gene amplification product by 1.5% agarose gel electrophoresis; (M lane is a standard molecular weight Marker, and 1-7 lanes are 7 random PCR products, which have obvious and specific bands at the 520bp position); Figure 2 is the sequencing peak chart of the PCR products of the three genotypes of individuals; (the position indicated by the arrow is the mutation site. The CC type individual has c base at the site; the CT type individual has c / t base at the site; and the TT type individual has t base at the site); Figure 3is the result of electrophoresis of the ERC1 gene amplification product in Example 1 by 1.5% agarose gel; (wherein M lane is a standard molecular weight marker, 1-6 lanes are 6 PCR products detected randomly, and there is an obvious and specific band at 520 bp position); Figure 4 is the sequencing peak chart of the PCR product of three genotypes of individuals in Example 1; (the position indicated by the arrow is the mutation site. The site of the CC type individual is c base; the site of the CT type individual is c / t T base; and the site of the TT type individual is t base). DETAILED DESCRIPTION

[0014] The present application is further exemplarily described by the following examples, which do not limit the present application in any way, and any modification or change made by those skilled in the art without departing from the technical solutions of the present application will fall within the scope of the claims of the present application. Example 1

[0015] The extracted bovine genomic DNA is used as a template, a pair of specific primers is designed, partial DNA sequence of bovine ERC1 gene is cloned, sequencing and genotyping are performed, and different genotypes are associated with superovulation traits to provide molecular markers for marker-assisted selection of bovine.

[0016] I. Cloning of partial DNA fragment of bovine ERC1 gene To ensure good primer quality, in the present application, the primers are synthesized by Shengong Bioengineering (Shanghai) Co., Ltd., and the primer sequences are as follows: Forward primer: ERC1-fwd (SEQ ID NO: 2): aatacatcacagtgccgacag; Reverse primer: ERC1-rev (SEQ ID NO: 3): ttctcagatacctgcgatttcc; Taq enzyme, buffer, magnesium ions, dNTPs and the like required in the PCR reaction process can be selected by oneself. In order to obtain good results more quickly, the present application selects 2×chemical dye method quantitative PCR premix of Mona Biotech Co., Ltd. for PCR amplification. The specific reaction system is: 2×MonAmp™ ChemoHS qPCR Mix (provided in the product packaging box) 10.0 μl, 0.5 μl of forward primer and reverse primer (the concentration of each is 10 pmol / μl), 0.5 μl of genomic DNA (containing 10-50 ng of DNA), and 8.5 μl of double distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, a total of 35 cycles; 72℃ final extension for 5 minutes; II. PCR product sequence determination and genotype determination The 520bp specific amplification fragment was obtained from the bovine genomic DNA by using primer ERC1-fwd (SEQ ID NO: 2) and ERC1-rev (SEQ ID NO: 3) Figure 1 The sequencing result shows that, in the 520bp fragment, due to the c-t mutation at the 293rd position, different genotypes CC, CT and TT are generated, wherein the CC type individual is homozygous for c base at the 293rd position; the CT type individual is heterozygous for c / t at the 293rd position; and the TT type individual is homozygous for t base at the 293rd position Figure 2 III. Marker trait association analysis The experimental population owned by the applicant is used as the experimental object for trait association analysis, and the following model is established by using the One-Way ANOVA process of SPSS22.0 software for trait association analysis: The statistical analysis model is Y ij = μ + G i + e j . Wherein, Y ij is the production performance phenotype value of the observed individual; μ is the least square mean of the production performance; G i is the effect value of the genotype on the production performance; and e j is the random residual corresponding to the observation value. IV. Cloning of partial DNA sequence of bovine ERC1 gene and determination of different genotypes The 1.5% agarose gel electrophoresis detection result of the PCR amplification product shows that it is a specific PCR product, as shown in Figure 3 The PCR product is recovered and sequenced, and the result shows that the product length is 520bp. The sequencing result shows that there is a c-t base mutation at the 293rd position of the fragment, and part of the sequencing peak is shown in Figure 4 V. Association analysis on the marker trait The association analysis result of the 293rd position of the amplification fragment sequence of the bovine ERC1 gene and the superovulation trait of the bovine in the present application shows that there is a significant difference (P<0.05) in the number of embryos per head and the total number per head in the superovulation trait of the individuals corresponding to different genotypes of the site, that is, the genetic polymorphism of the site has an influence on the superovulation effect of the bovine.

[0017] Conclusion: The present application provides an important theoretical basis for using the site as a molecular marker for auxiliary selection of bovine reproduction and production performance and applying it to genetic improvement, and has a good application prospect. Example 2

[0018] ​​In the Hebei Tianhe Cattle Breeding Co., Ltd. of the superovulation mother cow group is selected randomly 92 individuals to be tested, collection blood for genomic DNA extraction and using the primer, PCR reaction system and conditions designed by the application for PCR amplification. The 2x chemical dye method quantitative PCR premix of Monabio Technology Co., Ltd. is used for PCR amplification. The specific reaction system is: 2x MonAmp™ ChemoHS qPCR Mix (provided in the product package box) 10.0 μl, primer ERC1-fwd (SEQ ID NO: 2) and ERC1-rev (SEQ ID NO: 3) each 0.5 μl (the concentration is 10 pmol / μl), genomic DNA 0.5 μl (containing 10-50 ng DNA), and 8.5 μl of double distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 60℃ annealing for 45 seconds, 72℃ extension for 45 seconds, a total of 35 cycles; 72℃ last extension for 5 minutes.

[0019] The amplification product is detected by 1.5% agarose gel electrophoresis, and the results show specific PCR products. As shown in Figure 3 , wherein M lane is a standard molecular weight Marker, and lanes 1-6 are PCR products detected. The PCR product is sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing, and the results show that in all the individuals detected, 53 individuals belong to CC type; 21 individuals belong to CT type; and 18 individuals belong to TT type.

[0020] Combined with the superovulation related records of the 92 individuals, the corresponding data is analyzed, the SPSS22.0 software One-Way ANOVA process is used, Y ij =μ+G i +e j . Wherein, Y ij is the production performance phenotype value of the observed individual; μ is the least squares mean of production performance; G i is the effect value of genotype on production performance; e j is the random residual corresponding to the observation value.

[0021] In the 92 individuals, the correlation analysis results (mean ± standard error) between different genotypes and the number of embryos per head, the total number of embryos per head in the superovulation traits are shown in Table 1.

[0022] Table 1. Significant difference analysis results of superovulation traits between individuals of different genotypes

[0023] Note: Different groups of data with different letters indicate significant difference (P<0.05).

[0024] The results showed that the different genotypes of this locus had significant difference in superovulation traits, and the superovulation traits of TT type were better than CT type and CC type.

[0025] The results of the association analysis between the polymorphism of the 293 locus of the amplified sequence of bovine ERC1 gene and superovulation traits showed that among the 149 individuals randomly selected, there were 92 CC type individuals, 42 CT type individuals and 15 TT type individuals. The results of the significant difference analysis between the superovulation traits of the individuals with different genotypes (mean ± standard error) were shown in Table 2.

[0026] Table 2. The results of the significant difference analysis between the superovulation traits of the individuals with different genotypes

[0027] Note: The data with different letters in different groups were significantly different (P<0.05). The number of available embryos per head = the total number of available embryos obtained by multiple superovulation treatments / the number of superovulation treatments; the total number of embryos per head = the total number of embryos obtained by multiple superovulation treatments / the number of superovulation treatments.

[0028] The results showed that the different genotypes of this SNP locus had significant difference in superovulation traits. Overall, the superovulation effect of TT type was better than that of CT type or CC type, and TT type should be selected as superovulation donors, and CC type should be avoided as much as possible.

Claims

1. The use of the ERC1 gene as a molecular marker in the preparation of a formulation for detecting bovine superovulation, characterized in that: The sequence of the aforementioned molecular marker is shown in SEQ ID NO:

1. There is a mutation of a ct base at position 293, which leads to differences in superovulation traits.

2. A method for using the ERC1 gene as a molecular marker for bovine superovulation, characterized in that... The primer sequences are as follows: Forward primer: ERC1-fwd: aatacatcacagtgccgacag; Reverse primer: ERC1-rev: ttctcagatacctgcgatttcc.

3. A method for using the ERC1 gene as a molecular marker for bovine superovulation, characterized in that... Includes the following steps: Genomic DNA was extracted from bovine blood using the forward and reverse primers described in claim 2 and amplified by PCR. A base mutation of ct at position 293 of the DNA sequence of the PCR product fragment led to SNP polymorphism, and the specific genotype could be identified by sequencing. The association analysis between the different genotypes shown in the detection results and the superovulation trait in cattle was performed, and individuals with the TT genotype were selected to obtain better superovulation results.

Images