G101T SNP (Single Nucleotide Polymorphism) site related to wheat wet gluten content and application of G101T SNP site
By developing a wheat genome identification technology using KASP-labeled G101T SNP sites and fluorescently labeled primers, the problem of identifying and screening wheat wet gluten content was solved. This technology achieves efficient screening and identification of wheat with high wet gluten content, addresses the issue of insignificant wheat quality improvement effects in existing technologies, and improves the efficiency of wheat quality improvement.
Patent Information
- Application Number
- CN202511497671.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2045-10-20
AI Technical Summary
Existing technologies are difficult to effectively utilize molecular marker-assisted selection to increase the wet gluten content of wheat, resulting in insignificant wheat quality improvement effects, and poor repeatability and environmental adaptability of QTLs.
We developed a KASP-labeled G101T SNP site and used specific fluorescent primers to perform genotyping after PCR amplification. We then used FAM and HEX fluorescence signals to distinguish KASP-labeled wheat with genotypes GG or TT, achieving efficient screening and identification of wheat varieties with high wet gluten content.
It enables efficient and accurate identification and screening of wet gluten content, improves the efficiency of wheat quality improvement, and enhances the operability and environmental adaptability of breeding.
Smart Images

Figure CN121023085A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the field of molecular marker breeding technology, in particular to a G101T SNP site related to the wet gluten content of wheat and application thereof. BACKGROUND
[0002] Wheat is the largest area of cultivation, the most widely used and the highest yield of cultivated grain in the world, China is the largest wheat producer and consumer, and wheat is of great strategic significance to guarantee China's food security. Before the 1980s, the wheat breeding work in China focused on yield, resulting in that the genetic improvement of wheat quality started late, and the comprehensive processing quality was lower than that of foreign wheat. In the past 20 years, with the development of society and the improvement of people's living standards, people's demand for high-quality wheat is increasingly urgent, and wheat quality improvement is listed as an important breeding goal. According to the current "Wheat Variety Quality Classification Standard (GB / T 17320-2013)" in China, the wheat quality indicators mainly include the hardness of the grain, the crude protein content, and the wet gluten content, the sedimentation value, the water absorption, the stability time, the maximum stretching resistance and the energy of the wheat flour. The wet gluten content of strong gluten wheat is greater than or equal to 30%, the wet gluten content of medium strong gluten wheat is 28% to 30%, the wet gluten content of medium gluten wheat is 26% to 28%, and the wet gluten content of weak gluten wheat is less than 26%. Therefore, the determination of the wet gluten content is of great significance to the classification of the evaluation of wheat variety quality.
[0003] Wet gluten is a network mixture with certain viscosity and elasticity obtained by mechanically stirring, kneading and washing wheat flour, and its main components are glutenin and gliadin, which are combined with each other in a certain proportion and quantity to jointly affect the processing quality traits of wheat. The wet gluten content of wheat is significantly positively correlated with the dough stability time, the stretching area and the maximum stretching resistance, and is one of the important indicators for evaluating the quality of wheat flour. The wet gluten content is a quantitative trait, and its heredity is controlled by multiple genes, and the gene effect is mainly additive effect. Some QTLs related to the wet gluten content of wheat have been located, but due to the influence of factors such as mapping population, genetic background and mapping method, the results can only reflect the gene information contained in a specific wheat variety, and most of the QTLs have small contribution rate to the phenotype and poor repeatability in different environments, so they still cannot meet the needs of molecular marker assisted selection.
[0004] Molecular marker assisted selection is a modern breeding method of using DNA molecular markers closely linked to target traits for genotypic selection of target traits, which has the advantage of not being affected by external environmental factors. KASP (Kompetitive Allele-Specific PCR) is a homogeneous genotyping technology based on fluorescence developed in recent years. The primer is designed according to the specific SNP or InDels in the target allele, and different fluorescent groups are added at the end of the primer. The target sequence is typed based on the reading of the terminal fluorescence signal of PCR, which has the advantages of high efficiency, accuracy and low cost, and has a broad application prospect in crop breeding.
[0005] Therefore, mining SNPs related to wheat wet gluten content and developing corresponding KASP markers can provide an effective detection means for breeding new varieties of high-quality wheat, and has very important significance for improving the breeding level of high-quality wheat in China. SUMMARY
[0006] The technical problem to be solved by the present application is to provide a wheat wet gluten content related G101T SNP site and its application.
[0007] To solve the above technical problems, the technical solutions adopted by the present application are as follows.
[0008] A method for identifying or assisting in identifying the wet gluten content of wheat, characterized by: identifying or assisting in identifying the wet gluten content of wheat based on the specific genotype of a single nucleotide polymorphism site in the wheat genome.
[0009] As a preferred technical solution of the present application, the single nucleotide polymorphism site is located at the position of 80813538 bp of chromosome 6A in the Chinese Spring wheat genome IWGSC RefSeq v1.0, corresponding to the 101th base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 4, named G101T SNP; the G101T SNP genotype includes GG or TT; the wet gluten content of wheat with TT genotype is higher than or candidate higher than that of wheat with GG genotype.
[0010] As a preferred technical solution of the present application, the method for detecting the genotype of G101T SNP site in the wheat genome is to use KASP marker primer sequence to perform PCR amplification on the wheat genome DNA to be tested, and determine the genotype of the wheat to be tested after fluorescence scanning.
[0011] As a preferred technical solution of the present application, the KASP marker primer sequence includes the downstream primer R1 shown in SEQ ID NO: 1, the downstream primer R2 shown in SEQ ID NO: 2, and the upstream primer F shown in SEQ ID NO: 3.
[0012] As a preferred technical solution of the present application, the downstream primers R1 and R2 are added with FAM and HEX fluorescent linker sequences at the 5' end of the primers, respectively, for distinguishing the polymorphism difference of the G101T SNP site; the upstream primer F is a universal KASP upstream primer; the primers R1, R2 and F jointly constitute the KASP marker primer sequence.
[0013] As a preferred technical solution of the present application, the primer sequence in claim 5 is used to perform PCR amplification on the to-be-tested wheat genomic DNA, to obtain a PCR amplification product; then the fluorescence signal is converted into an analyzable numerical value, and the fluorescence scanning result is graphically displayed by using GraphPad Prism: If FAM fluorescence is distributed near the x-axis, the genotype of the G101T SNP site in the to-be-tested wheat genome is GG. If HEX fluorescence is distributed near the y-axis, the genotype of the G101T SNP site in the to-be-tested wheat genome is TT.
[0014] On the other hand, the present application also includes the application of the above-mentioned method in wheat breeding.
[0015] On the other hand, the present application also includes an allelic KASP marker primer for detecting the above-mentioned G101T SNP site, comprising the downstream primer R1 shown in SEQ ID NO: 1, the downstream primer R2 shown in SEQ ID NO: 2, and the upstream primer F shown in SEQ ID NO: 3.
[0016] On the other hand, the present application also includes a reagent or kit for detecting the above-mentioned G101T SNP site, which at least comprises the KASP marker primer sequence mentioned above.
[0017] Finally, the present application also includes the application of the allelic KASP marker primer or the reagent or kit in any one of the following (1)-(4): (1) screening or assisting in screening wheat with high wet gluten content; (2) identifying or assisting in identifying the wet gluten content of wheat; (3) identifying or assisting in identifying the genotype of wheat qWGC6A.1; (4) wheat breeding.
[0018] The beneficial effects produced by the above technical scheme are that the application provides a new G101T SNP related to the content of wheat wet gluten, which is located at the nucleotide shown in the physical position 80813538 bp of chromosome 6A of Chinese Spring wheat genome IWGSC RefSeq v1.0, and the genotype is GG or TT. The application provides a KASP marker for identifying the content of wheat wet gluten, and provides a method for identifying or assisting in identifying the content of wheat wet gluten, through which it is found that the content of wheat wet gluten with the genotype TT of G101T SNP site is higher than or is a candidate for being higher than the content of wheat wet gluten with the genotype GG. The application has extremely important significance for improving the quality of wheat flour by improving the characteristics of wheat varieties through molecular genetic improvement. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 The schematic diagram of the KASP marker primer position for allelic variation.
[0020] Figure 2 The schematic diagram of the detection results of genotyping of 391 wheat germplasms in a natural population.
[0021] Figure 3 The schematic diagram of the correlation analysis of the average content of wheat wet gluten of wheat germplasms with genotype GG and genotype TT of G101T SNP site in a natural population under different environments. DETAILED DESCRIPTION
[0022] The following examples illustrate the application in detail. The various raw materials and equipment used in the application are conventional commercially available products and can be directly obtained by market purchase. The materials and reagents used in the following examples can be obtained from commercial channels unless otherwise specified. It should be understood that when used in the specification and appended claims of the present application, the term "comprising" indicates the presence of the described features, whole, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, whole, steps, operations, elements, components and / or sets thereof. It should also be understood that the term "and / or" used in the specification and appended claims of the present application means any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.
[0023] As used in the specification and the appended claims, the term “if’ can be construed to mean “when” or “once,” or “in response to a determination” or “in response to a detection” of, depending on the context. Similarly, the phrase “if it is determined” or “if [a described condition or event] is detected” can be construed to mean “once it is determined” or “in response to a determination” or “once [the described condition or event] is detected” or “in response to the detection [of the described condition or event],” depending on the context. Additionally, the terms “a” and “an” are used herein to refer to one or to more than one (i.e. to at least one) of the singular number unless the context clearly indicates otherwise. The terms “comprise (s),” “comprise(d),” “comprising,” and “comprises” and “include(s),” “include(d),” “including,” and “includes” are open- ended, and do not exclude additional, unrecited elements or method steps. The terms “first,” “second,” “third,” etc. are used herein to describe various elements depending on the context, and are not used to indicate or imply relative importance or significance. The use of “about” or “approximately” in connection with a reference to a specific quantity means that the quantity can vary from the stated value by up to 10% of the value, unless the context clearly indicates otherwise. The use of “one or more of’ in reference to a list of elements should be understood as including any one of those elements and any combination of two or more of those elements.
[0024] Example 1: Discovery of SNP site related to wheat wet gluten content and development of KASP marker 1. Discovery of G101T SNP site A SNP was found on the QTL qWGC6A.1 related to the wet gluten content of common wheat, which is located at 80813538 bp of the physical position of chromosome 6A (reference to Chinese Spring wheat genome IWGSC RefSeq vl.0). The SNP difference site contained in the two allelic types of the SNP was named G101T SNP site, and it was found that the site existed in two genotypes G or T in the natural population of wheat. Referring to the sequence information shown in SEQ ID NO: 4: CTGTTCATCCTAAAGACCGACTGCGCTACTGCGGTGGATATGATCTGAGGCCCAGCCAGGGACCGTTCCCCTTTGGCAACCATGGTGAGTAAGATTAAAAKGTTCATGAGTATAGGTAAAGTGCATGCACTATCACACGTTCATCGAGGATAAAATGAAGTTAGTCATAAGTTGTGCCAGATGGGGAGAGTTGGTCCATG (SEQ ID NO: 4; wherein K at position 101 is G or T).
[0025] 2. Development of KASP tags To facilitate the identification and selection of G101T SNP sites related to wet gluten content in wheat, and to reduce breeding costs and workload while enhancing the operability of breeding work, it is necessary to develop the target molecular marker probe sequence into a KASP marker that can be identified and screened using conventional molecular biology methods.
[0026] The KASP marker Kasp_qWGC6A.1 and the KASP primer set for detecting this marker were designed. The sequence of wheat chromosome 6A at physical locations 80813438 bp-80813637 bp was obtained for primer design.
[0027] The KASP primer set consists of three primers: downstream primer R1 shown in SEQ ID NO: 1, downstream primer R2 shown in SEQ ID NO: 2, and upstream primer F shown in SEQ ID NO: 3.
[0028] Downstream primer R1: 5'-GAAGGTGACCAAGTTCATGCTGCACTTTACCTATACTCATGAACC-3' (SEQ ID NO: 1) Downstream primer R2: 5'-GAAGGTCGGAGTCAACGGATTATGCACTTTACCTATACTCATGAACA-3' (SEQ ID NO: 2) Upstream primer F: 5'-TTCATCCTAAAGACCGACTGCGCTA-3' (SEQ ID NO: 3) like Figure 1 As shown in the figure, the sequence is the sequence of physical location 80813438 bp-80813637 bp on wheat chromosome 6A. The positions of upstream and downstream primers marked by KASP are indicated by boxes, and the red background represents the SNP at physical location 80813538 bp on chromosome 6A.
[0029] Example 2: Establishment of a method for genotyping using the KASP marker Kasp_qWGC6A.1 1. Extract genomic DNA from the wheat samples.
[0030] Genomic DNA was extracted from common wheat using the CTAB method and dissolved in 300 μL of ultrapure water. DNA quality was assessed by 1% agarose gel electrophoresis, requiring clear bands, no obvious impurities, and no degradation. The concentration was then determined and the DNA was diluted to 28.3 ng / μL.
[0031] 2. PCR amplification.
[0032] PCR amplification was performed using diluted genomic DNA as a template.
[0033] Preparation of KASP-labeled primer working solution: Two KASP downstream primers were designed based on the SNP at physical location 80813538 bp of the wheat wet gluten content-related QTL qWGC6A.1 in wheat genome version IWGSC RefSeq v1.0. The polymorphism of this SNP site is a G / T base difference. FAM and HEX fluorescent adapter sequences were added to the 5' end of the primers, respectively. At the same time, universal KASP upstream primers were designed, referring to the KASP primer set in Example 1, including downstream primer R1 shown in SEQ ID NO: 1, downstream primer R2 shown in SEQ ID NO: 2, and upstream primer F shown in SEQ ID NO: 3. The KASP-labeled primer working solution consisted of: 12 μL each of the two downstream primers (100 μM), 30 μL of the upstream primer (100 μM), and 46 μL of ultrapure water. After mixing, the solution was stored at -20℃ for later use.
[0034] PCR amplification system: 1.5 μL template DNA, 0.0417 μL primer working solution, 0.75 μL 2×KASP Master Mix (LGC, Lot No. 13426773), and sterile ultrapure water to make up to 3 μL.
[0035] PCR reaction program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, annealing / extension for 20 s (first annealing / extension temperature is 61℃, decreasing by 0.6℃ for each cycle), 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing / extension for 1 min, 26 cycles; 72℃ extension for 3 min; store at 4℃.
[0036] 3. Genotyping determination After the PCR reaction, a fluorescence signal reader (Omega) and a fluorescence detection system (Araya) were used to convert the fluorescence signal into analyzable values. The fluorescence scanning results were graphically displayed using GraphPad Prism. G bases showed FAM fluorescence, distributed near the x-axis; T bases showed HEX fluorescence, distributed near the y-axis; the negative control (CK) showed no detectable signal, distributed near the origin. Figure 2 As shown, GG is the homozygous GG type, i.e., genotype qWGC6A.1a; TT is the homozygous TT type, i.e., genotype qWGC6A.1b; CK is the negative control.
[0037] Example 3: Application of the KASP marker Kasp_qWGC6A.1 in the identification and screening of wet gluten content in natural wheat populations. Thirty-nine thousand wheat germplasm materials from China were planted for three consecutive years (2020-2021, 2021-2022, and 2022-2023) at the Dishan Experimental Station of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences. Each year, they were sown under normal irrigation and fertilization conditions (irrigated twice, once at the jointing stage and once at the grain-filling stage, with an irrigation volume of 50 m³). 3 (nitrogen fertilizer 12 kg / mu) and low-nitrogen treatment (irrigation once each at the jointing and grain-filling stages, with an irrigation volume of 50 m³). 3 Under two conditions (6 kg / mu of nitrogen fertilizer and 6 kg / mu of nitrogen fertilizer), with a row length of 3 m, a randomized block design with three replicates.
[0038] After harvest, wheat grains were milled into flour using a Brabender mill. The wet gluten content was determined according to the national standard "Wheat and Wheat Flour Gluten Content Part 2: Instrumental Determination of Wet Gluten (GB / T 5506.2-2008)". KASP marker detection revealed that among 391 Chinese wheat germplasm materials, 225 were of the qWGC6A.1a allele type (GG homozygous), and 166 were of the qWGC6A.1b allele type (TT homozygous). Table 1 shows the allele types of wheat germplasm materials and the wet gluten content under different years and conditions.
[0039] Table 1. Results of Kasp_qWGC6A.1 marker detection in wheat germplasm and wet gluten content of wheat in different years and under different environments.
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048] Note: 1. NA indicates the absence of average wet gluten content.
[0049] 2. Genotype qWGC6A.1a is GG homozygous and qWGC6A.1b is TT homozygous.
[0050] Statistical results showed that the mean wet gluten content of wheat germplasm carrying the qWGC6A.1b allele (G101T SNP genotype TT) was significantly higher than that of wheat germplasm carrying the qWGC6A.1a allele (G101T SNP genotype GG) under different years and environments (P < 0.01). The results are shown in Table 2 and... Figure 3 As shown, Figure 3 The genotypes for 20-21 normal_G and 20-21 normal_T are qWGC6A.1a and qWGC6A.1b respectively, both under normal water and fertilizer conditions in 2020-2021. Similarly, the genotypes for 21-22 normal_G and 21-22 normal_T are qWGC6A.1a and qWGC6A.1b respectively, both under normal water and fertilizer conditions in 2021-2022. The genotypes for 22-23 normal_G and 22-23 normal_T are qWGC6A.1b and qWGC6A.1b respectively, both under normal water and fertilizer conditions in 2022-2023. -21 Low Nitrogen_G represents the genotype qWGC6A.1a of the low nitrogen treatment in 2020-2021; 20-21 Low Nitrogen_T represents the genotype qWGC6A.1b of the low nitrogen treatment in 2020-2021; 21-22 Low Nitrogen_G represents the genotype qWGC6A.1a of the low nitrogen treatment in 2021-2022; 21-22 Low Nitrogen_T represents the genotype qWGC6A.1b of the low nitrogen treatment in 2021-2022; 22-23 Low Nitrogen_G represents the genotype qWGC6A.1a of the low nitrogen treatment in 2022-2023; 22-23 Low Nitrogen_T represents the genotype qWGC6A.1b of the low nitrogen treatment in 2022-2023; ** represents P < 0.01, i.e., the difference is highly significant.
[0051] Table 2. Statistical analysis of the relationship between QTL qWGC6A.1 allelic variation type and wet gluten content of common wheat.
[0052] Note: P < 0.01 indicates that the difference is highly significant.
[0053] In summary, this invention provides the KASP marker Kasp_qWGC6A.1 for identifying the G101T SNP genotype and its correlation with wheat wet gluten content. Applying the KASP marker from this invention to marker-assisted selection of wheat wet gluten content can rapidly and efficiently screen wheat varieties with higher wet gluten content, thereby accelerating the breeding process of high-quality new wheat varieties. This invention has significant theoretical and economic value for utilizing marker-assisted selection of wheat germplasm or breeding progeny materials with higher wet gluten content.
[0054] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.
Claims
1. A method for identifying or assisting in the identification of wet gluten content in wheat, characterized in that: Identification or auxiliary identification of wheat wet gluten content based on specific genotypes at single nucleotide polymorphism sites in the wheat genome.
2. The method according to claim 1, characterized in that: The single nucleotide polymorphism site is located at position 80813538 bp on chromosome 6A in the IWGSC RefSeq v1.0 genome of Chinese spring wheat, corresponding to the 101st base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 4, and is named G101T SNP; the genotype of the G101T SNP includes GG or TT; the wet gluten content of wheat with the TT genotype is higher than or candidate to be higher than that of wheat with the GG genotype.
3. The method according to claim 2, characterized in that: The method for detecting whether the genotype of the G101T SNP site in the wheat genome is GG or TT is as follows: PCR amplification of the wheat genomic DNA to be tested is performed using a KASP-labeled primer set, and the genotype of the wheat to be tested is determined after fluorescence scanning.
4. The application according to claim 3, characterized in that: The KASP-labeled primer set includes downstream primer R1 shown in SEQ ID NO: 1, downstream primer R2 shown in SEQ ID NO: 2, and upstream primer F shown in SEQ ID NO:
3.
5. The method according to claim 4, characterized in that: The downstream primers R1 and R2 have FAM and HEX fluorescent adapter sequences added to their 5' ends, respectively, to distinguish the polymorphic differences of the G101T SNP site; the upstream primer F is a universal KASP upstream primer; primers R1, R2 and F together constitute the KASP-labeled primer set.
6. The method according to claim 5, characterized in that: The wheat genomic DNA to be tested was amplified by PCR using the primer set in claim 5 to obtain PCR amplification products; then the fluorescence signal was converted into an analyzable value, and the fluorescence scanning results were graphically displayed using GraphPad Prism. If it has FAM fluorescence and is distributed near the x-axis, then the genotype of the G101T SNP site in the wheat genome to be tested is GG; If the SNP locus in the wheat genome is HEX fluorescent and located near the y-axis, then the genotype of the G101T SNP locus is TT.
7. The application of the method according to any one of claims 1-6 in wheat breeding.
8. A set of KASP marker primers with allelic variation, characterized in that: The primers used to detect the SNP sites described in claim 2 include the downstream primer R1 shown in SEQ ID NO: 1, the downstream primer R2 shown in SEQ ID NO: 2, and the upstream primer F shown in SEQ ID NO:
3.
9. A reagent or kit, characterized in that: The reagent or kit is used to detect the SNP site described in claim 2, and includes at least the KASP-labeled primer set described in claim 5.
10. The use of KASP-labeled primers for allelic variations or the reagents or kits described herein in any of the following (1)-(4): (1) Screening or assisting in screening wheat with high wet gluten content; (2) To identify or assist in the identification of wet gluten content in wheat; (3) To identify or assist in the identification of the genotype of wheat qWGC6A.1; (4) Wheat breeding.
Citation Information
Patent Citations
Wheat glutenin and subunit component content major QTL linkage marker Wass115339
CN113699265A
KASP labeled primer related to wheat sedimentation value and application of KASP labeled primer
CN117051156A
KASP molecular marker of wheat wet gluten content major QTL QWgc.cau-2D and application of KASP molecular marker
CN117867163A
KASP molecular marker for identifying wheat precipitation value in multiple environments and application of KASP molecular marker
CN120290765A
KASP of SNP related to wheat gluten quality
CN120330374A