Primer, kit and method for rapidly detecting chloramphenicol drug-resistant gene cmlA by adopting cross primer isothermal amplification technology

Abstract

The invention discloses primers, a kit and a method for rapidly detecting a drug-resistant gene cmlA of chloramphenicol by adopting a cross primer isothermal amplification technology, and belongs to the technical field of biology. Through a cross primer isothermal amplification technology, a target sequence can be rapidly amplified at a constant temperature, and a positive result can be obtained within 1 hour; the existence of the target gene can be determined by judging whether the amplification reaction occurs or not, so that high-specificity detection of the chloramphenicol drug-resistant gene cmlA is realized, and the difficulty in specific detection of the antibiotic drug-resistant gene in the field of rapid detection is overcome. According to the method, the detection limit of a chloramphenicol-tolerant strain carrying a chloramphenicol drug-resistant gene cmlA is 2.48 pg / mu L. The method effectively solves the problems of long detection time, low sensitivity, tedious operation, high cost, limited field application and the like in the prior art, and fills the technical blank of chloramphenicol drug resistance gene specificity detection in the field of rapid detection.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to primers, kits and methods for rapidly detecting whether chloramphenicol-resistant strains carry the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology. Background Technology

[0002] Chloramphenicol is a broad-spectrum antibiotic, first isolated from Streptomyces venezuelae in 1947. It is widely used to treat infections due to its effectiveness against a variety of bacteria and was once hailed as a highly effective, broad-spectrum agent, capable of fighting many Gram-positive and Gram-negative bacteria, spirochetes, chlamydia, and rickettsiae.

[0003] The detection of the chloramphenicol resistance gene cmlA mainly relies on molecular biology techniques, such as real-time quantitative PCR (qPCR) and conventional polymerase chain reaction (PCR). Both PCR and qPCR can specifically detect the cmlA resistance gene, but they are time-consuming, have low sensitivity, require strict equipment, and are complex to operate, which limits their application to some extent.

[0004] Cross-priming amplification (CPA), a molecular biology technique based on isothermal amplification of nucleic acids, offers faster and more sensitive detection compared to traditional molecular biology techniques. Therefore, developing a proprietary detection method using cross-priming isothermal amplification to target the chloramphenicol resistance gene cmlA is of significant importance. Summary of the Invention

[0005] In order to overcome the shortcomings and deficiencies of the existing technology, the primary objective of this invention is to provide a primer for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology.

[0006] Another objective of this invention is to provide a kit for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology.

[0007] Another objective of this invention is to provide a method for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] A set of primers for rapid detection of the chloramphenicol resistance gene cmlA using cross-priming isothermal amplification technology consists of stripping primers 4S and 5A, cross primers 2A and 1S, and specific primers 2A and 3A. Their nucleotide sequences are as follows:

[0010] Peeling primer 4S: 5'-GGCGGGCTATCTTTGCGTTTC-3' (SEQ ID NO.1);

[0011] Peeling primer 5a: 5'-ACCCATTCCAGCGGCGTA-3' (SEQ ID NO.2);

[0012] Cross primer 2a1s: 5'-CACTTAACGGGGAGTAGCAGGGTTTGGGCATGATCGCT-3' (SEQ ID NO. 3);

[0013] Specific primer 2a: 5'-CACTTAACGGGGAGTAGCAG-3' (SEQ ID NO.4);

[0014] Specific primer 3a: 5'-CAAGCCCGTAACTCGTTGC-3' (SEQ ID NO.5).

[0015] A kit for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology includes the primers described above for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology.

[0016] The concentration of primers in the kit is 10 μM.

[0017] The kit also includes the following components:

[0018] A. 2× Reaction Buffer: 40.5 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% (v / v) Tween 20, 1.6 M betaine, 2.8 mM dNTPs;

[0019] B, Bst DNA polymerase;

[0020] C. CPA reaction colorimetric reagent;

[0021] The Bst DNA polymerase described in component B is preferably an aqueous solution of Bst DNA polymerase with a concentration of 8 U / μL.

[0022] The CPA reaction colorimetric agent described in component C is a mixed solution of calcein and manganese chloride (MnCl2). Preferably, the concentration of calcein in the CPA reaction colorimetric agent is 3.5 mM, and the molar ratio of calcein to manganese ions is 1:2.

[0023] The above-mentioned primers or kits for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology are applied in the rapid detection of whether chloramphenicol-resistant strains carry the chloramphenicol resistance gene cmlA.

[0024] A method for detecting chloramphenicol-resistant strains carrying the chloramphenicol resistance gene cmlA using the above-mentioned kit for non-disease diagnostic purposes includes the following steps:

[0025] (1) Extract DNA from the test strain as a template, and ensure the OD of the template DNA aqueous solution is within the specified range. 260 / OD 280 The value is in the range of 1.8 to 2.0;

[0026] (2) Establish a cross-primer isothermal amplification reaction system for detecting chloramphenicol resistance gene cmlA, and carry out the cross-primer isothermal amplification reaction by incubating in a water bath at 60-66℃ for 50-60 minutes;

[0027] The isothermal amplification reaction system for the cross-primer consisted of: 12.5 μL of 2× reaction buffer, 1.5 μL each of 10 μM stripping primer 4s and 10 μM stripping primer 5a, 2.5 μL of 10 μM cross-primer 2a1s, 1.25 μL each of 10 μM specific primer 2a and 10 μM specific primer 3a, 1.0 μL of DNA template, 1.0 μL of 8 U / μL Bst DNA polymerase, and deionized water to bring the volume to 25 μL. Finally, 1 μL of the above-mentioned concentration of CPA reaction reagent was added.

[0028] Preferably, the conditions for the cross-primer isothermal amplification reaction are incubation in a water bath at 63°C for 60 minutes.

[0029] (3) After the reaction is complete, observe the color change of the chromogenic reagent and / or take the amplified product for agarose gel electrophoresis; if the color is green, it indicates that the test strain contains the chloramphenicol resistance gene cmlA; if the color is orange, it indicates that the test strain does not contain the chloramphenicol resistance gene cmlA; if the electrophoresis result shows a ladder-shaped band, it indicates that the test strain contains the chloramphenicol resistance gene cmlA; if the electrophoresis result shows no band, it indicates that the test strain does not contain the chloramphenicol resistance gene cmlA.

[0030] The present invention has the following advantages and effects compared with the prior art:

[0031] (1) This invention proposes a cross-primer isothermal amplification detection method for the chloramphenicol resistance gene cmlA, which effectively solves the problems of long detection time, low sensitivity, cumbersome operation, high cost and limited field application in the existing technology, and fills the technical gap in the field of rapid detection of chloramphenicol resistance gene specific detection.

[0032] (2) The method of this invention is performed under isothermal conditions, eliminating the need for temperature-changing steps, significantly shortening the detection time. Amplification can be completed and results obtained within 60 minutes, which is of great value for the development of novel isothermal amplification technologies and their application in on-site microbial detection. Furthermore, this method does not rely on expensive or specialized equipment, resulting in low detection costs, making it particularly suitable for small and medium-sized food enterprises for product self-inspection and other on-site testing scenarios. Simultaneously, this invention also discloses a specific target sequence targeting the conserved region of the chloramphenicol resistance gene cmlA and designs a set of specific primers to ensure the accuracy and reliability of the detection results. Attached Figure Description

[0033] Figure 1 The results of constructing a rapid detection system for the chloramphenicol resistance gene cmlA are shown in gel image and colorimetric image under natural light; + indicates the experimental group, and - indicates the blank control group.

[0034] Figure 2 The images show the sensitivity detection gel and colorimetric images under natural light for the rapid detection system of the chloramphenicol resistance gene cmlA; lanes (reaction tubes) 1-9 represent the DNA concentrations in the reaction system as 24.80 ng / μL, 2.48 ng / μL, 248.0 pg / μL, 24.80 pg / μL, 2.48 pg / μL, 248 fg / μL, 24.8 fg / μL, 2.48 fg / μL, and the negative control. Detailed Implementation

[0035] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise expressly stated, the reagents, methods and equipment used in the present invention are all conventional reagents, methods and equipment in the art. Unless otherwise specifically stated, the reagents and materials used in the present invention are commercially available.

[0036] Example 1: Primer design for detecting the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification reaction technology.

[0037] (1) Obtain conserved sequences of all downloaded chloramphenicol resistance gene cmlA sequences from the database using MEGA.

[0038] (2) A database of all cmlA sequences was constructed. The extracted conserved sequences were then compared with this database using BLASTN to obtain the identity and coverage values ​​of conserved sequences within all cmlA sequences. After performing Clustalw on all downloaded cmlA sequences using MAGE, the conservation of the extracted conserved sequences was analyzed. Based on the above analysis, the region with the highest conservation in cmlA was identified and used for primer design.

[0039] CGTGACATTTACGCAGGTCGCGAGGAAAGTAACGTCATTTACGGCATACTCGGATCCATGCTGGCCATGGTCCCGGCGGTAGGCCCATTGCTCGGAGCGCTCGTCGACATGTGGCTTGGGTGGCGGGCTATCTTTGCGTTTCTAGGTTTGGGCATGATCGCTGCATCTGCAG CAGCGTGGCGATTCTGGCCAGAAACCCGGGTGCAACGAGTTACGGGCTTGCAATGGTCGCAGCTGCTACTCCCCGTTAAGTGCCTGAACTTCTGGTTGTACACGTTGTGTTACGCCGCTGGAATGGGTAGCTTCTTCGTCTTTTTCTCCATTGCGCCCGGACTAATAATGGGC

[0040] (4) Based on the reaction principle of cross-primer isothermal amplification, primers were designed using Primer Premier software targeting the most conserved region of cmlA; their nucleotide sequences are shown below:

[0041] Peeling primer 4S: 5'-GGCGGGCTATCTTTGCGTTTC-3' (SEQ ID NO.1);

[0042] Peeling primer 5a: 5'-ACCCATTCCAGCGGCGTA-3' (SEQ ID NO.2);

[0043] Cross primer 2a1s: 5'-CACTTAACGGGGAGTAGCAGGGTTTGGGCATGATCGCT-3' (SEQ ID NO. 3);

[0044] Specific primer 2a: 5'-CACTTAACGGGGAGTAGCAG-3' (SEQ ID NO.4);

[0045] Specific primer 3a: 5'-CAAGCCCGTAACTCGTTGC-3' (SEQ ID NO.5).

[0046] Example 2: Construction of a rapid detection system for the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification reaction technology.

[0047] (1) Required reagents:

[0048] a. Stripping primers 4s and 5a, cross primers 2a and 1s, and specific primers 2a and 3a, all at a concentration of 10 μM, with primer sequences as shown in SEQ ID NO. 1 to 5 in Example 1;

[0049] b. Prepare 2× reaction buffer:

[0050] 2× reaction buffer: 40.5 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% (v / v) Tween 20, 1.6 M betaine, 2.8 mM dNTPs;

[0051] c. An aqueous solution of Bst DNA polymerase (large fragment, NEB) at a concentration of 8 U / μL.

[0052] d. The colorimetric reagent; the colorimetric reagent is a mixed solution of calcein and manganese chloride (MnCl2), wherein the concentration of calcein is 3.5 mM and the molar ratio of calcein to manganese ions is 1:2.

[0053] (3) Extract DNA from the test strain as template DNA:

[0054] This embodiment includes both an experimental group and a blank control group. The experimental group consists of *Macrococcus caseolyticus* Mcas231220, purchased from the Microbial Resource Center of the "South China University of Technology-Finch Joint Laboratory" at Guangzhou Finch Biotechnology Co., Ltd. This *Macrococcus caseolyticus* Mcas231220 was derived from freshwater fish and previously confirmed by PCR to contain the chloramphenicol resistance gene cmlA. Nucleic acid-free water was used as the blank control.

[0055] Bacterial DNA was extracted using a rapid bacterial genomic DNA extraction kit (Guangdong Dongsheng Biotechnology Co., Ltd.). The kit was operated according to the instructions. The OD value of the aqueous bacterial DNA solution obtained in the experimental group was... 260 / OD 280 The value (the ratio of absorbance at 260nm and 280nm) is 1.8.

[0056] (4) Establish a cross-primer isothermal amplification reaction system for detecting the cmlA gene:

[0057] Prepare a 25 μL isothermal amplification reaction system for the cross-primers in a reaction tube: add 12.5 μL of 2× reaction buffer, 3.0 μL of a mixture of equal volumes of 4S and 5A primers, 2.5 μL of cross-primer 2a1S, 2.5 μL of a mixture of equal volumes of specific primers 2a and 3a, 1 μL of Bst DNA polymerase, and 1.0 μL of DNA template. Add deionized water to bring the volume to 25 μL. Finally, add 1 μL of the above-mentioned concentration of CPA chromogenic solution and mix well. The concentrations of each substance at this point were: Tris-HCl 20.25 mM, ammonium sulfate 10.0 mM, potassium chloride 10.0 mM, magnesium sulfate 8.0 mM, Tween 20 0.1% (v / v), betaine 0.8 M, dNTPs 1.4 mM, Bst DNA polymerase 8 U / system, stripping primers 4S and 5A each 0.6 μM, cross-linking primer 2A1S 1.0 μM, and specific primers 2A and 3A each 0.5 μM. The reaction tubes were placed in a 63°C water bath and incubated for 60 minutes.

[0058] Electrophoresis results and color development results are as follows Figure 1 As shown, + indicates the experimental group, and - indicates the blank control group. In the experimental group, green indicates the presence of the chloramphenicol resistance gene cmlA, and the electrophoresis result shows a trapezoidal band; orange indicates the absence of the chloramphenicol resistance gene cmlA.

[0059] Example 3: Sensitivity Comparison Test of the Method for Detecting Chloramphenicol-Resistant Strains Carrying the Chloramphenicol Resistance Gene cmlA Using Cross-Primer Isothermal Amplification Reaction Technology

[0060] Genomic DNA from the chloramphenicol-resistant strain *M. caseinosus megaterium* Mcas231220, carrying the chloramphenicol resistance gene cmlA, was serially diluted 10-fold to 24.80 ng / μL, 2.48 ng / μL, 248.0 pg / μL, 24.80 pg / μL, 2.48 pg / μL, 248 fg / μL, 24.8 fg / μL, and 2.48 fg / μL. A negative control (nucleic acid-depleted water) was also included. A cross-isothermal amplification method was constructed according to the reaction system described in Example 2, and the amplification products were subjected to 2% agarose gel electrophoresis to determine the sensitivity of the detection method.

[0061] Electrophoresis results as follows Figure 2 As shown, the results indicate that the cross-primer isothermal amplification reaction method for the chloramphenicol resistance gene cmlA established in this invention can detect chloramphenicol-resistant strains carrying the chloramphenicol resistance gene cmlA in samples with a DNA concentration of 2.48 pg / μL.

[0062] in conclusion:

[0063] The experimental results above show that the cross-isothermal amplification reaction method has the following advantages compared to existing detection methods:

[0064] Fast and accurate: The target sequence can be rapidly amplified at a constant temperature using cross-primer isothermal amplification technology, and a positive result can be obtained within 1 hour; at the same time, due to the use of multiple primers, the accuracy of the detection results is extremely high.

[0065] High specificity: The presence of the target gene can be determined by judging whether the amplification reaction occurs, realizing the high specificity detection of the chloramphenicol resistance gene cmlA, overcoming the problem of specific detection of antibiotic resistance genes in the field of rapid detection.

[0066] High sensitivity: The detection limit of this method for chloramphenicol-resistant strains carrying the chloramphenicol resistance gene cmlA is 2.48 pg / μL, and its sensitivity is more than 100 times that of conventional PCR.

[0067] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A set of primers for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology, characterized in that, It consists of stripping primers 4S and 5A, cross primer 2A1S, and specific primers 2A and 3A, and its nucleotide sequence is as follows: 4S primer stripping: 5'-GGCGGGCTATCTTTGCGTTTC-3'; Peeling primer 5a: 5'-ACCCATTCCAGCGGCGTA-3'; Cross primer 2a1s: 5'-CACTTAACGGGGAGTAGCAGGGTTTGGGCATGATCGCT-3'; Specific primer 2a: 5'-CACTTAACGGGGAGTAGCAG-3'; Specific primer 3a: 5'-CAAGCCCGTAACTCGTTGC-3'.

2. A kit for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology, characterized in that, Includes the primers described in claim 1 for rapid detection of the chloramphenicol resistance gene cmlA using cross-primer isothermal amplification technology.

3. The reagent kit according to claim 2, characterized in that: The concentration of primers in the kit is 10 μM.

4. The reagent kit according to claim 2, characterized in that: The kit also includes the following components: A. 2× reaction buffer: 40.5 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% Tween 20, 1.6 M betaine, 2.8 mM dNTPs; B, Bst DNA polymerase; C. CPA reaction colorimetric reagent; The CPA reaction colorimetric agent described in component C is a mixed solution of calcein and manganese chloride.

5. The reagent kit according to claim 4, characterized in that: The Bst DNA polymerase described in component B is an aqueous solution of Bst DNA polymerase at a concentration of 8 U / μL.

6. The reagent kit according to claim 4, characterized in that: The concentration of calcein in the CPA reaction colorimetric reagent is 3.5 mM, and the molar ratio of calcein to manganese ions is 1:

2.

7. The use of the primers of claim 1 or the kits of any one of claims 2 to 6 in the rapid detection of whether chloramphenicol-resistant strains carry the chloramphenicol resistance gene cmlA.

8. A method for detecting chloramphenicol-resistant strains carrying the chloramphenicol resistance gene cmlA using the kit according to any one of claims 2 to 6 for non-disease diagnostic purposes, characterized in that, Includes the following steps: (1) Extract DNA from the test strain as a template, and ensure the OD of the template DNA aqueous solution is within the specified range. 260 / OD 280 The value is in the range of 1.8 to 2.0; (2) Establish a cross-primer isothermal amplification reaction system for detecting the chloramphenicol resistance gene cmlA, and carry out the cross-primer isothermal amplification reaction by incubating in a water bath at 60-66℃ for 50-60 minutes; (3) After the reaction is complete, observe the color change of the chromogenic reagent and / or take the amplified product for agarose gel electrophoresis; if the color is green, it indicates that the test strain contains the chloramphenicol resistance gene cmlA; if the color is orange, it indicates that the test strain does not contain the chloramphenicol resistance gene cmlA; if the electrophoresis result shows a ladder-shaped band, it indicates that the test strain contains the chloramphenicol resistance gene cmlA; if the electrophoresis result shows no band, it indicates that the test strain does not contain the chloramphenicol resistance gene cmlA.

9. The method according to claim 8, characterized in that: In step (2), the cross-primer isothermal amplification reaction system is as follows: 12.5 μL of 2× reaction buffer, 1.5 μL each of 10 μM stripping primer 4s and 10 μM stripping primer 5a, 2.5 μL of 10 μM cross primer 2a1s, 1.25 μL each of 10 μM specific primer 2a and 10 μM specific primer 3a, 1.0 μL of DNA template, 1.0 μL of 8 U / μL Bst DNA polymerase, and the volume is made up to 25 μL with deionized water; finally, 1 μL of CPA reaction colorimetric reagent is added. In step (2), the conditions for the cross-primer isothermal amplification reaction are to keep it in a water bath at 63°C for 60 minutes.

Images