Molecular marker closely linked with soybean main stem node number QTL qNN10 and application thereof

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked with soybean main stem node number QTL qNN10 and application. A main stem node number QTL qNN10 is identified on a No.10 chromosome of a soybean by utilizing whole genome association analysis, the remarkably associated SNP of the QTL qNN10 is located at 45th, 310 and 798th basic groups of the No.10 chromosome of a reference genome Glycinemaxv2.1, and 0.63%-2.71% of phenotypic variation can be explained. The PARMS marker developed by the SNP is used for detecting 256 soybean varieties, typing is clear, operation is easy and convenient, and the PARMS marker is suitable for soybean main stem node number molecular breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to a molecular marker closely linked to the number of main stem nodes in soybean QTLqNN 10 and its application. Background Technology

[0002] Soybean (Glycine max L.) is an important dual-purpose crop for food and oil in the world and a major source of high-quality plant protein for humans. It plays an important role in the daily consumption of Chinese people. Exploring the high-yield potential of soybeans and breeding high-yield soybean varieties are the goals that scientific researchers are constantly pursuing.

[0003] The number of nodes on the main stem of soybean has a significant impact on soybean grain yield, reflecting the vigor of plant growth and branching ability. It also affects the plant's structural morphology, ventilation, and lodging resistance, making it a crucial trait of great interest to soybean breeders. However, as a typical quantitative trait, it exhibits continuous variation and is profoundly influenced by environmental factors, making the correspondence between phenotypic values ​​and genotypes difficult to determine, thus limiting traditional agronomic and genetic research. Currently, dozens of QTL loci and related regulatory genes affecting the number of nodes on the main stem of soybean have been identified. Soybean pod-setting behavior is closely related to plant height and the number of nodes on the main stem. Dt1 and Dt2 are important genes affecting the number of nodes on the main stem of soybean. They are involved in the signal transduction and regulation of plant hormones, influencing the growth and development of the soybean main stem, thereby affecting the number of nodes and branches. The Dt1 gene is homologous to the Terminal flower1 gene in Arabidopsis thaliana and plays a negative regulatory role in the number of nodes on the main stem. Mutations in the Dt1 gene inhibit plant growth and development, leading to premature termination of main stem development. Conversely, the Dt2 gene encodes a positive regulator that promotes plant growth and development, thereby delaying main stem termination and reducing the number of branches. These key genes are of great significance to the molecular mechanisms of soybean growth and development and provide important theoretical basis and practical guidance for soybean plant architecture breeding.

[0004] This invention is based on an associated population constructed from 768 core soybean germplasm resources from home and abroad. Combining population genotype data and main stem node number phenotype data, genome-wide association analysis was used to identify a major QT L locus qNN10 that regulates the variation in soybean main stem node number. A PARMS marker closely linked to it was also developed, which can be used to assist in the breeding of ideal soybean plant type. Summary of the Invention

[0005] The purpose of this invention is to provide a reagent for detecting bases at position 45,310,798 of soybean chromosome 10 and its application in soybean main stem node number screening breeding.

[0006] Another object of the present invention is to provide the application of a reagent for detecting bases at position 45,310,798 of soybean chromosome 10 in the preparation of a soybean main stem node screening kit.

[0007] The final objective of this invention is to provide a method for screening and breeding soybean main stem nodes.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] Obtaining a molecular marker tightly linked to the soybean main stem node number QTL qNN10:

[0010] (1) Population Construction and Phenotypic Identification: 768 soybean accessions with broad genetic diversity from 23 provinces in my country were selected as core resources to construct soybean-related populations. They were planted at the Chongqing Academy of Agricultural Sciences Baishiyi Base (2023CQ) in 2023, the Anhui Academy of Agricultural Sciences Hefei Experimental Base (2024HF) in 2024, and the Hubei Academy of Agricultural Sciences Wuhan Base (2024WH) in 2024. The field trials employed a randomized block design with three replicates. Planting was done in two rows, with 20 plants per family per row, 2m long and 0.5m apart. After maturity, the number of main stem nodes was examined in 10 plants per row. The average of the three replicates for each environment was taken as the phenotypic value for that environment.

[0011] (2) Genotyping analysis: Using the BGI T7 sequencing platform, whole-genome resequencing was performed on 768 materials from the associated population. Genotyping was performed on the 768 materials using resequencing technology. The average sequencing depth was ~20×, and SNPs with a deletion rate >10% and a minimum allele frequency <0.05 were filtered out. Finally, 6,339,330 high-quality SNPs were retained for whole-genome association analysis.

[0012] (3) Genome-wide association analysis: A mixed linear model (MLM) was used in GEMMAX software for association analysis, with a significance threshold set at P≤1 / n (n being the number of SNPs, 6,339,330). The results showed a stable associated QTL locus, qNN10, on chromosome 10, which was significantly associated in the 2023CQ, 2024HF, and 2024WH environments, explaining 0.63%–2.71% of the phenotypic variation. Its peak SNP marker was named S10_45310798, located at base 45310798 on chromosome 10 of the soybean genome reference genome (Glycine_max_v2.1), with an allele of A / T. In the 2023CQ, 2024HF, and 2024WH environments, materials containing alleles with a higher number of main stem nodes had an average number of main stem nodes that was 37.37%–45.94% higher than materials containing alleles with a lower number of main stem nodes.

[0013] (4) PARMS marker development: Specific primers were designed based on the upstream and downstream sequences of the S10_45310798 site to construct a PARMS detection system. The primer sequences are as follows:

[0014] PARMS10:AGAATAGCTTCCACTGTAGCA,

[0015] PARMS10P1: GAAGGTGACCAAGTTCATGCATCAGAGGCATGTCTTATGA, and PARMS10P2: GAAGGTCGGAGTCAACGGATATCAGAGGCATGTCTTATGT.

[0016] The scope of protection of this invention includes:

[0017] Application of reagents for detecting the genotype of soybean chromosome 10 at positions 45,310,798 in soybean main stem node number breeding.

[0018] Application of reagents for detecting bases at positions 45,310,798 on soybean chromosome 10 in the preparation of a soybean main stem node screening kit.

[0019] In the above-described applications, if the base at position 45,310,798 of soybean chromosome 10 is detected as A, then the soybean is determined to be a multi-stem node type material.

[0020] In the above-described applications, if the base at position 45,310,798 of soybean chromosome 10 is detected as T, then the soybean is determined to be a material with few main stem nodes.

[0021] In the above applications, the preferred reagent is a primer.

[0022] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by the present invention: PARMS10: AGATAGCTTCCACTGTAGCA, PARMS10P1: GAAGGTGACCAAGTTCATGCATCAGAGGCATGTCTTATGA and PARMS10P2: GAAGGTCGGAGTCAACGGATATCAGAGGCATGTCT TATGT.

[0023] A method for screening soybean main stem nodes includes detecting bases at position 45,310,798 of soybean chromosome 10 using conventional methods in the art. These conventional methods include, but are not limited to, sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry.

[0024] The version number of the soybean reference genome used in this invention is Glycine_max_v2.1, and the URL is https: / / ensembl.gr amene.org / Glycine_max / .

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The QTL qNN10 identified in this invention is stably expressed under three environmental conditions and can explain 0.63% to 2.71% of the phenotypic variation in the number of main stem nodes, and has high breeding application value.

[0027] (2) The developed PARMS markers are easy to operate, low in cost, and have clear typing, making them suitable for high-throughput screening of large-scale breeding populations. Attached Figure Description

[0028] Figure 1 The frequency distribution of main stem nodes of 768 soybean materials under three environments is shown in the figure.

[0029] Figure 2 Manhattan plot of genome-wide association analysis results for soybean main stem node number.

[0030] Figure 3 Comparison of the number of main stem nodes for different genotypes (A vs T) of qNN10 under 3 environments. Detailed Implementation

[0031] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The version number of the soybean reference genome used in this invention is Glycine_max_v2.1, and the URL is https: / / ensembl.gramene.org / Glycine_max / .

[0032] Example 1:

[0033] SNP molecular markers significantly associated with soybean main stem node number QTL qNN10:

[0034] Test materials: 768 soybean accessions with broad genetic diversity from 23 provinces in my country were used as core resources to construct a soybean-related population.

[0035] (1) Identification of main stem node number in soybean populations: Soybeans were planted at the Chongqing Academy of Agricultural Sciences Baishiyi Base (2023CQ) in 2023, the Anhui Academy of Agricultural Sciences Hefei Experimental Base (2024HF) in 2024, and the Hubei Academy of Agricultural Sciences Wuhan Base (2024WH) in 2024. The field trial used a randomized block design with three replicates; two rows were planted, with 20 plants per family per row, 2m long and 0.5m apart. After maturity, the main stem node number was examined in 10 plants per row, and the average of the three replicates for each environment was taken as the phenotypic value for that environment. Figure 1 ).

[0036] (2) Genotyping analysis: Using the BGI T7 sequencing platform, whole-genome resequencing was performed on 768 materials from the associated population. Genotyping was performed on the 768 materials using resequencing technology. The average sequencing depth was ~20×, and SNPs with a deletion rate >10% and a minimum allele frequency <0.05 were filtered out. Finally, 6,339,330 high-quality SNPs were retained for whole-genome association analysis.

[0037] (3) Genome-wide association analysis: Combining population genotype and phenotypic data, the mixed linear model (MLM) in GEMMAX software was used for association analysis, with the significance threshold set to P≤1 / n (n is the number of SNPs, 6339330).

[0038] (4) Obtaining qNN10 and its significantly associated SNP markers: Association analysis results showed that a stable associated QTL site qNN10 was found on chromosome 10, which was significantly associated in all three environments and could explain 0.63%–2.71% of the phenotypic variation. Figure 2 (Table 1). Its peak SNP marker was named S10_45310798, located at base 45310798 on chromosome 10 of the soybean Glycine_max_v2.1 reference genome, with an allele of A / T. Its flanking sequence is: 5'-TATC TTCCTCGTGGAAGCCCATCAGAGGCATGTCTTATG[A / T]AAATATTTGCTGCTACAGTGG AAGCTATTCTTCAGAGGAC-3'. Under the three environments, the materials containing the multiple main stem node number allele had an average main stem node number 37.37%-45.94% higher than those containing the fewer main stem node allele. Figure 3 ).

[0039] Table 1 qNN10 and its associated SNP markers

[0040]

[0041] Example 2:

[0042] Development of a PARMS marker closely linked to the number of nodes on the main stem of soybean:

[0043] Based on the nucleotide sequences preceding and following the peak SNP marker S10_45310798, which is significantly associated with qNN10, the PARMS marker detection primer sequences were obtained according to primer design principles as follows:

[0044] PARMS10:AGAATAGCTTCCACTGTAGCA

[0045] PARMS10P1: GAAGGTGACCAAGTTCATGCT ATCAGAGGCATGTCTTATGA

[0046] PARMS10P2: GAAGGTCGGAGTCAACGGATT ATCAGAGGCATGTCTTATGT.

[0047] The underlined part is the fluorescent connector.

[0048] The method for detecting the genotype of the soybean qNN10 locus using the above PARMS primer set is as follows:

[0049] (1) Extract genomic DNA from the soybeans to be tested.

[0050] (2) Preparation of the reaction system. The reaction system consisted of 5 μL, including 2.5 μL of 2×PARMS PCR reaction mix (a product of Wuhan Jingtai Biotechnology Co., Ltd.), aqueous solutions of primers PARMS10, PARMS10P1, and PARMS10P2, DNA, and water. In the reaction system, the concentrations of primers PARMS10P1 and PARMS10P2 were both 150 nM, and the concentration of primer PARMS10 was 400 nM.

[0051] (3) Add 5 μL of paraffin oil to the reaction system (to prevent sample evaporation), and then perform PCR amplification.

[0052] The reaction program was as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, decreasing by 0.8℃ per cycle until reaching 57℃, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 32 cycles.

[0053] (4) After completing step (3), the signal is read on the TECAN Infinite M1000 and then the following judgment is made: if blue is displayed, the corresponding soybean is or is suspected to be a soybean with multiple main stem nodes; if green is displayed, the corresponding soybean is or is suspected to be a soybean with few main stem nodes.

[0054] Using the primers described above, the sequence amplified from the multi-stem node material, Chuanxiandou 2, is:

[0055] ATCAGAGGCATGTCTTATG A AAATATTTCTGCTACAGTGGAAGCTATTCT

[0056] The amplification product sequence of the low main stem node number material Changjiangchun 2 is:

[0057] ATCAGAGGCATGTCTTATG T AAATATTTCTGCTACAGTGGAAGCTATTCT.

[0058] Example 3:

[0059] Universality of PARMS markers in selection for the number of main stem nodes in soybean:

[0060] The PARMS primer set designed in Example 2 was used to detect the genotype and genetic effect of the qNN10 locus in soybean. The soybeans tested consisted of 256 domestic and international soybean varieties (lines) (newly collected by the applicant). Following the method described in Example 1, field identification was conducted in 2024 at the Baishiyi Base of the Chongqing Academy of Agricultural Sciences (2024CQ), and the number of main stem nodes was also examined.

[0061] The results showed that among the 256 soybean varieties (lines), 73 were identified as having the AA / TT genotype, with an average of 16.01 main stem nodes; 183 were identified as having the TT / AA genotype, with an average of 10.92 main stem nodes. The difference in the number of main stem nodes between the AA and TT genotypes was highly significant (P-value = 6.92e-13). This result indicates that the qNN10 locus exhibits segregation of genotypes in the 256 domestic and international soybean varieties (lines) and possesses a stable and reliable genetic effect.

[0062] The above results indicate that the prepared PARMS molecular marker qNN10 has a significant genetic effect on the number of main stem nodes in soybean and has a good screening effect.

Claims

1. Application of reagents for detecting bases at positions 45,310,798 of soybean chromosome 10 in soybean main stem node number screening breeding.

2. Application of reagents for detecting bases at positions 45,310,798 of soybean chromosome 10 in the preparation of a soybean main stem node screening kit.

3. The application according to claim 1 or 2, characterized in that: If the reagent detects that the base at position 45,310,798 of chromosome 10 of soybean is A, then the soybean is determined to be a multi-stem node type material.

4. The application according to claim 1 or 2, characterized in that: If the reagent detects that the base at position 45,310,798 of chromosome 10 of soybean is T, then the soybean is determined to be a material with few main stem nodes.

5. The application according to claim 1 or 2, characterized in that: The reagent is a primer.

6. The application according to claim 5, characterized in that: The primers are PARMS10: AGATAGCTTCCACTGTAGCA, PARMS10P1: GAAGGTGACCAAGTTCATGCATCAGAGGCATGTCTTATGA and PARMS10P2: GAAGGTCGGAGTCAACGGATATCAGAGGCATGTCTTATGT.

7. A method for screening soybean main stem nodes, comprising detecting the genotype at position 45,310,798 of soybean chromosome 10, wherein the method comprises sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry method.

Images