Molecular marker for identifying paphiopedilum leaf variants and application thereof

Abstract

The present application provides a molecular marker for identifying Paphiopedilum giganteum var. insigne, which is four AT-rich DNA sequences. The present application also provides a method for identifying Paphiopedilum giganteum var. insigne using the molecular marker, wherein total DNA is extracted from a sample, high-throughput sequencing is performed, and the sequencing reads are aligned to the molecular marker, and if the molecular marker can be completely covered, it is determined that the species of the sample is Paphiopedilum giganteum var. insigne.

Description

Technical Field

[0001] This case claims priority to the invention patent filed on May 6, 2025, with application number 2025105744336, entitled "Molecular Marker for Identifying Leaf Variation of Paphiopedilum and Its Application", the entire text of which is incorporated herein by reference.

[0002] This invention belongs to the field of biotechnology, specifically relating to a molecular marker for a leaf variant of Paphiopedilum macrocarpa and its application. Background Technology

[0003] *Paphiopedilum bellatulum* (Rchb. f) Stein, belonging to the genus *Paphiopedilum*, subgenus *Paphiopedilum*, section *Homo spp.*, subfamily Cypripedioideae, family Orchidaceae, has broadly elliptical petals. The entire flower is white with numerous purplish-brown spots. It is listed in Appendix I of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) and is strictly protected internationally. It is also one of the most valuable horticultural breeding materials in the *Paphiopedilum* genus, possessing high conservation and ornamental value. The leaves of *Paphiopedilum bellatulum* are dark green with alternating light and dark green reticulated markings on the ventral side and densely covered with coarse, dark purple spots on the dorsal side.

[0004] During long-term surveys and ex-situ conservation efforts of wild Paphiopedilum germplasm resources, researchers discovered a variant of Paphiopedilum bellatulum with light green undersides of its leaves, known as the "plain-leaved" variant (P. bellatulum f. viridis). The main difference between this variant and the original species lies in the color of the undersides of its leaves; the plain-leaved variant has light green undersides, while the original species has purplish-red undersides. The plain-leaved variant has significant scientific value in the systematic evolution and leaf color development of the Paphiopedilum genus, and its refreshing color is highly favored by consumers.

[0005] However, the undersides of the leaves of the *Paphiopedilum giganteum* seedling are green, just like the original *Paphiopedilum giganteum* species, making them easily confused. This poses a significant challenge to the effective development and utilization of the *Paphiopedilum giganteum* seedling. Currently, the conservation and utilization research of *Paphiopedilum* species has received widespread attention; however, species identification is fundamental to this research, and there are currently no molecular markers for accurately identifying the *Paphiopedilum giganteum* seedling. Therefore, developing molecular markers that can accurately distinguish between the *Paphiopedilum giganteum* seedling and the original *Paphiopedilum giganteum* species is of great significance for the identification of *Paphiopedilum* germplasm resources and hybridization breeding. Summary of the Invention

[0006] To overcome the aforementioned difficulties, we used a next-generation sequencing-based method to obtain two AT-enriched fragments of the *Paphiopedilum giganteum* leaf variant. Analysis showed that these fragments did not exhibit high homology with any existing *Paphiopedilum* genome, making them suitable as reference sequences for identifying the *Paphiopedilum giganteum* leaf variant. Furthermore, we designed a reliable method for identifying the *Paphiopedilum giganteum* leaf variant using the sequencing data. The technical solution adopted in this invention is as follows:

[0007] On the one hand, the present invention provides a molecular marker for identifying or assisting in the identification of Paphiopedilum macrocarpa leaf variants, the nucleic acid sequence of which is shown in any one of SEQ ID NO.1 to SEQ ID NO.4.

[0008] On the other hand, another object of the present invention is to provide the application of the above-mentioned molecular markers in the identification or auxiliary identification of leaf variants of Paphiopedilum giganteum.

[0009] On the other hand, the present invention provides a method for identifying or assisting in the identification of leaf variants of Paphiopedilum giganteum, characterized by comprising the following steps:

[0010] 1) Collect the green tissue of the Paphiopedilum orchid to be tested as the sample;

[0011] 2) Extract total DNA from the sample to be tested;

[0012] 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads;

[0013] 4) Assemble the sequencing data and align the assembled contigs with the aforementioned molecular markers;

[0014] 5) Perform sequence alignment between the contigs that can completely cover the molecular marker and have the highest consistency with the molecular marker, and determine whether the sample is a giant slipper orchid leaf variant based on the alignment results; if they are consistent with the molecular marker sequence, the species of the sample to be tested is determined to be a giant slipper orchid leaf variant.

[0015] On the other hand, the present invention provides a method for identifying or assisting in the identification of leaf variants of Paphiopedilum giganteum, characterized by comprising the following steps:

[0016] 1) Collect the green tissue of the Paphiopedilum orchid to be tested as the sample;

[0017] 2) Extract total DNA from the sample to be tested;

[0018] 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads;

[0019] 4) Using the default parameters of Geneious software, align the above sequencing reads to the DNA molecular markers described in this application;

[0020] 5) Determine whether the sample contains the Paphiopedilum leaf variant based on the coverage of sequencing reads on the DNA molecular marker; if the molecular marker is completely covered and a consistent sequence that is completely consistent with the DNA molecular marker is generated, it is determined that the species of the sample to be tested contains the Paphiopedilum leaf variant.

[0021] In one embodiment, step 3) involves grouping multiple sample sequencing reads together.

[0022] In one embodiment, if multiple sample sequencing reads are mixed and grouped in step 3), the process further includes step 6), which further divides the samples containing the Paphiopedilum leaf variant into two groups, mixes the sequencing reads in each group, and repeats step 5) until the Paphiopedilum leaf variant of a single sample is identified.

[0023] In one embodiment, the high-throughput sequencing described in step 3) is second-generation sequencing or third-generation sequencing.

[0024] In one embodiment, step 4) uses any one of the software Geneious, Bowtie, Tophat, or HISAT to compare reads.

[0025] In one embodiment, any one of the sequences SEQ ID NO.1 to SEQ ID NO.4 is used alone.

[0026] In one embodiment, SEQ ID NO.1 to SEQ ID NO.4 are used together.

[0027] On the other hand, the present invention provides any of the following applications of the above-mentioned molecular markers:

[0028] (1) Application in identifying the leaf variant of Paphiopedilum macrocarpa;

[0029] (2) Application in the identification, improvement or molecular marker-assisted breeding of Paphiopedilum giant petal germplasm resources;

[0030] (3) Application in screening or creating different giant-petaled Paphiopedilum varieties;

[0031] (4) Application in the DNA fingerprint database of leaf variants of Paphiopedilum macropetalum;

[0032] (5) Application in seedling quality testing of Paphiopedilum macrocarpa leaf variant.

[0033] The beneficial effects of this invention are:

[0034] First, this invention provides, for the first time, four AT-enriched fragments of the genome of the *Paphiopedilum giganteum* leaf variant. Analysis showed that these fragments did not exhibit high homology with any other existing *Paphiopedilum* genomes, making them suitable as reference sequences for identifying the *Paphiopedilum giganteum* leaf variant.

[0035] Secondly, the present invention can extract total DNA from mixed samples, such as directly collected green tissues, obtain the DNA information of the samples through high-throughput sequencing, and identify whether the samples contain the Paphiopedilum leaf variant by comparing with reference sequences.

[0036] Third, this invention can directly use high-throughput sequencing to identify or assist in the identification of Paphiopedilum macrocarpa leaf variants, eliminating the need for primer design, avoiding the difficulty of primer design, and providing convenient operation and high sensitivity.

[0037] Fourth, the present invention provides four specific markers that can be used alone or in combination, with the combination being more accurate. Attached Figure Description

[0038] The beneficial effects of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0039] Figure 1 This is the alignment result of the molecular marker SEQ ID NO.1 of the Paphiopedilum macrocarpa leaf variant in the NCBI nr / nt library.

[0040] Figure 2 This is the alignment result of the molecular marker SEQ ID NO.2 of the Paphiopedilum macrocarpa leaf variant in the NCBI nr / nt library.

[0041] Figure 3 This is the alignment result of the molecular marker SEQ ID NO.3 of the Paphiopedilum macrocarpa leaf variant in the NCBI nr / nt library.

[0042] Figure 4 These are the alignment results of different Paphiopedilum sequencing assembly sequences with molecular marker SEQ ID NO.1, where 1 is the reference sequence, 2-3 are Paphiopedilum macropetalum leaf variants, 4, 5, and 8 are common Paphiopedilum macropetalum, 6-7 are Paphiopedilum wenshanense, 9 is Paphiopedilum snow white, and 10-11 are Paphiopedilum monochromatic.

[0043] Figure 5 These are the alignment results of different Paphiopedilum sequencing assembly sequences with molecular marker SEQ ID NO.2, where 1 is the reference sequence, 2-3 are Paphiopedilum macropetalum leaf variants, 4-6 are common Paphiopedilum macropetalum, 7-8 are Paphiopedilum monochromatic, 9-10 are Paphiopedilum wenshanense, and 11 is Paphiopedilum snow white.

[0044] Figure 6These are the alignment results of different Paphiopedilum sequencing assembly sequences with molecular marker SEQ ID NO.3, where 1 is the reference sequence, 2-3 are Paphiopedilum macropetalum leaf variants, 4, 5, and 11 are common Paphiopedilum macropetalum, 6-7 are Paphiopedilum wenshanense, 9 is Paphiopedilum snow white, and 8 and 10 are Paphiopedilum of the same color.

[0045] Figure 7 These are the alignment results of different Paphiopedilum sequencing assembly sequences with molecular marker SEQ ID NO.4, where 1 is the reference sequence, 2-3 are Paphiopedilum macropetalum leaf variants, 4, 6, and 11 are common Paphiopedilum macropetalum, 7-8 are Paphiopedilum monochromatic, 9-10 are Paphiopedilum wenshanense, and 5 is Paphiopedilum snow white.

[0046] Figure 8 These are the results of high-throughput sequencing reads from samples containing the Paphiopedilum leaf variant being aligned to the molecular marker SEQ ID NO.1 of the Paphiopedilum leaf variant.

[0047] Figure 9 These are the results of high-throughput sequencing reads from samples containing the Paphiopedilum leaf variant being aligned to the molecular marker SEQ ID NO.2 of the Paphiopedilum leaf variant.

[0048] Figure 10 These are the results of high-throughput sequencing reads from samples containing the Paphiopedilum leaf variant aligned to the molecular marker SEQ ID NO.3 for the Paphiopedilum leaf variant. Figure 10 A is a screenshot of the 5' end after reads alignment. Figure 10 B is a screenshot of the 3' end after the reads are compared.

[0049] Figure 11 These are the results of high-throughput sequencing reads from samples containing the Paphiopedilum leaf variant being aligned to the molecular marker SEQ ID NO.4 of the Paphiopedilum leaf variant.

[0050] Figure 12 The results are the high-throughput sequencing reads of samples without the Paphiopedilum leaf variant aligned to the molecular marker SEQ ID NO.1 of the Paphiopedilum leaf variant.

[0051] Figure 13 The results are obtained by aligning high-throughput sequencing reads from samples that do not contain the Paphiopedilum leaf variant to the molecular marker SEQ ID NO.2 of the Paphiopedilum leaf variant.

[0052] Figure 14 The results are obtained by aligning high-throughput sequencing reads from samples that do not contain the Paphiopedilum leaf variant to the molecular marker SEQ ID NO.3 for the Paphiopedilum leaf variant.

[0053] Figure 15The results are obtained by aligning high-throughput sequencing reads from samples that do not contain the Paphiopedilum leaf variant to the molecular marker SEQ ID NO.4 of the Paphiopedilum leaf variant. Detailed Implementation

[0054] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0055] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0056] Example 1: Molecular markers for leaf variants of Paphiopedilum giganteum

[0057] This invention, through sequencing assembly and comparative analysis, determined the standard detection sequence for the molecular marker of the leaf variant of Paphiopedilum spp., specifically as follows:

[0058] 5'-CAACATAGGTCAAGTCGCACTCGATCAAAAATCATAATCATAATGTCTATTTTCTATTCATTCGGTATCCACGTATAAAAATTCCAGCTCTGTAGTTTACACTGTTCTGGGGTTTACATATACACATATAATATTATAATTAATATTAATATTTATATAATTAATATTAATATTTAGAATATAATATTAGAATATATTTAGAATAT-3' (SEQ ID NO. 1);

[0059] 5'-TATCCATCTTATATATCTTATATATAATAATAAATAATAATAAATATAATAATAATATATAATATATAATATATAATAATATATATTTAATATTTAATTTTATATTTTTTTTATTATTTTTATTATTTCCAATTTTCCAATTCTTTAAATTTCAATAGAATCTATTGACTAAGAA-3' (SEQ ID NO. 2);

[0060] 5'--3' (SEQ ID NO.3);

[0061] 5'-TATTATATTTATGTTATATTTATATGTATTTATATGTATAATATTATATTTGATATTATAGATATTATAATATTTATATTTGATATTATAGATATTATAATATTTATATTTGATATTATATTATATTTTATTATTTTATTTATATTTATTAATATTAATTTTATTAATATTTAAAATAATAAATATTTTTTAAATTATGAAATTATAAATATTTAAAAATTAGAAATATAAAATAATATAA-3'(SEQ ID NO.4).

[0062] Example 2: Molecular markers and sequence alignment of the leaf variant of Paphiopedilum giganteum with closely related species

[0063] To determine the species specificity of the molecular markers described in this invention, they were submitted to NCBI for online BLAST alignment, using the nr / nt library, without species limitation. Figures 1-3As shown, the molecular marker described in this invention was found to be closely related to *Paphiopedilum* species in the NCBI nr / nt library. The "Highly similar sequences (megablast)" parameter was selected. Figure 1 The sequence with the highest similarity to SEQ ID NO.1 is *P. bellatulum*, with a similarity of 96.71%. Selecting the "Somewhat similar sequences (blastn)" parameter... Figure 2 The species with the highest consistency with SEQ ID NO.2 is *P. bellatulum*, with a consistency rate of 96.07%. Figure 3 The highest homology for SEQ ID NO. 3 was observed in *P. bellatulum*, with a homology of 90.07%. SEQ ID NO. 4 showed no highly homologous sequences in the nr database, indicating that the molecular marker described in this invention has extremely high specificity. In addition to distinguishing the *P. bellatulum* leaf variant from the normal *P. bellatulum*, the molecular marker of this invention can also differentiate it from other *Paphiopedilum* species.

[0064] Example 3: Identification Method of Leaf Variation in Paphiopedilum 'Giant Petal' 1

[0065] 1) Collect the green tissue (such as leaves) of the Paphiopedilum to be tested as the test sample;

[0066] 2) Extract total DNA from the sample to be tested;

[0067] 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads;

[0068] 4) Assemble the sequencing data and align the assembled contigs with the aforementioned molecular markers;

[0069] 5) Perform sequence alignment between the contigs that can completely cover the molecular marker and have the highest consistency with the molecular marker, and determine whether the sample is a Paphiopedilum leaf variant based on the alignment results; if they are consistent with the molecular marker sequence, the species of the sample to be tested is determined to be Paphiopedilum leaf variant, otherwise the opposite result is obtained.

[0070] Test results as follows Figures 4-7 As shown, two of the giant slipper orchid leaf variant sequences (samples 2-3) are completely identical to the molecular marker in Example 1 (sample 1), while the homologous sequences of the other species are different from the molecular marker sequences in Example 1, indicating that the method of the present invention can accurately identify the giant slipper orchid leaf variant.

[0071] Example 4: Identification Method of Leaf Variation in Paphiopedilum 'Giant Petal' 2

[0072] 1) Collect green tissue (such as leaves) as the sample to be tested;

[0073] 2) Extract total DNA from the sample to be tested;

[0074] 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads;

[0075] 4) Using the default parameters of Geneious software, align the above sequencing reads to the DNA molecular markers described in this application;

[0076] 5) Determine whether the sample contains the Paphiopedilum leaf variant based on the coverage of sequencing reads on the DNA molecular marker; if the molecular marker is completely covered and a consistent sequence that is completely identical to the DNA molecular marker is generated, it is determined that the species of the sample to be tested contains the Paphiopedilum leaf variant.

[0077] 6) If multiple sample sequencing reads are mixed and grouped in step 4), then step 6) further includes dividing the samples containing the Paphiopedilum leaf variant into two groups, mixing the sequencing reads separately, and repeating step 5) until the Paphiopedilum leaf variant of a single sample is identified.

[0078] See results Figures 8-15 , Figures 8-11 The sequencing reads from samples containing the Paphiopedilum leaf variant completely covered SEQ ID NO.1 to SEQ ID NO.4, generating sequences identical to those in SEQ ID NO.1 to SEQ ID NO.4. Figures 12-15 The sequencing reads of samples without the *Paphiopedilum giganteum* leaf variant (containing *Paphiopedilum simianum*, *Paphiopedilum vensanense*, *Paphiopedilum var. spp.*, *Paphiopedilum var. spp.*, *Paphiopedilum spp.*, *Paphiopedilum spp.*, *Paphiopedilum henryi*, *Paphiopedilum tigrinum*, *Paphiopedilum var. spp.*, *Paphiopedilum var. spp.*, *Paphiopedilum var. spp.*, and *Paphiopedilum var. spp.*) could not generate sequences identical to SEQ ID NO. 1 to SEQ ID NO. 4. Figure 14 and Figure 15 There is a noticeable gap. Figure 14 Due to the length of the sequence, the specific sequence is not displayed. Red represents A bases, green represents T bases, blue represents C bases, yellow represents G bases, and the area within the red box is the gap (the black part in the consistency sequence).

[0079] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A molecular marker for identifying or assisting in the identification of leaf variants of Paphiopedilum macrocarpa, characterized in that, The molecular marker contains at least one sequence of SEQ ID NO.1 to SEQ ID NO.

4.

2. The molecular marker as described in claim 1, characterized in that, The molecular markers comprise all sequences of SEQ ID NO.1 to SEQ ID NO.

4.

3. A method for identifying or assisting in the identification of leaf variants of Paphiopedilum macrocarpa, characterized in that... Includes the following steps: 1) Collect the leaves of the Paphiopedilum orchid to be tested as the test samples; 2) Extract total DNA from the sample to be tested; 3) Perform high-throughput sequencing on the total DNA to obtain sequencing reads; 4) Assemble the sequencing data and align the assembled contigs with the molecular markers described in claim 1; 5) The contigs that can completely cover the molecular markers of claim 1 and have the highest consistency are sequence compared with the molecular markers of claim 1. Based on the comparison results, it is determined whether the sample is a Paphiopedilum leaf variant. If the sequence is consistent with the molecular markers of claim 1, it is determined that the species of the sample to be tested is Paphiopedilum leaf variant.

4. A method for identifying or assisting in the identification of leaf variants of Paphiopedilum macrocarpa, characterized in that... Includes the following steps: 1) Collect leaf tissue from the Paphiopedilum orchid to be tested as the sample; 2) Extract total DNA from the sample to be tested; 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) Align the above sequencing reads to the molecular marker described in claim 1; 5) Determine whether the sample contains the Paphiopedilum leaf variant based on the coverage of sequencing reads on the molecular markers; if the molecular markers are completely covered and a consistent sequence that is completely identical to the DNA molecular markers is generated, it is determined that the species of the sample to be tested contains the Paphiopedilum leaf variant.

5. The method for identifying or assisting in the identification of leaf variants of Paphiopedilum giganteum as described in claim 4, characterized in that, If in step 3) multiple sample sequencing reads are mixed and grouped after obtaining sequencing reads, then step 6) is further included after step 5): the samples containing the Paphiopedilum leaf variant are further divided into two groups, and the sequencing reads are mixed separately, and step 5) is repeated until the Paphiopedilum leaf variant of a single sample is identified.

6. The method for identifying or assisting in the identification of leaf variants of Paphiopedilum giganteum as described in claim 3, characterized in that, The high-throughput sequencing mentioned in step 3) is either second-generation sequencing or third-generation sequencing.

7. The method for identifying or assisting in the identification of leaf variants of Paphiopedilum macrocarpa as described in any one of claims 4 to 5, characterized in that, Step 4) Use any of the following software, Geneious, Bowtie, Tophat, or HISAT, to compare the reads.

8. The use of the molecular marker as a reference sequence in the method for identifying or assisting in the identification of Paphiopedilum macrocarpa leaf variants.

Images