Low-caffeine related molecular markers of fangcheng tea based on liquid chip and application thereof
By developing molecular markers and liquid-phase chip technology related to alkaloids in Fangcheng tea, the identification problem of Fangcheng tea has been solved, enabling rapid and accurate identification of germplasm resources and detection of alkaloid content, especially the screening of tea trees with low caffeine and high theobromine.
Patent Information
- Application Number
- CN202511525771.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-24
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2045-10-24
AI Technical Summary
Existing technologies are insufficient to accurately identify the authenticity of Fangcheng tea and its alkaloid content. Traditional morphological identification is highly subjective, and biochemical component testing is costly and complex.
We developed molecular markers and primer pairs related to the alkaloid content of Fangcheng tea, used liquid-phase microarrays for genotyping, and combined probe combinations and primer sets for DNA sequencing or PCR amplification to identify the authenticity of Fangcheng tea and the level of alkaloid content in tea trees.
This study enabled rapid, accurate, and low-cost identification of Fangcheng tea germplasm resources, screened out tea tree resources with low caffeine and high theobromine content, and provided a theoretical basis for rare allelic variations of the caffeine synthase TCS1.
Smart Images

Figure CN120989298B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of tea tree biotechnology, in particular to Fangcheng tea low caffeine related molecular markers based on liquid chip and application thereof. BACKGROUND
[0002] Caffeine is one of the important taste substances of tea, which has physiological functions such as refreshing, anti-inflammatory and anti-allergic, but its excitatory effect on the central nervous system can easily cause side effects such as insomnia and palpitation, which limits the consumption of tea by some people. Therefore, in order to meet market demand, developing low caffeine tea tree breeding and researching low caffeine tea has become an important direction of tea industry innovation and development.
[0003] Fangcheng tea (Camellia fangchengensis Liang et Zhong) belongs to the Camellia genus of Theaceae. Because of its unique characteristics in the Camellia genus, Fangcheng tea is included in the Camellia genus classification system of Min Tianlu as a new species. Due to its narrow distribution range and similar morphological characteristics to the Camellia genus Bai Maocha, it is merged into the Bai Maocha variety in the Camellia genus classification system of Chen Liang. At present stage, whether according to morphological characteristics or biochemical component detection, there are the following problems in identifying Fangcheng tea: (1) the traditional morphological identification method has strong subjectivity and is not easy to distinguish specific resource types; (2) the detection of biochemical components requires a large amount of manpower, material resources and cost.
[0004] The liquid chip based on targeted sequencing genotype detection technology is a commonly used technical method for crop and horticultural plant variety breeding and resource identification. This technology genotypes the target marker sites on the genome, which is a SNP genetic marker that can directly reflect DNA differences. Compared with traditional SSR markers, it has the advantages of high detection throughput, automation, speed, extremely low cost, and integrated analysis and comparison of detection data from different batches and different laboratories. So far, no functional marker related to identifying the authenticity of Fangcheng tea and identifying the high and low content of alkaloids in tea tree has been reported. SUMMARY
[0005] The purpose of the present application is to provide a molecular marker, primer pair and application related to the content of alkaloids in Fangcheng tea to solve the problems existing in the prior art.
[0006] To achieve the above purpose, the present application provides the following solutions:
[0007] The present application provides a molecular marker related to the content of alkaloids in Fangcheng tea, which comprises molecular markers 1-5.
[0008] The nucleotide sequence of the molecular marker 1 is shown as SEQ ID NO. 5, and G / A mutation exists at the 100th base of the nucleotide sequence, and C / A mutation exists at the 101th base;
[0009] The nucleotide sequence of the molecular marker 2 is shown as SEQ ID NO. 10, and G / T mutation exists at the 58th base of the nucleotide sequence;
[0010] The nucleotide sequence of the molecular marker 3 is shown as SEQ ID NO. 15, and A / G mutation exists at the 58th base of the nucleotide sequence;
[0011] The nucleotide sequence of the molecular marker 4 is shown as SEQ ID NO. 20, and G / T mutation exists at the 97th base of the nucleotide sequence;
[0012] The nucleotide sequence of the molecular marker 5 is shown as SEQ ID NO. 25, and T / G mutation exists at the 50th base of the nucleotide sequence;
[0013] The alkaloid includes caffeine and / or theobromine.
[0014] The present application provides a probe combination for detecting the above-mentioned molecular markers, which includes a probe sequence for detecting the molecular marker 1, a probe sequence for detecting the molecular marker 2, a probe sequence for detecting the molecular marker 3, a probe sequence for detecting the molecular marker 4 and a probe sequence for detecting the molecular marker 5;
[0015] The probe sequence for detecting the molecular marker 1 includes a probe sequence of nucleotide shown as SEQ ID NO. 6;
[0016] The probe sequence for detecting the molecular marker 2 includes a probe sequence of nucleotide shown as SEQ ID NO. 11;
[0017] The probe sequence for detecting the molecular marker 3 includes a probe sequence of nucleotide shown as SEQ ID NO. 16;
[0018] The probe sequence for detecting the molecular marker 4 includes a probe sequence of nucleotide shown as SEQ ID NO. 21;
[0019] The probe sequence for detecting the molecular marker 5 includes a probe sequence of nucleotide shown as SEQ ID NO. 26.
[0020] The application provides a primer set for detecting the above-mentioned molecular markers, which comprises a primer pair for detecting molecular marker 1, a primer pair for detecting molecular marker 2, a primer pair for detecting molecular marker 3, a primer pair for detecting molecular marker 4 and a primer pair for detecting molecular marker 5.
[0021] The primer pair for detecting molecular marker 1 comprises an upstream primer 1 with a nucleotide sequence as shown in SEQ ID NO. 7, an upstream primer 2 with a nucleotide sequence as shown in SEQ ID NO. 8 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 9;
[0022] The primer pair for detecting molecular marker 2 comprises an upstream primer 1 with a nucleotide sequence as shown in SEQ ID NO. 12, an upstream primer 2 with a nucleotide sequence as shown in SEQ ID NO. 13 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 14;
[0023] The primer pair for detecting molecular marker 3 comprises an upstream primer 1 with a nucleotide sequence as shown in SEQ ID NO. 17, an upstream primer 2 with a nucleotide sequence as shown in SEQ ID NO. 18 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 19;
[0024] The primer pair for detecting molecular marker 4 comprises an upstream primer 1 with a nucleotide sequence as shown in SEQ ID NO. 22, an upstream primer 2 with a nucleotide sequence as shown in SEQ ID NO. 23 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 24;
[0025] The primer pair for detecting molecular marker 5 comprises an upstream primer 1 with a nucleotide sequence as shown in SEQ ID NO. 27, an upstream primer 2 with a nucleotide sequence as shown in SEQ ID NO. 28 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO. 29.
[0026] The application provides application of the above-mentioned probe combination or the above-mentioned primer pair in preparation of a product for identifying authenticity of Fangcheng tea and / or identifying content of alkaloids in tea plants, wherein the alkaloids comprise caffeine and / or theobromine.
[0027] Further preferably, the product comprises a chip detection reagent or a kit.
[0028] The application provides a product for identifying authenticity of Fangcheng tea and / or identifying content of alkaloids in tea plants, wherein the product comprises the above-mentioned probe combination or the above-mentioned primer pair, and the alkaloids comprise caffeine and / or theobromine.
[0029] Further preferably, the product comprises a chip detection reagent or a kit.
[0030] The application provides application of the molecular marker, the probe combination, the primer pair or the product in any one or more of the following:
[0031] (1) identifying authenticity of Fangcheng tea;
[0032] (2) identifying content of alkaloids of tea plants; the alkaloids include caffeine and / or theobromine.
[0033] The application provides a method for identifying authenticity of Fangcheng tea, comprising the following steps:
[0034] Taking genomic DNA of a tea plant sample to be tested as a template, performing library construction and sequencing on the template by using the probe sequence, and performing genotyping according to a sequencing result; or taking a genome of a tea plant sample to be tested as a template, performing PCR amplification on the template by using the primer set, and performing genotyping according to an amplification result.
[0035] Preferably, when the genotype of the molecular marker 1 is AA and AA, the genotype of the molecular marker 2 is TT, the genotype of the molecular marker 3 is GG, the genotype of the molecular marker 4 is TT, and the genotype of the molecular marker 5 is GG, the tea plant sample to be tested is Fangcheng tea.
[0036] When the genotype of the molecular marker 1 is GG and CC, the genotype of the molecular marker 2 is GG, the genotype of the molecular marker 3 is AA, the genotype of the molecular marker 4 is GG, and the genotype of the molecular marker 5 is TT, the tea plant sample to be tested is non-Fangcheng tea.
[0037] The application provides a method for identifying content of alkaloids of tea plants, comprising the following steps:
[0038] Taking genomic DNA of a tea plant sample to be tested as a template, performing library construction and sequencing on the template by using the probe sequence, and performing genotyping according to a sequencing result; the alkaloids include caffeine and / or theobromine; or taking a genome of a tea plant sample to be tested as a template, performing PCR amplification on the template by using the primer set, and performing genotyping according to an amplification result.
[0039] Preferably, when the genotype of the molecular marker 1 is AA and AA, the genotype of the molecular marker 2 is TT, the genotype of the molecular marker 3 is GG, the genotype of the molecular marker 4 is TT, and the genotype of the molecular marker 5 is GG, the tea plant sample to be tested is a tea plant variety with low content of caffeine and / or high content of theobromine.
[0040] When the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the tea tree sample to be tested is a tea tree variety with high caffeine content and / or low theobromine content.
[0041] The present invention discloses the following technical effects:
[0042] This invention utilizes a previously developed liquid-phase chip to detect 16 different types of tea tree resources, including Fangcheng tea, and simultaneously detects the content of relevant indicators. Six meaningful SNP mutations were identified on the CfTCS1 gene of Fangcheng tea caffeine synthase. These six mutations can accurately, efficiently, and cost-effectively identify Fangcheng tea germplasm resources. Furthermore, these mutations are closely related to the caffeine and theobromine content of tea trees, and their genotypes can be used to quickly screen for low-caffeine and high-theobromine germplasm resources. Specific embodiments of this invention show that tea tree resources with genotypes of AA / AA / TT / GG / TT / GG in that order correspond to Fangcheng tea germplasm resources with high theobromine and low caffeine content. In summary, by using this technology to detect and analyze different tea tree resources, Fangcheng tea resources with low-caffeine and high-theobromine content can be identified. Therefore, the six SNP molecular markers described in this invention can be applied to the identification of genuine Fangcheng tea resources and the detection of alkaloid (caffeine and theobromine) content in tea trees. This invention also proves that Fangcheng tea is a high-thecobromine, low-caffeine resource, and provides a theoretical basis for exploring rare allelic variants of caffeine synthase TCS1. Attached Figure Description
[0043] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0044] Figure 1 This is the caffeine synthase metabolic pathway;
[0045] Figure 2 Statistical analysis of genotype and alkaloid content; where A is a statistical analysis graph of genotype and caffeine content; and B is a statistical analysis graph of genotype and theobromine content.
[0046] Figure 3 For the alignment of the TCS gene and TCS amino acid sequence. Detailed Implementation
[0047] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be illustrative of certain aspects, features and embodiments of the present application and not restrictive of the present application.
[0048] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where a range of values is provided, it is understood that each intervening value, to the upper and lower limit of the ranges is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also encompassed by the application, subject to any specifically excluded limit in the stated
[0049] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials which are related to the present application. In the case of conflict between the present specification and any document incorporated by reference, the present specification will control.
[0050] Many modifications and variations of this application can be made in the light of the above teachings without departing from the spirit and scope thereof. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The examples and embodiments described herein are exemplary only and are not intended to be limiting.
[0051] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.
[0052] The caffeine biosynthesis pathway is shown in Figure 1. Figure 1 The position of the caffeine biosynthesis enzyme TCS gene in the caffeine metabolic pathway is shown in Figure 2.
[0053] Example 1 Development of SNP sites
[0054] 1. Sampling:
[0055] The one-bud two-leaf sprouts of Shuchazao (SCZ), Fangchengcha (FCC), Longjing 43 (LJ43), Houzhach (HZC), Dali tea (DLC), Tieguanyin (TGY), Baiye No.1 (BY1), Danxia No.5 (DX5H), Danxia No.8 (DX8H), Guihong No.3 (GH3H), Huangjinba (HJY), Jinguanyin (JGY), Jinmudan (JMD), Lingtoudancong (LTDC), Qilan No.10 (QL10H) and Wuyi Xian (WYSX) were collected in the National Hangzhou Tea Garden in spring 2024, frozen in liquid nitrogen and stored in a refrigerator at -80°C. Some of the samples were used for DNA extraction for functional liquid chip detection of tea plants, and some were used for biochemical component detection.
[0056] 2. Caffeine and theobromine content detection:
[0057] The above samples were first freeze-dried and then ground into powder using a high-throughput grinder. 0.1 g of powder was weighed into a 15 mL centrifuge tube, 10 mL of preheated 70% (v / v) methanol was added, and after mixing, it was extracted in a 70°C water bath for 10 min, shaking every 5 min. Then cool to room temperature, centrifuge at 4000 rpm for 10 min, the supernatant is passed through a 0.22 μm organic filter membrane, take 1 mL in a liquid phase bottle for HPLC detection, detection wavelength is 278 nm, flow rate 1 mL / min, column temperature 35°C, C 18 Chromatographic column (particle size 5 μm, 250 mm x 4.6 mm), sample size 10 μL, mobile phase: 1% (v / v) formic acid and pure acetonitrile. Gradient conditions of mobile phase: 0-1 min 96% 1% (v / v) formic acid; 1-42 min: 1% formic acid from 96% to 81.3%; 42-43 min: 1% (v / v) formic acid back to 96%.
[0058] 3. Detection of different tea resources by liquid chip:
[0059] The tea tree resources were first ground into powder with liquid nitrogen, and DNA was extracted using a modified CTAB plant genomic DNA rapid extraction kit (Aidley Biological Company). The quality of the DNA was detected by 1% agarose gel electrophoresis, and the concentration of the DNA was detected by Nanodrop 2000. The probe sequence was designed using the GenoBaits Probe Designer platform. Subsequently, the qualified DNA samples were used to construct a sequencing library using a tea tree functional liquid chip detection reagent (the other components of the detection reagent were provided by Shijiazhuang Boruidi Biological Technology Co., Ltd., and the sequences of the probes are shown in SEQ ID NO. 5, SEQ ID NO. 10, SEQ ID NO. 15, SEQ ID NO. 20 and SEQ ID NO. 25), and sequencing was performed using the MGISEQ-2000 platform. The raw sequencing data was filtered to form clean data using fastq, and the clean data was subsequently aligned to the ‘Shuchazao’ reference genome (http: / / tpia.teaplants.cn / web / Download / Genomic_data / shuchazao_V2.genome.fas.gz) using BWA software. Finally, the GATK software was used to analyze the mutation sites in the target region. Subsequently, six mutation sites on the caffeine synthase (TCS1) were screened by combining annotation information, which were labeled as Chr01_36769734, Chr01_36769735, Chr01_36771727, Chr01_36771787, Chr01_36771907 and Chr01_36771974, i.e., the above-mentioned sites are located at the 36769734th, 36769735th, 36771727th, 36771787th, 36771907th and 36771974th bases of the 1st chromosome of the ‘Shuchazao’ reference genome of the tea tree.
[0060] The base of Chr01_36769734 and Chr01_36769735 sites is changed from GC to AA, which causes the encoded amino acid to be changed from alanine A (GCT) to asparagine N (AAT); the base of Chr01_36771727 site is changed from G to T, which causes the encoded amino acid to be changed from aspartic acid D (GAT) to threonine Y (TAT); the base of Chr01_36771787 site is changed from A to G, which causes the encoded amino acid to be changed from isoleucine I (ATA) to valine V (GTA); the base of Chr01_36771907 site is changed from G to T, which causes the encoded amino acid to be changed from alanine A (GCC) to serine S (TCC); the base of Chr01_36771974 site is changed from T to G, which causes the encoded amino acid to be changed from phenylalanine F (TTC) to cysteine C (TGC), and the mutation only occurs in Fangcheng tea resources. Figure 3 Therefore, the above SNP sites can be used to identify the authenticity of Fangcheng tea.
[0061] Meanwhile, the present application also finds that the above SNP sites have certain correlation with the content of caffeine and theobromine in tea tree. When the genotype of the material at the six SNP sites is AA / AA / TT / GG / TT / GG, the caffeine content is low (0.67%), and the theobromine content is high (3.42%); when the genotype of the material at the six SNP sites is GG / CC / GG / AA / GG / TT, the caffeine content is high (the average is 3.58%), and the theobromine content is low (the average is 0.77%) Figure 2 and Table 1
[0062] Table 1 Genotype and alkaloid content of different tea tree resources
[0063]
[0064]
[0065] The amino acid sequence of the caffeine synthase CfTCS1 in Fangcheng tea is shown as SEQ ID NO. 2, and is specifically as follows: MEIATTGKVNEVLFMNRGEGESSYAQNSSFTQQVASMATPALENAVETLFSKDFHLQNLNATDLGCAAGPNTFAVISTIKRMMEKKCRELNCQTLELQVYLNDLFGNDFNTLFKGLLSEVIGNKCEEVPCYVMGVPGSFHGRLFPRNSLHLVHSSYSVHWLTQAPKGLTNREGLALNKGKIYISKTSPPIVSEAYLSQFHEDFTMFLNARSQEVVPNGCMVLILRGRQSSDPSDMQSCFTWELLAMAIAELVSQGLIDEYKLDTFNIPCYFPSLEEVKDVVERDGSFTIDHMEGFDLDSLQMQENDKWVRGEKFTKVVRSFTEPIISNQFGHEIMDKLYDKCTHIVVSDLEAKLPKTTSIILVLSKIDG.
[0066] Example 2 Development of molecular markers and KASP primer pairs
[0067] This example is based on the SNP sites found in Example 1 to develop molecular markers and KASP primer pairs, and is specifically as follows:
[0068] The FAM fluorescent group linker sequence is shown as SEQ ID NO. 3, and is specifically as follows: GAAGGTGACCAAGTTCATGCT.
[0069] The HEX fluorescent group linker sequence is shown as SEQ ID NO. 4, and is specifically as follows: GAAGGTCGGAGTCAACGGATT.
[0070] (1) Chr01_36769734 (G / A) and Chr01_36769735 (C / A)
[0071] 1) The sequence where the molecular marker 1 is located: AGTTGTTCTCTCTTGCAGCAAACAGTGACCTCAATGACAATGCCAGTGCTAGAAAATGCAGTTGAAACCCTCTTCTCCAAAGATTTCCACCTTCTTCAARMTCTTAACGCAGTGGACTTGGGTTGTGCAGCAGGTCCA, SEQ ID NO. 5, wherein R is A or G, and M is C or A.
[0072] 2) Probe sequence: TGGACCTGCTGCACAACCCAAGTCCACTGCGTTAAGAGCTTGAAGAAGGTGGAAATCTTTGGAGAAGAGGGTTTCAACTGCATTTTCTAGCACTGGCATTGTCATTGAGGTCACTGTTTGCTGCAAGAGAGAACAACT, SEQ ID NO. 6.
[0073] 3) KASP primer pair sequence:
[0074] Primer_AlleleFAM: FAM-AGTCCACTGCGTTAAGAGCTTGA, SEQ ID NO. 7, which is modified with FAM fluorescent group at the 5' end.
[0075] Primer_AlleleHEX: HEX-AGTCCACTGCGTTAAGATTTTGA, SEQ ID NO. 8, which is modified with HEX fluorescent group at the 5' end.
[0076] Primer_Common: AGAAAATGCAGTTGAAACCCTCTTCTCCAA, SEQ ID NO. 9.
[0077] (2) Chr01_36771727 (G / T)
[0078] 1) Sequence where molecular marker 2 is located: ATTCCAATCTATTGATTTTCTCTCTTTCCTTCGCGATAATAGGGATTGATAGATGAAKATAAATTAGACACCTTCAATGTACCTAGCTATTTTCCATCACTTGAGGAAGTG, SEQ ID NO. 10, wherein K is T or G.
[0079] 2) Probe sequence: CACTTCCTCAAGTGATGGAAAATAGCTAGGTACATTGAAGGTGTCTAATTTATCTTCATCTATCAATCCCTATTATCGCGAAGGAAAGAGAGAAAATCAATAGATTGGAAT, SEQ ID NO. 11.
[0080] 3) KASP primer pair sequence:
[0081] Primer_AlleleFAM: FAM-TGAAGGTGTCTAATTTATCTTCAT, SEQ ID NO. 12, which is modified with FAM fluorescent group at the 5' end.
[0082] Primer_AlleleHEX: HEX-TGAAGGTGTCTAATTTATATTCAT, SEQ ID NO. 13, which modifies a HEX fluorescent group at its 5' end.
[0083] Primer_Common: CTCTTTCCTTCGCGATAATAGGGAT, SEQ ID NO. 14.
[0084] (3) Chr01_36771787 (A / G)
[0085] 1) Sequence where molecular marker 3 is located: AAATTAGACACCTTCAATGTACCTAGCTATTTTCCATCACTTGAGGAAGTGAAAGACRTAGTGGAGAGGAACGGATCATTCACAATTGATCATATGGAGGGGTTTGAACTTGATAGCCCA, SEQ ID NO. 15, wherein R is A or G.
[0086] 2) Probe sequence: TGGGCTATCAAGTTCAAACCCCTCCATATGATCAATTGTGAATGATCCGTTCCTCTCCACTATGTCTTTCACTTCCTCAAGTGATGGAAAATAGCTAGGTACATTGAAGGTGTCTAATTT, SEQ ID NO. 16.
[0087] 3) KASP primer pair sequences:
[0088] Primer_AlleleFAM: FAM-GATCCGTTCCTCTCCACTATGTCT, SEQ ID NO. 17, which modifies a FAM fluorescent group at its 5' end.
[0089] Primer_AlleleHEX: HEX-GATCCGTTCCTCTCCACTACGTCT, SEQ ID NO. 18, which modifies a HEX fluorescent group at its 5' end.
[0090] Primer_Common: TCAATGTACCTAGCTATTTTCCATCACTTGA, SEQ ID NO. 19.
[0091] (4) Chr01_36771907 (G / T)
[0092] 1) Sequence where molecular marker 4 is located: ACAATTGATCATATGGAGGGGTTTGAACTTGATAGCCCAGAGATGCAAGAAAATGATAAATGGGTTAGAGGGGAAAAGTTTGCCACGGTTGCCAGGKCCTTCACAGAGCCTATAATTT, SEQ ID NO. 20, wherein K is G or T.
[0093] 2) Probe sequence: AAATTATAGGCTCTGTGAAGGCCCTGGCAACCGTGGCAAACTTTTCCCCTCTAACCCATTTATCATTTTCTTGCATCTCTGGGCTATCAAGTTCAAACCCCTCCATATGATCAATTGT, SEQ ID NO. 21.
[0094] 3) KASP primer pair sequences:
[0095] Primer_AlleleFAM: FAM-GTGAAGGCCCTGGCAACCGT, SEQ ID NO. 22, which is modified with FAM fluorescent group at its 5' end.
[0096] Primer_AlleleHEX: HEX-GTGAAGGACCTGGCAACCGT, SEQ ID NO. 23, which is modified with HEX fluorescent group at its 5' end.
[0097] Primer_Common: ACTTGATAGCCCAGAGATGCAAGAAAATGATAAAT, SEQ ID NO. 24.
[0098] (5) Chr01_36771974 (T / G)
[0099] 1) Sequence where molecular marker 5 is located: ATTTCAAACCAGTTTGGACATGAAATCATGGACAAACTATATGAGAAGTKCACTCACATTGTAGTTTCAGATTTGGAAGCAAAGATACCGAAGATCACAAGTATCATTCTAGTGCTTT, SEQ ID NO. 25, wherein K is T or G.
[0100] 2) Probe sequence: AAAGCACTAGAATGATACTTGTGATCTTCGGTATCTTTGCTTCCAAATCTGAAACTACAATGTGAGTGAACTTCTCATATAGTTTGTCCATGATTTCATGTCCAAACTGGTTTGAAAT, SEQ ID NO. 26.
[0101] 3) KASP primer pair sequence:
[0102] Primer_AlleleFAM: FAM-ACAATGTGAGTGAACTTCT, SEQ ID NO. 27, which is modified with FAM fluorescent group at the 5' end.
[0103] Primer_AlleleHEX: HEX-ACAATGTGAGTGCACTTCT, SEQ ID NO. 28, which is modified with FAM fluorescent group at the 5' end.
[0104] Primer_Common: AAACCAGTTTGGACATGAAATCAT, SEQ ID NO. 29.
[0105] Example 3: Establishment of detection method
[0106] A method for identifying the authenticity of Fangcheng tea and detecting the content of caffeine and theobromine in tea tree, comprising the following steps:
[0107] Method I: DNA extraction: The DNA of the one-bud two-leaf new shoots of the tea tree to be tested was extracted by using a modified CTAB plant genomic DNA rapid extraction kit (Aidley Biological Company).
[0108] Detection of molecular markers: The qualified DNA samples were used to construct sequencing library by tea tree functional liquid chip kit (other components in the kit were provided by Shijiazhuang Boruitai Biotechnology Co., Ltd., and the sequences of the probes are shown in SEQ ID NO. 5, SEQ ID NO. 10, SEQ ID NO. 15, SEQ ID NO. 20 and SEQ ID NO. 25), and sequencing was performed by using the MGISEQ-2000 platform. The raw sequencing data was filtered by fastq to form clean data, and then the clean data was aligned to the 'Shuchazao' reference genome (http: / / tpia.teaplants.cn / web / Download / Genomic_data / shuchazao_V2.genome.fas.gz) by using the BWA software. Finally, the 6 mutation sites (Chr01_36769734, Chr01_36769735, Chr01_36771727, Chr01_36771787, Chr01_36771907 and Chr01_36771974) on theobromine synthase (TCS1) were analyzed by using the GATK software to obtain the genotyping information of the corresponding molecular marker sites (Table 1).
[0109] Result determination of the authenticity of Fangcheng tea: when the genotype of the molecular marker 1 is AA and AA, the genotype of the molecular marker 2 is TT, the genotype of the molecular marker 3 is GG, the genotype of the molecular marker 4 is TT, and the genotype of the molecular marker 5 is GG, the variety of the tea tree sample to be tested is Fangcheng tea; when the genotype of the molecular marker 1 is GG and CC, the genotype of the molecular marker 2 is GG, the genotype of the molecular marker 3 is AA, the genotype of the molecular marker 4 is GG, and the genotype of the molecular marker 5 is TT, the variety of the tea tree sample to be tested is non-Fangcheng tea.
[0110] Result determination of the high and low content of caffeine and theobromine: when the genotype of the molecular marker 1 is AA and AA, the genotype of the molecular marker 2 is TT, the genotype of the molecular marker 3 is GG, the genotype of the molecular marker 4 is TT, and the genotype of the molecular marker 5 is GG, the tea tree sample to be tested is a tea tree variety with low caffeine content and / or high theobromine content; when the genotype of the molecular marker 1 is GG and CC, the genotype of the molecular marker 2 is GG, the genotype of the molecular marker 3 is AA, the genotype of the molecular marker 4 is GG, and the genotype of the molecular marker 5 is TT, the tea tree sample to be tested is a tea tree variety with high caffeine content and / or low theobromine content.
[0111] Method two, DNA extraction: the improved CTAB plant genomic DNA rapid extraction kit (Aidley biological company) was used to extract the DNA of the one bud two leaf new shoots of the tea plants to be tested.
[0112] Detection of molecular markers: the KASP primers developed in Example 3 were used to perform PCR amplification on the DNA of the one bud two leaf new shoots of the tea plants to be tested, and the PCR amplification and program were the same as the commercially available PCR amplification kit. After the completion of the PCR, the QuantStudio 6 real-time fluorescent quantitative PCR system was used to read the fluorescent signal, and then the KlusterCaller analysis software was used to analyze and convert the fluorescent signal to obtain clear and intuitive typing charts, and according to the different colors, the genotype results were output.
[0113] The results of the judgment of the authenticity of Fangcheng tea and the high and low contents of caffeine and theobromine were the same as the foregoing.
[0114] Example 4 Verification and application of molecular markers
[0115] The probe sequences in Example 2 and the method one in Example 3 were used to perform genotype identification on 24 different tea plant resources to be tested (14 Fangcheng tea and 10 other tea plant resources (Anji yellow tea-AJHC, Bai Mudan-BMD, Beicha 36-BC36, Bishang-BS, Bixiangzao-BXZ, Lefeng-LF, Longqu No. 1-LQ1, Meizhan-MZ, Lu Yun No. 1-LY1 and Qiancha No. 1-QC1)) and the results are shown in Table 2.
[0116] The results show that only in Fangcheng tea, the genotype of the six SNP sites is AA / AA / TT / GG / TT / GG in turn, and the caffeine content of the material with this genotype is low and the theobromine content is high; the genotype of the six SNP sites of other varieties of tea plants is GG / CC / GG / AA / GG / TT in turn, and the caffeine content of the material with this genotype is high and the theobromine content is low (Table 2).
[0117] Table 2 Genotype information and alkaloid content of tea verification materials
[0118]
[0119] The above-described examples only describe the preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art shall fall within the protection scope determined by the claims of the present application.
Claims
1. A molecular marker associated with the alkaloid content of Fangcheng tea, characterized in that, The molecular markers include molecular markers 1-5; The nucleotide sequence of molecular marker 1 is shown in SEQ ID NO.5, and there is a G / A mutation at the 100th base and a C / A mutation at the 101st base in the nucleotide sequence. The nucleotide sequence of molecular marker 2 is shown in SEQ ID NO.10, and a G / T mutation exists at the 58th base of this nucleotide sequence; The nucleotide sequence of molecular marker 3 is shown in SEQ ID NO.15, and an A / G mutation exists at the 58th base of this nucleotide sequence; The nucleotide sequence of molecular marker 4 is shown in SEQ ID NO.20, and a G / T mutation exists at the 97th base of this nucleotide sequence; The nucleotide sequence of molecular marker 5 is shown in SEQ ID NO.25, and a T / G mutation exists at the 50th base of this nucleotide sequence; The alkaloids include caffeine and / or theobromine.
2. A probe assembly for detecting the molecular marker of claim 1, characterized in that, The probe sequences include probe sequences for detecting molecular marker 1, probe sequences for detecting molecular marker 2, probe sequences for detecting molecular marker 3, probe sequences for detecting molecular marker 4, and probe sequences for detecting molecular marker 5. The probe sequence for detecting molecular marker 1 includes nucleotides as shown in SEQ ID NO. 6; The probe sequence for detecting molecular marker 2 includes nucleotides as shown in SEQ ID NO. 11; The probe sequence used to detect molecular marker 3 includes nucleotides as shown in SEQ ID NO. 16; The probe sequence used to detect molecular marker 4 includes nucleotides as shown in SEQ ID NO.21; The probe sequence used to detect molecular marker 5 includes nucleotides as shown in SEQ ID NO.
26.
3. A primer set for detecting the molecular marker of claim 1, characterized in that, The primer set includes primer pairs for detecting molecular marker 1, primer pairs for detecting molecular marker 2, primer pairs for detecting molecular marker 3, primer pairs for detecting molecular marker 4, and primer pairs for detecting molecular marker 5. The primer pair used to detect molecular marker 1 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO.7, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO.8, and downstream primer with nucleotide sequence as shown in SEQ ID NO.9; The primer pair used to detect molecular marker 2 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 12, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 13, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 14; The primer pair used to detect molecular marker 3 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 17, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 18, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 19; The primer pair used to detect molecular marker 4 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 22, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 23, and downstream primer with nucleotide sequence as shown in SEQ ID NO. 24; The primer pair used to detect molecular marker 5 includes upstream primer 1 with nucleotide sequence as shown in SEQ ID NO. 27, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO. 28, and downstream primer with nucleotide sequence as shown in SEQ ID NO.
29.
4. The application of the probe combination of claim 2 or the primer pair of claim 3 in the preparation of products for identifying the authenticity of Fangcheng tea and / or identifying the content of tea tree alkaloids, characterized in that, The alkaloids include caffeine and / or theobromine.
5. A product for identifying the authenticity of Fangcheng tea and / or determining the content of alkaloids in tea trees, characterized in that, The product comprises the probe combination of claim 2 or the primer pair of claim 3, and the alkaloid comprises caffeine and / or theobromine.
6. The use of the molecular marker of claim 1, the probe combination of claim 2, the primer pair of claim 3, or the product of claim 5 in any one or more of the following: (1) Identifying the authenticity of Fangcheng tea; (2) To determine the content of alkaloids in tea plants; the alkaloids include caffeine and / or theobromine.
7. A method for identifying the authenticity of Fangcheng tea, characterized in that, Includes the following steps: Using the genomic DNA of the tea plant sample to be tested as a template, the template is constructed and sequenced using the probe combination described in claim 2, and genotyping is performed based on the sequencing results; or using the genomic DNA of the tea plant sample to be tested as a template, the template is amplified by PCR using the primer set described in claim 3, and genotyping is performed based on the amplification results.
8. The method according to claim 7, characterized in that, When the genotype of molecular marker 1 is AA and AA, the genotype of molecular marker 2 is TT, the genotype of molecular marker 3 is GG, the genotype of molecular marker 4 is TT, and the genotype of molecular marker 5 is GG, the tea tree sample to be tested is Fangcheng tea. When the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the tea tree sample to be tested is non-Fangcheng tea.
9. A method for identifying the alkaloid content of tea plants, characterized in that, Includes the following steps: Using the genomic DNA of the tea plant sample to be tested as a template, the template is constructed and sequenced using the probe combination described in claim 2, and genotyping is performed based on the sequencing results; the alkaloids include caffeine and / or theobromine; or using the genomic DNA of the tea plant sample to be tested as a template, the template is amplified by PCR using the primer set described in claim 3, and genotyping is performed based on the amplification results.
10. The method according to claim 9, characterized in that, When the genotype of molecular marker 1 is AA and AA, the genotype of molecular marker 2 is TT, the genotype of molecular marker 3 is GG, the genotype of molecular marker 4 is TT, and the genotype of molecular marker 5 is GG, the tea tree sample to be tested is a tea tree variety with low caffeine content and / or high theobromine content. When the genotype of molecular marker 1 is GG and CC, the genotype of molecular marker 2 is GG, the genotype of molecular marker 3 is AA, the genotype of molecular marker 4 is GG, and the genotype of molecular marker 5 is TT, the tea tree sample to be tested is a tea tree variety with high caffeine content and / or low theobromine content.
Citation Information
Patent Citations
Specific primer pair, allele and molecular marker for screening thea section with low caffeine trait and screening method
CN105505957A
Common camellia oleifera SSR molecular marker primers and marking method and application thereof
CN110144418A