Gene therapy for anterior of eye
By using circular DNA vectors and electrode delivery technology to express transgenes in anterior anterior cells, the treatment challenge of Fuchs malnutrition has been solved, achieving sustained gene expression and effective disease treatment, avoiding the limitations of traditional tissue transplantation.
Patent Information
- Application Number
- CN202480024685.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-02-10
- Filing Date
- 2024-02-09
- Publication Date
- 2025-11-21
AI Technical Summary
Existing treatments are ineffective in treating Fuchs dystrophy, a corneal endothelial disease that leads to progressive vision loss, and the only current treatment option is tissue transplantation-based therapy, leaving an unmet medical need.
Using a circular DNA vector lacking one or more components of the plasmid backbone, encoding a transgene, and delivering it to anterior anterior cells via electrodes to express the transgene for the treatment of Fuchs malnutrition, the process includes electrode placement and electrical energy delivery to achieve transgene expression.
This study achieved persistent transgene expression in anterior cells, reduced immunogenicity, provided more persistent gene expression than plasmid DNA vectors, and effectively treated Fuchs malnutrition.
Smart Images

Figure CN121002188A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] Generally, the present application features nucleic acid vectors and methods of administering nucleic acid vectors to ocular cells in the anterior segment of the eye.
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 444,740, filed February 10, 2023, which is hereby incorporated by reference in its entirety.
[0004] DESCRIPTION OF TEXT FILE SUBMITTED ELECTRONICALLY
[0005] This application contains a Sequence Listing submitted electronically via Patent Center as an XML file. The content of the XML copy was created on February 8, 2024, is named “IGT-012PC_135234-5012.xml” and is 11,089 bytes in size. The Sequence Listing is incorporated by reference herein in its entirety. BACKGROUND
[0006] Many ocular disorders involving dysfunction of anterior segment tissue (such as corneal dysfunction) have high unmet medical need. For example, Fuchs’ dystrophy is a disease of the corneal endothelium characterized by gradual loss of vision due to its progressive degeneration. Symptoms include decreased corneal endothelial cell count and pleomorphism and polymorphous changes, corneal guttata (water droplet-like deposits), corneal edema, decreased visual acuity and contrast sensitivity, glare, diurnal fluctuations in vision, and pain. Onset can occur early or late in life; it is estimated to affect 4% of the population over 40 years of age in the United States. Fuchs’ dystrophy can be caused by autosomal dominant inheritance of known mutations, which can cause symptoms through mechanisms such as oxidative stress, mitochondrial dysregulation, endoplasmic reticulum-associated mechanisms (such as protein misfolding), apoptosis, epithelial-mesenchymal transition, RNA toxicity, and repeat sequence-associated non-ATG-initiated translation. Currently, the only available treatments are tissue transplantation-based therapies such as penetrating keratoplasty and Descemet’s stripping endothelial keratoplasty / Descemet’s membrane endothelial keratoplasty. There is clearly unmet medical need for treatment options for anterior segment disorders. SUMMARY
[0007] The present application provides methods of treatment for anterior segment disorders (e.g., Fuchs’ dystrophy), methods of delivering nucleic acid vectors to anterior segment tissues and cells, and therapeutic compositions (circular DNA vectors) for treating Fuchs’ dystrophy.
[0008] In one aspect of the application, a method of expressing a transgene in ocular cells of an anterior segment of an individual is provided. In some embodiments, the method comprises: (a) administering a circular DNA vector to an anterior segment of an eye (e.g., the anterior chamber or the corneal stroma), wherein the circular DNA vector lacks one or more components of a plasmid backbone and encodes a transgene; (b) placing one or more electrodes (e.g., one, two, three, four, or more electrodes) on and / or around the eye; and (c) delivering electrical energy through the one or more electrodes under conditions suitable for electroporation of the circular DNA vector into ocular cells of the anterior segment, thereby expressing the transgene in ocular cells of the anterior segment. In some embodiments, the circular DNA vector is expressed in ocular cells of the anterior segment eight days after administration. In some embodiments, the transgene expressed in ocular cells of the anterior segment by the circular DNA vector is more durable than a transgene encoded by a plasmid DNA vector encoding the transgene. In some embodiments, the circular DNA vector has lower immunogenicity in ocular cells of the anterior segment than a plasmid DNA vector encoding the transgene. In some embodiments, the one or more components of the plasmid backbone that are lacking in the circular DNA vector comprise a drug resistance gene and / or an origin of replication.
[0009] In some embodiments, the circular DNA vector is a non-viral circular DNA vector, e.g., a naked circular DNA vector. In some embodiments, the DNA vector is a synthetic circular DNA vector. In some embodiments, the DNA vector comprises an origin of replication and / or lacks a selectable marker. In some embodiments, the 3’ end of the transgene is linked to the 5’ end of the promoter of the transgene by a sequence comprising a bacterial origin of replication, wherein the sequence comprising the bacterial origin of replication is less than 50 bp or less than 100 bp in length. In embodiments, the sequence comprising the bacterial origin of replication is less than 50 bp in length and the circular DNA vector lacks a selectable marker. In various embodiments, the vector further lacks a recombination site. In some embodiments, the vector comprises a transposase scar. In some embodiments, the origin of replication is a ColE2-P9 origin of replication or a functional variant thereof.
[0010] In embodiments, the sequence comprising the bacterial origin of replication directly links the 3’ end of the therapeutic sequence to the 5’ end of the therapeutic sequence.
[0011] In embodiments, the circular DNA vector has about 200 base pairs (bp) or less, or about 150 bp or less, or about 100 bp or less, or about 75 bp or less, or about 50 bp or less of bacterial-derived sequence.
[0012] In embodiments, the origin of replication is from a ColE2-related plasmid, and the origin of replication is optionally ColE2-P9. In such embodiments, the origin of replication is recognized by ColE2-P9 replication proteins. Exemplary ColE2-P9 replication proteins comprise the amino acid sequence of SEQ ID NO: 1.
[0013] In embodiments, the origin of replication is 40 bp or less in length. In some embodiments, the origin of replication is 36 bp or less in length, 34 bp or less in length, 32 bp or less in length, 30 bp or less in length, or 28 bp or less in length. For example, the origin of replication can have the nucleotide sequence of SEQ ID NO: 2, or can be a functional variant or a truncation variant thereof.
[0014] In embodiments, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication comprises or consists of the nucleotide sequence of SEQ ID NO: 5.
[0015] In embodiments, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication comprises or consists of the nucleotide sequence of SEQ ID NO: 6.
[0016] In embodiments, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication comprises or consists of the nucleotide sequence of SEQ ID NO: 7.
[0017] In embodiments, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication comprises or consists of the nucleotide sequence of SEQ ID NO: 8.
[0018] In embodiments, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication comprises or consists of the nucleotide sequence of SEQ ID NO: 9.
[0019] In embodiments, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication comprises or consists of the nucleotide sequence of SEQ ID NO: 10.
[0020] In embodiments, the origin of replication is a truncated ColE2-P9 origin of replication, wherein one strand of the origin of replication comprises or consists of the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.
[0021] In embodiments, the origin of replication comprises or consists of the nucleic acid sequence of X1X2X3X4X5TGTTATCTGATAAGGCTTATCTGGTCTX6X7 (SEQ ID NO: 11), wherein each X is selected from A, T, C, or G. In some embodiments: X1is A, T, or C; X2is A, T, or C; X3is A, T, or G; X4is A, T, or C; X5is A, T, or G; X6is C; X7is A.
[0022] In an aspect, the disclosure provides an engineered bacterial cell for replicating a circular DNA vector. The engineered bacterial cell comprises: (a) a circular DNA vector of the disclosure, and (b) a Rep gene encoding a bacterial replication protein that binds to a bacterial origin of replication of the circular DNA vector, wherein the Rep gene replicates the circular DNA vector.
[0023] In some embodiments, the therapeutic sequence comprises a transposase overhang sequence, which can be (without limitation) TTAA. In such embodiments, the bacterial cell comprises a transposase protein, wherein the transposase protein hydrolyzes DNA adjacent to the transposase overhang sequence. In some embodiments, the transposase protein is encoded by a transposase gene expressed by the engineered bacterial cell and can be integrated into the bacterial genome. In some embodiments, the engineered bacterial cell further comprises an insertion sequence excision enhancer (IEE), which can be encoded by a gene integrated into the bacterial genome. In some embodiments, the engineered bacterial cell further comprises a closed-ended linear DNA molecule comprising a plasmid backbone. The plasmid backbone can comprise a selectable marker (which can be an antibiotic resistance gene and / or a counterselectable marker).
[0024] In various embodiments, the origin of replication is the only bacterial sequence in the circular DNA vector. In embodiments, the engineered bacterial cell comprises an average of at least 10 copies of the circular DNA vector (e.g., in culture). In various embodiments, the circular DNA vector is monomeric. In some embodiments, the bacterial cells in culture comprise an average copy number of the circular DNA vector of at least 10, or at least 15, or at least 20 per engineered bacterial cell.
[0025] In another aspect, the disclosure provides an engineered bacterial cell for producing a circular DNA vector, the cell comprising: (a) a plasmid template, wherein the plasmid template comprises: (i) a first segment comprising a therapeutic sequence and a sequence comprising a bacterial origin of replication, wherein the first segment is flanked by two transposase overhang sequences; and (ii) a second segment comprising a plasmid backbone, wherein the second segment is flanked by a left end (LE) repeat sequence and a right end (RE) repeat sequence, wherein the LE repeat sequence and the RE repeat sequence are bindable by a transposase protein; and (b) a Rep gene encoding a bacterial replication protein that binds to the bacterial origin of replication. In various embodiments, the bacterial cell further comprises a transposase protein, wherein the transposase protein hydrolyzes DNA adjacent to the transposase overhang sequences. In some embodiments, the engineered bacterial cell further comprises (e.g., produces): (c) a circular DNA vector comprising the therapeutic sequence, the sequence comprising the bacterial origin of replication, and one of the two transposase overhang sequences; and / or (d) a linear closed-ended DNA molecule comprising the plasmid backbone flanked by the LE repeat sequence and the RE repeat sequence.
[0026] In some embodiments, the transposase protein is encoded by a transposase gene expressed by the engineered bacterial cell, and the transposase gene is integratable into the bacterial genome. In some embodiments, the engineered bacterial cell further expresses an IEE, wherein the IEE is encodable by a gene integrated into the bacterial genome.
[0027] In any of the foregoing embodiments for expressing a transgene in an ocular cell, step (a) can comprise intra- anterior chamber administration of the circular DNA vector or administration of the circular DNA vector into corneal stroma. In some embodiments, step (b) comprises placing one or more electrodes (e.g., one or more needle electrodes, e.g., a monopolar needle electrode) intra- anterior chamber, and step (c) comprises delivering electrical energy through the one or more intra- anterior chamber placed electrodes. In some embodiments, the intra- anterior chamber location of the one or more electrodes is 5 mm from the corneal endothelium.
[0028] In some embodiments of any of the foregoing embodiments, the ocular cell expressing the pro-segment of the circular DNA vector is a corneal cell, a trabecular meshwork cell, an iris cell, a lens cell, a ciliary body cell, and / or a Schlemm’s canal cell. In some embodiments, the ocular cell of the pro-segment is a corneal endothelial cell or a corneal stromal cell.
[0029] In some embodiments, the transgene encodes a protective factor that promotes corneal endothelial cell survival. In some embodiments, the protective factor modulates the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway (e.g., an Nrf2 agonist), the Rho kinase (ROCK) signaling pathway (e.g., a ROCK inhibitor), the transforming growth factor beta (TGF-B) signaling pathway (e.g., a TGF-B inhibitor), or the fibroblast growth factor 1 (FGF-1) signaling pathway. In some embodiments, the circular DNA vector silences, corrects, or replaces a mutant gene associated with Fuch’s dystrophy, such as solute carrier family 4 member 11 (SLC4A11), TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.
[0030] In another aspect, the application provides a method of expressing a therapeutic protein in ocular cells of an anterior segment of an individual. In some embodiments, the method comprises: (a) administering a nucleic acid vector to the anterior segment of the eye (e.g., the anterior chamber or the corneal stroma), wherein the nucleic acid vector encodes a therapeutic protein; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through the one or more electrodes under conditions suitable for electroporating the nucleic acid vector into ocular cells of the anterior segment, thereby expressing the therapeutic protein in ocular cells of the anterior segment.
[0031] In some embodiments, the therapeutic protein is a protective factor that promotes corneal endothelial cell survival. In some embodiments, the protective factor modulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway. In some embodiments, the nucleic acid vector silences, corrects, or replaces a mutant gene associated with Fuch’s dystrophy, such as SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.
[0032] In some embodiments, the individual has Fuch’s dystrophy.
[0033] In another aspect, the application provides a method of treating Fuch’s dystrophy in an individual in need thereof, the method comprising: (a) administering a nucleic acid vector to the anterior segment of the eye (e.g., the anterior chamber or the corneal stroma) of the individual, wherein the nucleic acid vector encodes a protective factor that promotes corneal endothelial cell survival; (b) placing one or more electrodes inside and / or around the eye; and (c) transmitting electrical energy through the one or more electrodes under conditions suitable for electroporating the nucleic acid vector into ocular cells of the anterior segment, thereby expressing the protective factor in ocular cells of the anterior segment in an amount sufficient to treat Fuch’s dystrophy.
[0034] In another aspect, a method of treating Fuchs' dystrophy in an individual in need thereof is provided, the method comprising: (a) administering a nucleic acid vector to an anterior segment (e.g., the anterior chamber or corneal stroma) of the eye in the individual, wherein the nucleic acid vector silences, corrects, or replaces a mutant gene associated with Fuchs' dystrophy; (b) placing one or more electrodes in and / or around the eye; and (c) delivering electrical energy through the one or more electrodes under conditions suitable for electroporation of the nucleic acid vector into cells of the anterior segment, thereby silencing, correcting, or replacing the mutant gene in an amount sufficient to treat Fuchs' dystrophy.
[0035] In some embodiments, the nucleic acid vector lacks one or more components of a plasmid backbone. In some embodiments, the one or more components of a plasmid backbone that are lacking in the circular DNA vector comprise a drug resistance gene and / or a replication origin.
[0036] In some embodiments, the nucleic acid vector is a circular DNA vector, e.g., a non-viral circular DNA vector, e.g., a naked circular DNA vector. In some embodiments, the DNA vector is a synthetic circular DNA vector. In some embodiments, the DNA vector comprises a replication origin and / or lacks a selectable marker. In some embodiments, the 3' end of the transgene is linked to the 5' end of the promoter of the transgene by a sequence comprising a bacterial replication origin, wherein the sequence comprising the bacterial replication origin is less than 100 bp in length. In some embodiments, the replication origin is a ColE2-P9 replication origin or a functional variant thereof.
[0037] In some embodiments, the individual is a mammal, e.g., a human.
[0038] In another aspect, there is provided a circular DNA vector (e.g., an isolated and / or engineered circular DNA vector) comprising: (a) a eukaryotic promoter; (b) a coding sequence, wherein the coding sequence: (i) encodes a protective factor that promotes corneal endothelial cell survival; or (ii) silences, corrects, or replaces a mutant gene associated with Fuchs’ dystrophy; and (c) a bacterial origin of replication that is less than 50 bp in length, wherein the circular DNA vector lacks a selectable marker (e.g., a drug resistance gene). In some embodiments, the 3’ end of the coding sequence is connected to the 5’ end of the promoter by a sequence comprising the bacterial origin of replication, wherein the sequence comprising the bacterial origin of replication is less than 100 bp in length. In some embodiments, the origin of replication is a ColE2-P9 origin of replication or a functional variant thereof (e.g., a truncated ColE2-P9 origin as described). In some embodiments, the protective factor modulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway. In some embodiments, the gene associated with Fuchs’ dystrophy is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.
[0039] In another aspect, the present application provides a pharmaceutical composition comprising: (a) a circular DNA vector of any of the preceding aspects of any of the preceding embodiments; and (b) a suitable vehicle for use in delivering the pharmaceutical composition into an individual.
[0040] In another aspect, provided is a method of delivering a circular DNA vector of any of the preceding embodiments of any of the preceding aspects to ocular cells of the anterior segment of an individual (e.g., corneal endothelial cells of an individual), the method comprising: (a) administering the circular DNA vector to the anterior segment of the eye (e.g., by intracameral injection or injection into the corneal stroma); (b) placing one or more electrodes in and / or around the eye (e.g., placing one or more electrodes (e.g., needle electrodes) in the anterior chamber); and (c) transmitting electrical energy (e.g., an electric pulse) through the one or more electrodes under conditions suitable for electroporating the circular DNA vector into ocular cells of the anterior segment, thereby delivering the circular DNA vector to ocular cells of the anterior segment (e.g., corneal endothelial cells). In some embodiments, the circular DNA vector is expressed in ocular cells of the anterior segment (e.g., corneal endothelial cells) eight days after administration. In some embodiments, a transgene expressed in ocular cells of the anterior segment by the circular DNA vector is more durable than a transgene encoded by a plasmid DNA vector encoding the transgene. In some embodiments, the circular DNA vector lacks one or more components of the plasmid backbone that include a drug resistance gene and / or an origin of replication. In some embodiments, the individual is a mammal, e.g., a human. BRIEF DESCRIPTION OF DRAWINGS
[0041] The application file contains at least one drawing executed in color. Copies of this patent or patent application with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0042] Figure 1A is a schematic showing the relative positions of a DNA injection needle and an electrode needle in the anterior segment of an eye, as described in Example 1. DNA was administered to the anterior chamber (intracameral), and a pulsed electric field was transmitted through a single monopolar electrode in the anterior chamber (intracameral).
[0043] Figure 1B is a real-time fluorescent image taken using a RetCam with gonioscopic lens showing GFP expression in a rabbit eye at day 7 post-surgery.
[0044] Figure 1C is a fluorescent image showing GFP expression (green) in the corneal endothelium. NaK ATPase is red, and DAPI is blue.
[0045] Figure 2A is a schematic showing the relative positions of a DNA injection needle and an electrode needle in the anterior segment of an eye, as described in Example 2. DNA was administered to the corneal stroma, and a pulsed electric field was transmitted through a single monopolar electrode in the anterior chamber (intracameral).
[0046] Figure 2Bis a fluorescent real-time image taken using a RetCam with a gonioscope, showing extensive GFP expression in a rabbit eye 7 days post-surgery.
[0047] Figure 2C is a fluorescent image showing GFP expression (green) in the corneal endothelium. NaK ATPase is red, and DAPI is blue. DETAILED DESCRIPTION
[0048] I. Definitions
[0049] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs and in connection with the references cited herein, which provide general guidance regarding many of the terms used in the present application. If there is any conflict in the definitions provided in this document and the definitions provided in the referenced publications, the definitions provided in this document control.
[0050] As used herein, the terms "anterior segment" and "anterior portion of the eye" are used interchangeably to refer to the region of the eye containing the cornea, iris, ciliary body, and lens, and the anterior chamber and posterior chamber space filled with aqueous humor.
[0051] As used herein, "electrotransfer" refers to movement of a molecule (e.g., a nucleic acid, e.g., a naked nucleic acid) across a membrane of a target cell (e.g., from outside to inside of a target cell, e.g., a corneal endothelial cell) that is caused by transmission of an electric field (e.g., a pulsed electric field) to a microenvironment (e.g., the anterior segment of the eye) in which the cell is located. Electrotransfer can occur as a result of electrophoresis, i.e., movement of a molecule (e.g., a nucleic acid, e.g., a naked nucleic acid) along an electric field (e.g., in the direction of an electric current) based on the charge of the molecule. Electrophoresis can induce electrotransfer, e.g., by moving a molecule (e.g., a nucleic acid, e.g., a naked nucleic acid) near a cell membrane to allow a biological transport process (e.g., endocytosis including pinocytosis or phagocytosis) or passive transport (e.g., diffusion or lipid partitioning) to bring the molecule into the cell. Additionally or alternatively, electrotransfer can occur as a result of electroporation, i.e., the creation of a pore in a target cell by transmission of an electric field (e.g., a pulsed electric field) where the size, shape, and duration of the pore are suitable for accommodating movement of a molecule (e.g., a nucleic acid, e.g., a naked nucleic acid) from outside of the target cell to inside of the target cell. Thus, in some cases, electrotransfer occurs as a result of a combination of electrophoresis and electroporation.
[0052] The terms "level of expression" or "expression level" are used interchangeably and generally refer to the amount of polynucleotide or amino acid product or protein in a biological sample (e.g., retina). "Expression" generally refers to the process by which genetic code information is converted into structures that are present and functioning in a cell. Thus, according to the present application, "expression" of a gene can refer to transcription into a polynucleotide, translation into a protein, or post-translational modification of a protein. Fragments of a transcribed polynucleotide, translated protein, or post-translationally modified protein should also be considered expressed, whether they arise from a transcript produced by alternative splicing or a degraded transcript, or from post-translational processing of a protein, e.g., by proteolysis. "Expressed genes" include those that are transcribed into a polynucleotide that is then translated into a protein, as well as those that are transcribed into RNA but not translated into a protein (e.g., transfer and ribosomal RNAs).
[0053] As used herein, "delivering," "to deliver," and grammatical variants thereof refer to causing an agent (e.g., a therapeutic agent) to enter a target cell. An agent can be delivered by administering the agent to an individual having a target cell (e.g., systemically or locally administering the agent) such that the agent has access to the organ or tissue in which the target cell is located. Additionally or alternatively, an agent can be delivered by applying a stimulus to a tissue or organ containing the agent, wherein the stimulus causes the agent to enter a target cell. Thus, in some cases, an agent is delivered to a target cell by transmitting an electric field into a tissue containing the agent under conditions suitable for electrically transfecting the agent into the target cell within the tissue.
[0054] As used herein, "administering" refers to the method of dosing an individual with a therapeutic agent of the disclosure (e.g., a nucleic acid vector described herein) or a composition thereof. The compositions utilized in the methods described herein can be administered intraocularly, e.g., intra-camerally (i.e., into the aqueous humor), into the cornea (e.g., into the corneal stroma), intravitreally, subretinally, or periocularly. Additionally or alternatively, the compositions can be delivered intravenously, subcutaneously, intradermally, transdermally, intramuscularly, intra-arterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intra-prostatically, intrapleurally, intratracheally, intrathecally, intranasally, intravaginally, intrarectally, topically, intraperitoneally, subconjunctival, intracapsular, transmucosally, intrapericardially, intranasoally, orally, topically, transdermally, conjunctivally, subtenonally, intracamerally, subretinally, retrobulbarly, intramicroscopically, by inhalation, by injection, by implantation, by infusion, by continuous infusion, by direct local perfusion to infiltrate a target cell, by catheter, by lavage, in creme, or in a lipid composition. The compositions utilized in the methods described herein can be administered systemically. The method of administration can vary depending on various factors, e.g., the compound or composition administered and the severity of the condition, disease, or disorder being treated.
[0055] As used herein, the terms "vector" and "nucleic acid vector" are used interchangeably and refer to a nucleic acid molecule capable of delivering an attached therapeutic sequence into a target cell, where the therapeutic sequence can be subsequently transcribed, replicated, processed, and / or expressed. A therapeutic sequence is not considered a vector after it has been processed by the target or host cell. One type of vector is a "plasmid," which refers to a circular double stranded DNA loop containing a bacterial backbone into which additional DNA segments can be ligated. Another type of vector is a bacteriophage vector. Another type of vector is a viral vector (e.g., an adeno-associated virus (AAV) vector), in which additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Additionally certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply, "recombinant vectors" or "expression vectors"). Any of the nucleic acid vectors described herein can be referred to as an "isolated nucleic acid vector."
[0056] As used herein, the term "circular DNA vector" refers to a DNA vector in a circular form. Such circular forms are generally capable of being amplified into concatemers by rolling circle amplification. As used herein, a linear double stranded nucleic acid having strands that are bound at the ends (e.g., a backbone covalently conjugated as by a hairpin loop or other structure) is not a circular vector. The term "circular DNA vector" can be used interchangeably herein with the terms "covalently closed circular DNA vector" and "covalently closed circular DNA" (cccDNA). As used herein, the term "circular DNA vector" refers to a DNA vector in a circular form. Such circular forms are generally capable of being amplified into concatemers by rolling circle amplification. As used herein, a linear double stranded nucleic acid having strands that are bound at the ends (e.g., a backbone covalently conjugated as by a hairpin loop or other structure) is not a circular vector. The term "circular DNA vector" can be used interchangeably herein with the terms "covalently closed circular DNA vector" and "covalently closed circular DNA" (cccDNA). 3 As used herein, the term "circular DNA vector" refers to a DNA vector in a circular form. Such circular forms are generally capable of being amplified into concatemers by rolling circle amplification. As used herein, a linear double stranded nucleic acid having strands that are bound at the ends (e.g., a backbone covalently conjugated as by a hairpin loop or other structure) is not a circular vector. The term "circular DNA vector" can be used interchangeably herein with the terms "covalently closed circular DNA vector" and "covalently closed circular DNA" (cccDNA). As used herein, the term "circular DNA vector" refers to a DNA vector in a circular form. Such circular forms are generally capable of being amplified into concatemers by rolling circle amplification. As used herein, a linear double stranded nucleic acid having strands that are bound at the ends (e.g., a backbone covalently conjugated as by a hairpin loop or other structure) is not a circular vector. The term "circular DNA vector" can be used interchangeably herein with the terms "covalently closed circular DNA vector" and "covalently closed circular DNA" (cccDNA).
[0057] As used herein, the term "recombination site" refers to a nucleic acid sequence that is the product of site-specific recombination, which includes a first sequence corresponding to a portion of a first recombination enzyme attachment site and a second sequence corresponding to a portion of a second recombination enzyme attachment site. One example of a hybrid recombination site is attR, which is the product of site-specific recombination and includes a first sequence corresponding to a portion of attP and a second sequence corresponding to a portion of attB. Alternatively, recombination sites can be generated by Cre / Lox recombination. Thus, vectors generated by Cre / Lox recombination (e.g., vectors including a LoxP site) include recombination sites as used herein. Other site-specific recombination events that generate recombination sites include, for example, lambda integrase, FLP recombinase, and Kw recombination enzymes. Nucleic acid sequences generated by non-site-specific recombination events (e.g., ITR-mediated intermolecular recombination) are not recombination sites as defined herein.
[0058] As used herein, the terms "individual" and "subject" are used interchangeably and include any mammal in need of treatment or prevention, e.g., by a therapeutic circular DNA vector or pharmaceutical composition thereof described herein. In some embodiments, the individual or subject is a human. In other embodiments, the individual or subject is a non-human mammal (e.g., a non-human primate (e.g., a monkey), a mouse, a pig, a rabbit, a cat, or a dog). The individual or subject can be male or female.
[0059] As used herein, an "effective amount" or "effective dose" of a nucleic acid vector or pharmaceutical composition thereof refers to an amount sufficient to achieve a desired biological, pharmacological, or therapeutic effect, e.g., when administered to an individual according to the chosen form, route, and / or schedule of administration. As will be appreciated by those of ordinary skill in the art, the absolute amount of a particular composition that is effective can vary depending on factors such as the desired biological or pharmacological endpoint, the agent to be delivered, the target tissue, and the like. Those of ordinary skill in the art will further appreciate that an "effective amount" can be contacted with a cell or administered to a subject in a single dose or by using multiple doses. An effective amount of a composition to treat a disease can slow or stop disease progression, or increase partial or complete response, relative to a reference population, e.g., an untreated population or a placebo population, or a population receiving standard-of-care treatment.
[0060] As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In some embodiments, the therapeutic circular DNA vectors of the application are used to delay development of a disease or to slow the progression of a disease (e.g., reduction in corneal thickness or loss of vision).
[0061] As used herein, “target cell” refers to a cell that expresses a therapeutic protein encoded by a therapeutic gene.
[0062] The terms “level of expression” or “expression level” are used interchangeably and generally refer to the amount of polynucleotide or amino acid product or protein in a biological sample (e.g., corneal endothelium). “Expression” generally refers to the process by which genetic code information is converted into structures that are present and functioning in a cell. Thus, according to the present application, “expression” can refer to transcription into a polynucleotide, translation into a protein, or post-translational modification of a protein. Fragments of a transcribed polynucleotide, translated protein, or post-translationally modified protein should also be considered to be expressed, whether they arise from a transcript produced by alternative splicing or a degraded transcript, or from post-translational processing of a protein, e.g., by proteolysis. “Expressed genes” include those that are transcribed into a polynucleotide that is then translated into a protein, as well as those that are transcribed into RNA but not translated into a protein (e.g., transfer and ribosomal RNA). The term “a” or “an” means “one or more.” For example, “a cell” is understood to mean one or more cells. Accordingly, the terms “a” or “an,” “one or more” and “at least one” are used interchangeably herein.
[0063] As used herein, unless otherwise indicated, the term “about” means a range of values ±10% from a reference value.
[0064] II. Methods
[0065] Provided herein are methods of administering nucleic acid vectors to the anterior segment of the eye using electroporation. Such methods include methods of expressing a transgene encoded by a nucleic acid vector, and methods of treating a disease (e.g., Fuchs endothelial dystrophy) by administering a nucleic acid vector encoding a protective factor that promotes survival of corneal endothelial cells, or by administering a nucleic acid vector that silences, corrects, or replaces a mutant gene associated with Fuchs dystrophy.
[0066] Fuchs' dystrophy
[0067] The methods provided herein can be used to treat diseases of the anterior segment of the eye, such as Fuchs' dystrophy, which is characterized by a gradual loss of vision due to progressive degeneration of the corneal endothelium. The methods of the invention provide treatment for Fuchs' dystrophy by administering nucleic acid vectors that (a) encode a protective factor that promotes survival of corneal endothelial cells or (b) silence, correct, or replace a mutant gene associated with Fuchs' dystrophy, and transfecting corneal endothelial cells with these vectors by electroporation.
[0068] In some embodiments, the methods of treating Fuchs' dystrophy involve administering nucleic acid vectors that express a protective factor known to promote survival of corneal endothelial cells. Exemplary protective factors include modulators of Nrf2, ROCK, TGF-B, and FGF-1. In some embodiments, the protective factor modulates the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway (e.g., an Nrf2 agonist), the Rho kinase (ROCK) signaling pathway (e.g., a ROCK inhibitor), the transforming growth factor beta (TGF-B) signaling pathway (e.g., a TGF-B inhibitor), or the fibroblast growth factor 1 (FGF-1) signaling pathway. Thus, such protective factors can be cell-bound (e.g., intracellular or membrane-bound in the transfected cells) or secreted to the extracellular space (e.g., can act on one or more additional cell types or extracellular components of the anterior segment of the eye).
[0069] In other embodiments, the methods of treating Fuchs' dystrophy involve administering nucleic acid vectors that silence (e.g., by inhibitory nucleic acids (e.g., shRNAs)), correct (e.g., by gene editing, e.g., CRISPR), or replace (e.g., replace with a functional version of the same or a functionally similar or equivalent gene) a mutant gene associated with (i.e., known to cause or contribute to) Fuchs' dystrophy. Genes associated with Fuchs' dystrophy are known in the art and include, for example, SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2. Specific information (e.g., nucleotide and amino acid changes) regarding these mutations are identified and discussed in Liu et al., Eye Vis. 2021:8(1):24, which is incorporated by reference herein in its entirety.
[0070] In some embodiments, the mutation in the gene is an autosomal dominant mutation.
[0071] Administration of therapeutic agents
[0072] Provided herein are methods of administering a nucleic acid vector (e.g., any of the nucleic acid vectors described herein) or a pharmaceutical composition thereof to the anterior segment of an eye to deliver a therapeutic agent to a target cell in the anterior segment of an individual (e.g., a human patient). In some cases, the nucleic acid vector is administered to the eye such that the nucleic acid vector enters the extracellular space of the anterior segment of the eye (e.g., the anterior chamber or the corneal stroma). Once the nucleic acid vector is in the extracellular space of the anterior segment following administration, it can then be electroporated into a target retinal cell via electrical energy transmission to the anterior segment of the eye, e.g., by electrical energy transmission from an electrode placed within, on, or near the eye (e.g., within the anterior chamber).
[0073] In some embodiments, the nucleic acid vector is administered prior to transmission of the electrical field. For example, the nucleic acid vector can be administered within 24 hours prior to transmission of the electrical field (e.g., within 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 3 hours, 2 hours, 90 minutes, 60 minutes, 45 minutes, 30 minutes, 20 minutes, 15 minutes, 10 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes, 1 minute, 45 seconds, 30 seconds, 20 seconds, 15 seconds, 10 seconds, or 5 seconds prior to transmission of the electrical field). In some embodiments, the nucleic acid vector is administered as part of a method described herein.
[0074] Any suitable anterior eye administration means known in the art or described herein can be used as part of the methods provided herein. Methods of delivering a nucleic acid vector to a target retinal cell include administering the nucleic acid vector to the eye by intraocular injection (e.g., intracameral injection) or intraocular implantation. In some embodiments of any of the methods described herein, administration of the nucleic acid vector is achieved by intraocular implantation (e.g., controlled release or depot implantation). In other embodiments, administration of the nucleic acid vector is not achieved by intraocular implantation.
[0075] In some cases, administration of the nucleic acid vector is non-surgical. For example, in some embodiments, administration of the nucleic acid vector does not utilize general anesthesia and / or does not involve retrobulbar anesthesia (i.e., retrobulbar block). Additionally or alternatively, administration of the nucleic acid vector does not involve injection using a needle larger than 28 gauge.
[0076] Additionally or alternatively, administration of the nucleic acid vector does not involve the use of a guided mechanism that typically requires shunt or cannula placement for ocular drug delivery.
[0077] In some cases, administration of the nucleic acid vector is achieved by injection (e.g., microneedle injection) into an external tissue of the eye (e.g., the sclera, cornea, corneal stroma, conjunctiva, subconjunctival space, or subretinal space). Alternatively, administration of the nucleic acid vector is achieved by injection (e.g., microneedle injection) into a site proximal to an external tissue (e.g., the trabecular meshwork, ciliary body, or aqueous humor).
[0078] In some cases, administration of the nucleic acid vector is achieved by topical administration or eye drops.
[0079] Any of the nucleic acid vectors or pharmaceutical compositions thereof described herein can be administered to a subject at a dose of 1 μg to 10 mg of DNA (e.g., from 5 μg to 5.0 mg, from 10 μg to 2.0 mg, or from 100 μg to 1.0 mg of DNA, e.g., from 10 μg to 20 μg, from 20 μg to 30 μg, from 30 μg to 40 μg, from 40 μg to 50 μg, from 50 μg to 75 μg, from 75 μg to 100 μg, from 100 μg to 200 μg, from 200 μg to 300 μg, from 300 μg to 400 μg, from 400 μg to 500 μg, from 500 μg to 1.0 mg, from 1.0 mg to 5.0 mg; or from 5.0 mg to 10 mg of DNA, e.g., about 10 μg, about 20 μg, about 30 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg, about 90 μg, about 100 μg, about 150 μg, about 200 μg, about 250 μg, about 300 μg, about 350 μg, about 400 μg, about 450 μg, about 500 μg, about 600 μg, about 700 μg, about 750 μg, about 1.0 mg, about 2.0 mg, about 2.5 mg, about 5.0 mg, about 7.5 mg, or about 10 mg of DNA).
[0080] Transmission of electric field
[0081] Methods of delivering a nucleic acid vector (e.g., a circular DNA vector) to the anterior segment of the eye involve the transmission of electrical energy into the tissue where the target ocular cells reside. Such methods involve the electrotransfer of a therapeutic agent from the extracellular space of the anterior segment of the eye (e.g., the anterior chamber or corneal stroma) into the target ocular cells (e.g., the corneal endothelium). For example, in some cases where an individual is being treated for a disease of the anterior segment of the eye (e.g., Fuchs’ dystrophy), the methods involve the transmission of electrical energy into the retina to cause the electrotransfer of a nucleic acid vector from the extracellular space within or adjacent to the cornea into the corneal endothelial cells.
[0082] In some aspects of the application, an electrode is placed inside an individual’s eye (e.g., in the anterior segment, e.g., in the anterior chamber or corneal stroma), and an electric field is transmitted into the target ocular tissue by the electrode under conditions suitable for electrically transfecting nucleic acid vectors into target cells (e.g., corneal endothelial cells). The electric field transmitted into the target ocular tissue can facilitate the transfer of nucleic acid vectors (e.g., circular DNA vectors) into the target ocular cells. Such electric transfection can occur by any of several mechanisms (and combinations thereof), including electrophoresis, electrokinetically driven drug uptake, and / or electroporation. The delivery of the electric field involves conditions suitable for such mechanisms. Suitable means for generating electric fields for electrically transfecting nucleic acids in mammalian tissue are known in the art, and any suitable means known in the art or described herein can be suitable for use as part of the present application.
[0083] Various means of generating and delivering electric fields into tissue are contemplated herein as part of the methods of the present application. Devices and systems having electrodes suitable for delivering electric fields into mammalian tissue are commercially available and can be used in the methods disclosed herein. In some cases, the electric field is delivered by an electrode comprising a needle (e.g., a needle located in the vitreous humor or in the subretinal space). Suitable needle electrodes include the CLINIPORATOR® electrodes sold by IGEA® and the needle electrodes sold by AMBU®. Other electrodes that can be adapted for use in the anterior segment of the eye are described in International Patent Publication No. WO 2022 / 198138, which is incorporated herein by reference in its entirety.
[0084] The electrodes (e.g., needle electrodes) used in the methods of the present application can be monopolar. In some embodiments involving electric transfection using a monopolar electrode, a grounding electrode is attached to a point on the individual other than the eye (e.g., to the individual’s skin). In some embodiments, the grounding electrode is a pad that contacts the individual’s skin on the buttocks, leg, torso, neck (e.g., the back of the neck), or head (e.g., the back of the head or the temple). In some embodiments, the monopolar electrode delivers electrical energy after being positively charged. In some embodiments, the monopolar electrode delivers electrical energy after being negatively charged.
[0085] Alternatively, the electrode can be bipolar. In bipolar embodiments, an auxiliary electrode can be in electrical communication with the primary electrode. The auxiliary electrode can be proximate to the primary electrode (i.e., closer to the operator), e.g., be part of or connected to a sheath that houses the primary lead electrode. In some embodiments involving electric transfection using a bipolar electrode, electrical energy (e.g., electrical current) is delivered after a positive voltage is applied to the primary electrode and a negative voltage is applied to the auxiliary electrode. In some embodiments involving electric transfection using a bipolar electrode, electrical energy (e.g., electrical current) is delivered after a negative voltage is applied to the primary electrode and a positive voltage is applied to the auxiliary electrode.
[0086] It should be appreciated that a variety of suitable electrical parameters and algorithms thereof can be used. The power supply can be configured to generate, for example, an electric field intensity of about 10 V / cm to about 1,500 V / cm (e.g., about 10 V / cm to about 100 V / cm, e.g., about 10 V / cm, 20 V / cm, 30 V / cm, 40 V / cm, 50 V / cm, 60 V / cm, 70 V / cm, 80 V / cm, 90 V / cm, or 100 V / cm; e.g., about 100 V / cm to about 1,000 V / cm, e.g., about 200 V / cm, 300 V / cm, 400 V / cm, 500 V / cm, 600 V / cm, 700 V / cm, 800 V / cm, 900 V / cm, or 1,000 V / cm; e.g., about 1,000 V / cm to about 1,500 V / cm, e.g., about 1,110 V / cm, 1,200 V / cm, 1,300 V / cm, 1,400 V / cm, or 1,500 V / cm) at the target cells. In some embodiments, the power supply is configured to generate, for example, an electric field intensity of about 10 V / cm to about 1,000 V / cm (e.g., about 10 V / cm to 500 V / cm or about 500 V / cm to about 1,000 V / cm) at the target cells. In some embodiments, the field strength is 50 V / cm to 300 V / cm. In some embodiments, the field strength at the target cells (e.g., target retinal cells) is about 100 V / cm.
[0087] In some embodiments, the total number of electrical energy pulses is delivered in 1-60 seconds (e.g., in 1-5 seconds, 5-10 seconds, 10-15 seconds, 15-20 seconds, 20-30 seconds, 30-40 seconds, 40-50 seconds, or 50-60 seconds). In some embodiments, the total number of electrical energy pulses is delivered in 1-20 seconds. For example, the total number of electrical energy pulses can be delivered in 1-5 seconds, 5-10 seconds, 10-15 seconds, or 15-20 seconds, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 seconds. The electrical energy pulses can be, for example, square waveforms. The electrical energy pulses can have an amplitude of 5 V to 500 V. For example, the electrical energy pulses can have an amplitude of about 5 V, 10 V, 15 V, 20 V, 25 V, 30 V, 35 V, 40 V, 45 V, 50 V, 60 V, 70 V, 80 V, 90 V, 100 V, 125 V, 150 V, 175 V, 200 V, 225 V, 250 V, 275 V, 300 V, 325 V, 350 V, 375 V, 400 V, 425 V, 450 V, 475 V, or 500 V. In some embodiments, the electrical energy pulses have an amplitude of about 5-250 V (e.g., about 20 V). Any of the above voltages can be the top of a rectangular waveform, the peak of a sinusoidal waveform, the peak of a sawtooth waveform, the root mean square (RMS) voltage of a sinusoidal waveform, or the RMS voltage of a sawtooth waveform.
[0088] In some embodiments, about 1-12 electrical energy pulses (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 pulses) are delivered during use. In some embodiments, about 4-12 electrical energy pulses are delivered during use.
[0089] In some embodiments, each electrical energy pulse is about 10 ms to about 200 ms. For example, each electrical energy pulse can be about 10 ms, 20 ms, 30 ms, 40 ms, 50 ms, 60 ms, 70 ms, 80 ms, 90 ms, 100 ms, 110 ms, 120 ms, 130 ms, 140 ms, 150 ms, 160 ms, 170 ms, 180 ms, 190 ms, or 200 ms. In some embodiments, each electrical energy pulse is about 50 ms. In some embodiments, each electrical energy pulse is less than 10 ms. For example, each electrical energy pulse can be about 10 ps to about 10 ms, e.g., about 10 ps to about 100 ps, e.g., about 20 ps, 30 ps, 40 ps, 50 ps, 60 ps, 70 ps, 80 ps, 90 ps, or 100 ps; e.g., about 100 ps to about 1 ms, e.g., about 200 ps, 300 ps, 400 ps, 500 ps, 600 ps, 700 ps, 800 ps, 900 ps, or 1 ms; e.g., about 1 ms to about 10 ms, e.g., about 2 ms, 3 ms, 4 ms, 5 ms, 6 ms, 7 ms, 8 ms, 9 ms, or 10 ms.
[0090] As shown in Examples 1 and 2, the relative positioning of the electrode and injection can determine the region of transfection and transgene expression, e.g., of corneal endothelial cells.
[0091] In one instance of the application, any of the nucleic acid vectors described herein can be injected into the corneal stroma, and an electrode placed in the anterior chamber can deliver energy in the aqueous humor. This configuration can result in widespread expression within (e.g., and specific to) the corneal endothelium.
[0092] Alternatively, any of the nucleic acid vectors described herein can be injected intracameral, and an electrode placed in the anterior chamber can deliver energy in the aqueous humor. This configuration can result in localized expression within (e.g., and specific to) the corneal endothelium, in the region proximal to the electrode. In some instances, the method comprises repositioning the electrode one or more times and repeating energy delivery to transfect two or more regions of the corneal endothelium.
[0093] III. Compositions
[0094] The application provides therapeutic compositions (e.g., nucleic acid vectors and pharmaceutical compositions thereof) useful in the treatment of Fuchs’ Dystrophy. In some instances, the application provides covalently closed circular DNA (C 3 DNA) vectors (e.g., C 3DNA vectors).
[0095] Nucleic acid vectors
[0096] Provided herein are nucleic acid vectors comprising any transgene or coding sequence described herein. Nucleic acid vectors can be produced according to methods for producing plasmid DNA vectors, nanoplasmid vectors (as described in, e.g., WO 2008 / 153733 and WO 2014 / 035457), minicircle DNA vectors (as described in, e.g., U.S. Patent Nos. 8,828,726 and 9,233,174), minintron plasmids (as described in, e.g., Lu et al., Mol. Ther. 2013, 21:954 and U.S. Patent No. 9,347,073), synthetic circular DNA vectors as described herein and in WO 2019 / 178500, closed-end DNA vectors (as described in, e.g., U.S. 2020 / 0283794 and U.S. 2021 / 0071197), dogbone DNA vectors (as described in, e.g., U.S. 2015 / 0329902 and U.S. Patent No. 9,499,847), or microstring DNA vectors (as described in, e.g., U.S. Patent No. 9,290,778 and USRE48908E1). In particular embodiments, any nucleic acid vector described herein comprises a therapeutic sequence.
[0097] In some cases, the nucleic acid vector is a C 3 DNA vectors that persist in the cell in episomal form (e.g., in dividing or quiescent cells, such as post-mitotic cells), for example, in a manner analogous to AAV vectors. In any embodiment described herein, the circular DNA vector can be a non-integrating vector. The C 3 DNA vectors can be naked DNA vectors, free of components inherent to viral vectors (e.g., viral proteins) and major components of bacterial plasmid DNA, such as immunogenic components (e.g., immunogenic bacterial signature sequences (such as CpG islands or CpG motifs)) or otherwise or otherwise components associated with reduced persistence (e.g., CpG islands or CpG motifs). Circular DNA vectors feature one or more therapeutic sequences and can lack plasmid backbone elements, such as (i) a bacterial origin of replication and / or (ii) a drug resistance gene and / or (iii) a recombination site. Synthetic circular DNA vectors lacking an origin of replication can be synthesized by various methods known in the art and described herein. Synthetic methods can involve the use of a bacteriophage polymerase, such as Phi29 polymerase, as a replication tool using, e.g., rolling circle amplification. Particular methods of cell-free synthesis of synthetic circular DNA vectors are further described in, e.g., WO 2019 / 178500, which is hereby incorporated by reference.
[0098] In other embodiments, the therapeutic circular DNA vectors described herein can be non-synthetic vectors (e.g., containing bacterial backbone sequences, such as an origin of replication and / or recombination sites).
[0099] Such nucleic acid vectors described herein (e.g., circular DNA vectors lacking plasmid backbone elements) can be produced in vivo (e.g., in bacteria), and can lack a selectable marker (e.g., a drug resistance gene) and optionally lack a recombination site or transposase scar, for example, by using an engineered bacterial cell to produce a circular DNA vector from a parental plasmid. Such bacterial-produced circular DNA (e.g., C 3 DNA) vectors can include any of the features described in International Patent Application No. PCT / US2022 / 082078, which is incorporated by reference herein in its entirety. A bacterial cell (e.g., E. coli) can be engineered to contain a Rep gene encoding a bacterial replication protein, which is optionally integrated into the bacterial genome. The engineered cell can be transfected with a parental plasmid having a vector sequence and a backbone sequence. The vector sequence includes an ori sequence (e.g., a ColE2-P9 origin of replication) corresponding to the Rep gene, and does not include a selectable marker. The backbone sequence includes a selectable marker, and does not include the ori sequence included in the vector sequence. The parental plasmid can also have a restriction enzyme recognition sequence, or a site-specific recombination, or a transposase recognition sequence, which is flanked by the vector sequence, such that the plasmid backbone sequence can be separated from the vector sequence within the cell by restriction enzyme cleavage, site-specific recombination, or transposase action. In the case of restriction enzyme cleavage, a circular DNA vector is subsequently formed by self-ligation of the vector sequence. In the case of site-specific recombination or transposase action, a circular DNA vector is formed upon completion of the recombination or transposase action. Upon separation of the vector sequence and formation of the circular DNA vector, expression of the rep protein can maintain a high copy number of the circular DNA vector, despite the lack of a selectable marker for the circular DNA vector. In contrast, maintenance of the plasmid backbone sequence in the engineered bacterial cell after separation can be avoided by changing the culture conditions to remove the selective pressure for the selectable marker. Culturing a population of bacterial cells having a high copy number of the circular DNA vector under conditions in which the parental plasmid is not maintained can be effective to produce a high yield of high purity C 3 DNA vectors having a backbone (and less than 50 bp origin) of less than 100 bp. Such methods are described in WO 2023 / 122625 and U.S. 63 / 509,458 (filed June 21, 2023), which are hereby incorporated by reference in their entireties.
[0100] One benefit of using a transposase-based system is the ability to further reduce the size of the C 3The size of the backbone within the DNA DNA vector. For example, the use of site-specific recombinases results in the presence of recombination sites (e.g., attachment sites) within the vector, near or adjacent to the origin of replication. In contrast, the use of transposases allows the origin of replication to directly link the 5’ end of the therapeutic sequence to the 3’ end of the therapeutic sequence without an intervening sequence. In some cases, the use of transposases can achieve a “scarless” backbone by placing the resulting sequence (transposase overhang) generated by the transposition within the therapeutic sequence without altering the function of the therapeutic sequence. As an example, the piggybac transposase generates a four bp transposase overhang of TTAA. By placing the plasmid backbone at a TTAA site within the sequence of interest, a system can be designed such that upon transposase-mediated excision of the plasmid backbone from the sequence of interest, the original sequence of interest is restored, leaving only the original TTAA sequence as the transposase scar. This results in a C 3 The backbone within the DNA DNA vector is free of transposase scars. Thus, the plasmid backbone sequence in the vector can consist entirely of the origin of replication.
[0101] Additionally or alternatively, the transposase scar can be located within the vector backbone (e.g., within the sequence containing the origin of replication). For example, if the parent plasmid contains inverted repeat sequences flanking the backbone (left end) and (right end), and / or transposase overhang sequences flanking the therapeutic sequence, the transposase scar will be located between the 3’ and 5’ ends of the sequence of interest (e.g., next to the origin of replication).
[0102] In some embodiments, the engineered bacterial cell for producing the C 3 The engineered bacterial cell of the DNA DNA vector includes a Rep gene encoding a bacterial replication protein that directs replication from the ColE2-P9 origin, and the gene can be integrated into the bacterial genome. Alternatively, the Rep gene is included on a DNA molecule outside of the chromosome, such as, for example, a plasmid or a bacterial artificial chromosome (“BAC”). The engineered bacterial cell further comprises a parent plasmid containing a vector sequence and a backbone sequence. The vector sequence includes an origin of replication (ori) sequence corresponding to the Rep gene, and does not include a selectable marker. The backbone sequence includes a gene encoding a selectable marker, and does not include the ori sequence included in the vector sequence. The parent plasmid also has an enzyme recognition sequence (e.g., a restriction enzyme recognition sequence, a site-specific recombination sequence, or a transposase recognition sequence) flanking the vector sequence, such that the plasmid backbone sequence can be separated from the vector sequence within the cell by restriction enzyme cleavage, transposition, or site-specific recombination.
[0103] In some embodiments, the engineered bacterial cell for producing the C 3A short origin of replication is used in the DNA DNA vector to minimize bacterial sequences, such as the ColE2-P9 origin of replication or functional variants thereof. In such embodiments, the Rep gene encodes a ColE2-P9 replication protein. In some exemplary embodiments, the Rep gene encodes a ColE2-P9 replication protein having the amino acid sequence set forth in SEQ ID NO: 1 (or a functional variant thereof, e.g., having at least 80%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto). Other suitable replication proteins include those encoded by naturally occurring plasmids, including, for example, those related to ColE2-P9, such as ColE3-CA38.
[0104] In some exemplary embodiments, the ori (e.g., one strand) comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments, the ori sequence is a functional fragment of a ColE2-P9 ori sequence having the DNA sequence set forth in SEQ ID NO: 2 (on one strand). A 40 base pair functional fragment set forth in SEQ ID NO: 2 is capable of supporting vector replication in a cell expressing a ColE2-P9 replication protein. In some embodiments, the ori is a ColE2-P9 origin and is no more than about 40 nucleotides in length, or no more than 38 nucleotides in length, or no more than 37 nucleotides in length, or no more than 36 nucleotides in length, or no more than 34 nucleotides in length, or no more than 30 nucleotides in length. In various embodiments, the ColE2-P9 origin is 20 to 40 nucleotides in length, or 30 to 40 nucleotides in length, or 34 to 40 nucleotides in length, thereby minimizing C 3 Bacterial-derived sequences in the DNA vector. In some embodiments, the ori sequence is a naturally occurring ori sequence.
[0105] In some cases, the ori sequence is a functional variant of a naturally occurring ori, such as, for example, an ori sequence that has been modified to be shorter than the corresponding naturally occurring ori sequence, but still retains the ability to support replication initiation. Such functional variants of the ColE2-P9 origin of replication include SEQ ID NOs: 3-11. Although the origin is known to exist in the vector as double stranded DNA, for convenience such sequences are shown herein as single stranded. In some embodiments, the functional variant has 1, 2, 3, 4, or 5 nucleotide substitutions relative to the origin sequence of SEQ ID NOs: 3-11.
[0106] In some cases, the C 3The DNA vector is a naked DNA vector and does not contain components inherent to viral vectors (e.g., viral proteins) or major components of bacterial plasmid DNA, such as immunogenic components (e.g., immunogenic bacterial signature sequences (e.g., CpG motifs)) or additional or otherwise associated with reduced persistence (e.g., CpG islands). For example, in some embodiments, C... 3 The DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the DNA lacks one or more elements of the bacterial plasmid DNA, such as immunogenic components (e.g., immunogenic bacterial signature sequences (e.g., CpG motifs)) or additional or otherwise associated components with reduced persistence (e.g., CpG islands). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the DNA lacks CpG methylation. 3 The DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the DNA lacks bacterial methylation signature sequences, such as Dam methylation and Dcm methylation. For example, in some embodiments, C 3 The DNA vector contains DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the GATC sequence is unmethylated (e.g., by Dam methyltransferase). Alternatively or additionally, C 3 DNA vectors contain DNA in which at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or substantially all) of the CCAGG and / or CCTGG sequences are unmethylated (e.g. by Dcm methyltransferase).
[0107] In some embodiments, C lacking one or more components of the plasmid backbone 3 DNA vectors persist in vivo (e.g., relative to a reference vector, such as a circular DNA vector with a plasmid backbone, or a C vector lacking one or more components of the plasmid backbone). 3 DNA vectors exhibit improved expression persistence (e.g., intracellular persistence and / or transgenerational persistence) and / or therapeutic persistence.
[0108] In some embodiments, C lacking one or more components of the plasmid backbone 3Expression of the DNA vector persists for at least two weeks, at least three weeks, at least four weeks, at least six weeks, at least two months, at least three months, at least four months, at least five months, at least six months, at least seven months, at least eight months, at least nine months, at least ten months, at least eleven months, at least one year, or more after administration.
[0109] In some embodiments, the C 3 The DNA vector persists in the targeted ocular cells for at least about six months or at least one year, or at least 18 months, or years. In some embodiments, the C 3 The expression level of the DNA vector decreases by no more than 90%, or no more than 50%, or no more than 25%, or no more than 10% at 1 week or more, e.g., 2 weeks, 3 weeks, 5 weeks, 7 weeks, 9 weeks or more, 13 weeks or more, 18 weeks or more, after transfection. In some embodiments, administration of the nucleic acid vectors of the disclosure (e.g., to retinal cells) is no more than 4 times per year, or no more than 2 times per year, or no more than 1 time per year, or even less frequently (e.g., 1 time every two years).
[0110] In embodiments, the C 3 The DNA vector is monomeric. In some embodiments, the C 3 The DNA vector is supercoiled, e.g., after treatment with a topoisomerase (e.g., gyrase). In some embodiments, the C 3 The DNA vector is a monomeric, supercoiled circular DNA molecule. In some embodiments, the C 3 The DNA vector is nicked. In some embodiments, the C 3 The DNA vector is open circular (relaxed open circular). In some embodiments, the C 3 The DNA vector is double-stranded circular.
[0111] The therapeutic C 3 The DNA DNA vector contains a therapeutic sequence, which can include one or more protein-coding domains and / or one or more non-protein-coding domains. The therapeutic sequence can include any of the expression constructs disclosed herein.
[0112] In embodiments of the C 3 In embodiments of the DNA DNA vector, the therapeutic sequence lacks a protein-coding domain (e.g., a therapeutic protein-coding domain). For example, in some embodiments, the therapeutic sequence includes a non-protein-coding therapeutic nucleic acid, such as a short hairpin RNA (shRNA) coding sequence or an immune-activating therapeutic nucleic acid (e.g., a TLR agonist).
[0113] In the context of C 3In some embodiments of the DNA vector, the length of the therapeutic sequence is from 0.1 Kb to 100 Kb (e.g., the length of the therapeutic gene sequence is 0.2 Kb to 90 Kb, 0.5 Kb to 80 Kb, 1.0 Kb to 70 Kb, 1.5 Kb to 60 Kb, 2.0 Kb to 50 Kb, 2.5 Kb to 45 Kb, 3.0 Kb to 40 Kb, 3.5 Kb to 35 Kb, 4.0 Kb to 30 Kb, 4.5 Kb to 25 Kb, 4.6 Kb to 24 Kb, 4.7 Kb to 23 Kb, 4.8 Kb to 22 Kb, 4.9 Kb to 21 Kb, 5.0 Kb to 20 Kb, 5.5 Kb to 18 Kb, 6.0 Kb to 17 Kb, 6.5 Kb to 16 Kb, 7.0 Kb to 15 Kb, 7.5 Kb). Kb to 14Kb, 8.0 Kb to 13 Kb, 8.5 Kb to 12.5 Kb, 9.0 Kb to 12.0 Kb, 9.5 Kb to 11.5 Kb, or 10.0 Kb to 11.0 Kb, for example, lengths of 0.1 Kb to 0.5 Kb, 0.5 Kb to 1.0 Kb, 1.0 Kb to 2.5 Kb, 2.5 Kb to 4.5 Kb, 4.5 Kb to 8 Kb, 8 Kb to 10 Kb, 10 Kb to 15 Kb, 15 Kb to 20 Kb, or greater, for example, lengths of 0.1 Kb to 0.25 Kb, 0.25 Kb to 0.5 Kb, 0.5 Kb to 1.0 Kb, 1.0 Kb to 1.5 Kb, 1.5 Kb to 2.0 Kb, 2.0 Kb to 2.5 Kb, 2.5 Kb. Kb to 3.0 Kb, 3.0 Kb to 3.5 Kb, 3.5 Kb to 4.0 Kb, 4.0 Kb to 4.5 Kb, 4.5 Kb to 5.0 Kb, 5.0 Kb to 5.5 Kb, 5.5 Kb to 6.0 Kb, 6.0 Kb to 6.5 Kb, 6.5 Kb to 7.0 Kb, 7.0 Kb to 7.5 Kb, 7.5 Kb to 8.0 Kb, 8.0 Kb to 8.5 Kb, 8.5 Kb to 9.0 Kb, 9.0 Kb to 9.5 Kb, 9.5 Kb to 10 Kb, 10 Kb to 10.5 Kb, 10.5 Kb to 11 Kb, 11 Kb to 11.5 Kb, 11.5 Kb to 12 Kb, 12 Kb to 12.5 Kb, 12.5 Kb to 13 Kb Kb, 13 Kb to 13.5 Kb, 13.5 Kb to 14 Kb, 14 Kb to 14.5 Kb, 14.5 Kb to 15 Kb, 15 Kb to 15.5 Kb, 15.5 Kb to 16 Kb, 16 Kb to 16.5 Kb, 16.5 Kb to 17 Kb, 17 Kb to 17.5 Kb, 17.5 Kb to 18 Kb, 18 Kb to 18.5 Kb, 18.5 Kb to 19 Kb, 19 Kb to 19.5 Kb, 19.5 Kb to 20 Kb, 20 Kb to 21 Kb, 21 Kb to 22 Kb, 22 Kb to 23 Kb, 23 Kb to 24 Kb, 24 Kb to 25 Kb or more, e.g., about 4.5 Kb, about 5.0 Kb, about 5.5 Kb, about 6.0 Kb, about 6.5 Kb, about 7.0 Kb, about 7.5 Kb, about 8.0 Kb, about 8.5 Kb, about 9.0 Kb, about 9.5 Kb, about 10.0 Kb, about 10.5 Kb, about 11.0 Kb, about 11.5 Kb, about 12.0 Kb, about 12.5 Kb, about 13.0 Kb, about 13.5 Kb, about 14.0 Kb, about 14.5 Kb, about 15.0 Kb, about 15.5 Kb, about 16.0 Kb, about 16.5 Kb, about 17.0 Kb, about 17.5 Kb, about 185 Kb, about 10 Kb, about 11 Kb, about 12 Kb, about 13 Kb, about 14 Kb, about 15 Kb, about 16 Kb, about 17 Kb, about 18 Kb, about 19 Kb, about 20 Kb, or more). In some embodiments, the therapeutic sequence is at least 10 Kb (e.g., 10 Kb to 15 Kb, 15 Kb to 20 Kb, or 20 Kb to 30 Kb; e.g., 10 Kb to 13 Kb, 10 Kb to 12 Kb, or 10 Kb to 11 Kb; e.g., 10-11 Kb, 11-12 Kb, 12-13 Kb, 13-14 Kb, or 14-15 Kb). In some embodiments, the therapeutic sequence is at least 1,100 bp in length (e.g., 1,100 bp to 10,000 bp, 1,100 bp to 8,000 bp, or 1,100 bp to 5,000 bp in length). In some embodiments, the therapeutic sequence is at least 2,500 bp in length (e.g., 2,500 bp to 15,000 bp, 2,500 bp to 10,000 bp, or 2,500 bp to 5,000 bp in length; e.g., 2,500 bp to 5,000 bp, 5,000 bp to 7,500 bp, 7,500 bp to 10,000 bp, 10,000 bp to 12,500 bp, or 12,500 bp to 15,000 bp in length). In some embodiments, the therapeutic sequence is at least 8,000 bp, at least 9,000 bp, at least 10,000 bp, at least 11,000 bp, at least 12,000 bp, at least 13,000 bp, at least 14,000 bp, at least 15,000 bp, at least 16,000 bp (e.g., 11,000 bp to 16,000 bp, 12,000 bp to 16,000 bp, 13,000 bp to 16,000 bp, 14,000 bp to 16,000 bp, or 15,000 bp to 16,000 bp). In particular embodiments, the therapeutic sequence is large enough to encode a protein and is not an oligonucleotide therapy (e.g., is not an antisense, siRNA, shRNA therapy, etc.).
[0114] In some embodiments, the nucleic acid vector includes a reporter sequence in addition to the therapeutic protein-encoding domain or the therapeutic non-protein-encoding domain. Such a reporter gene can be used to verify expression of the therapeutic gene sequence, e.g., in particular cells and tissues. Reporter sequences that can be provided in the transgene include, but are not limited to, DNA sequences encoding beta-lactamase, beta-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art. When associated with regulatory elements that drive its expression, the reporter sequence provides a signal that can be detected by conventional methods, including enzymatic, radiographic, colorimetric, fluorescent or other spectroscopic assays, fluorescence activated cell sorting assays, and immunoassays, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA), and immunohistochemistry. For example, where the marker sequence is a LacZ gene, then the presence of the signal-carrying vector is detected by a beta-galactosidase activity assay. Where the transgene is green fluorescent protein or luciferase, the signal-carrying vector can be visualized by color or luminescence in a luminometer. In some embodiments, the therapeutic sequence lacks a reporter sequence.
[0115] In some cases, the nucleic acid vector is a non-viral DNA vector (e.g., the DNA vector is not encapsulated within a viral capsid). Additionally or alternatively, in some embodiments, the nucleic acid vector is not encapsulated in a membrane (e.g., a lipid membrane) or matrix (e.g., a polymeric matrix) and is not physically associated (e.g., covalently or non-covalently bound) to a solid structure (e.g., a particulate structure) prior to and after administration to an individual. In some embodiments, the nucleic acid vector is not tethered to any adjacent nucleic acid vectors, such that in a solution of nucleic acid vectors, each nucleic acid vector freely diffuses independently of adjacent nucleic acid vectors. In some embodiments, the nucleic acid vector is associated with another agent (e.g., a charge-altering molecule or a stabilizing molecule) in a liquid solution.
[0116] The nucleic acid vector can be a naked DNA vector, i.e., not complexed with another agent (e.g., not encapsulated within another agent, not conjugated to or non-covalently bound to another agent). The naked DNA vector can be co-formulated (e.g., in solution) with agents that are not complexed with the naked DNA vector, such as buffering agents and / or agents that are Generally Recognized as Safe (GRAS) by the U.S. Food and Drug Administration.
[0117] Pharmaceutical compositions
[0118] The present disclosure also provides methods involving administering a pharmaceutical composition having a therapeutic agent (e.g., any of the nucleic acid vectors (e.g., circular DNA vectors) described herein) in a pharmaceutically acceptable carrier. In some cases, the pharmaceutical composition contains non-viral nucleic acid vectors (e.g., the pharmaceutical composition is substantially free of viral capsids). Additionally or alternatively, the pharmaceutical composition can contain nucleic acid vectors that are not encapsulated in a membrane (e.g., a lipid membrane) or matrix (e.g., a polymeric matrix) and are not physically associated (e.g., covalently or non-covalently bound) to a solid structure (e.g., a particulate structure) prior to and after administration to an individual. In some embodiments of the pharmaceutical composition, the nucleic acid vectors are not tethered to any adjacent nucleic acid vectors, such that in a solution of the nucleic acid vectors, each nucleic acid vector freely diffuses independent of adjacent nucleic acid vectors. In some embodiments of the pharmaceutical composition, the nucleic acid vectors are associated with another agent (such as a charge-altering molecule or a stabilizing molecule) in a liquid solution.
[0119] The pharmaceutical composition can contain the nucleic acid vectors in naked form, i.e., the nucleic acid vectors are not complexed with another agent (e.g., not encapsulated within another agent, not conjugated or non-covalently bound to another agent). In such pharmaceutical compositions, the naked nucleic acid molecules can be co-formulated (e.g., in solution) with agents that are not complexed with the naked nucleic acid molecules (such as buffering agents and / or agents that are Generally Regarded as Safe [GRAS] by the U.S. Food and Drug Administration).
[0120] In some cases of the present disclosure, the pharmaceutical composition comprises naked circular DNA vectors.
[0121] The pharmaceutically acceptable carrier can include excipients and / or stabilizers that are non-toxic to the individual at the dosages and concentrations employed. In some embodiments, the pharmaceutically acceptable carrier is an aqueous pH-buffered solution. Examples of pharmaceutically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, e.g., serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, polyethylene glycol (PEG), and pluronics.
[0122] A pharmaceutical composition with a therapeutic agent of the present application (e.g., a nucleic acid vector, such as a circular DNA vector) can contain a pharmaceutically acceptable carrier. If the composition is provided in liquid form, the carrier can be water (e.g., pyrogen-free water), isotonic saline, or a buffered aqueous solution, such as a phosphate buffer solution or a citrate buffer solution. Injection of the pharmaceutical composition can be carried out in water or a buffer, such as an aqueous buffer, e.g., containing a sodium salt (e.g., at least 50 mM of a sodium salt), a calcium salt (e.g., at least 0.01 mM of a calcium salt), or a potassium salt (e.g., at least 3 mM of a potassium salt). According to particular embodiments, the sodium, calcium, or potassium salt can be present in the form of a halide thereof, such as a chloride, iodide, or bromide, in the form of a hydroxide, carbonate, bicarbonate, or sulfate thereof, or the like. Examples of sodium salts include, but are not limited to, NaCl, Nal, NaBr, Na2CO2, NaHCO2, and Na2SO4. Examples of potassium salts include, e.g., KC1, KI, KBr, K2CO2, KHCO2, and K2SO4. Examples of calcium salts include, e.g., CaCl2, CaI2, CaBr2, CaCO2, CaSO4, and Ca(OH)2. Additionally, the buffer can contain an organic anion of the above-mentioned cations. According to particular embodiments, the buffer suitable for injection purposes as defined above can contain a salt selected from sodium chloride (NaCl), calcium chloride (CaCl2), or potassium chloride (KC1), wherein additional anions can be present. CaCl2may also be replaced by another salt, such as KC1. In some embodiments, the salt in the injection buffer is present in a concentration of at least 50 mM sodium chloride (NaCl), at least 3 mM potassium chloride (KC1), and at least 0.01 mM calcium chloride (CaCl2). The injection buffer can be hyper-, iso-, or hypo-osmolar relative to a particular reference medium, i.e., the buffer can have a higher, the same, or a lower salt content relative to a particular reference medium, wherein preferably such concentrations of the above-mentioned salts can be used that do not lead to cell damage due to osmotic or other concentration effects. The reference medium can be a liquid, such as blood, lymph, cytosol, other body fluid, or a common buffer. Such common buffers or liquids are known to the skilled person. Lactated Ringer's solution is particularly preferred as the liquid base.
[0123] One or more compatible solid or liquid filler substances, diluents or encapsulating compounds can be suitable for administration to humans. The ingredients of the pharmaceutical composition according to the present application can be mixed with the nucleic acid vector according to the present application as defined herein in a manner that no interaction occurs which would significantly reduce the pharmaceutical effectiveness of the (pharmaceutical) composition according to the present application under typical conditions of use. Pharmaceutically acceptable carriers, fillers and diluents can have sufficiently high purity and sufficiently low toxicity to make them suitable for administration to the individual being treated. Some examples of compounds which can be used as pharmaceutically acceptable carriers, fillers or ingredients thereof are sugars, such as lactose, glucose, trehalose and sucrose; starches, such as corn starch or potato starch; dextrose; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethyl cellulose, cellulose acetate; powdered tragacanth; malt; gelatin; beef fat; solid flow enhancers, such as stearic acid, magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols, such as polypropylene glycol, glycerol, sorbitol, mannitol, polyethylene glycol and the like; or alginic acid.
[0124] The choice of pharmaceutically acceptable carrier can be determined by the mode of administration of the pharmaceutical composition.
[0125] Suitable unit dosage forms for injection include sterile aqueous solutions, physiological saline and mixtures thereof. The pH of such solutions can be adjusted to about 7.4. Suitable injectable carriers include hydrogels, devices for controlled or delayed release, polylactic acid and collagen matrices.
[0126] The pharmaceutical composition according to the present application can be provided in liquid or dry (e.g. lyophilized) form. In particular embodiments, the nucleic acid vector of the pharmaceutical composition is provided in lyophilized form. Lyophilized compositions comprising the nucleic acid vector of the present application can be reconstituted in a suitable buffer (advantageously based on an aqueous carrier, such as lactated Ringer’s solution, Ringer’s solution or phosphate buffered solution) prior to administration.
[0127] In certain embodiments of the present application, any of the nucleic acid vectors of the present application can be complexed with one or more cationic or polycationic compounds (e.g. cationic or polycationic polymers, cationic or polycationic peptides or proteins, such as protamine, cationic or polycationic polysaccharides, and / or cationic or polycationic lipids).
[0128] According to particular embodiments, the nucleic acid vectors of the present application can be complexed with lipids to form one or more liposomes, lipoplexes or lipid nanoparticles. Thus, in one embodiment, the compositions of the present application comprise liposomes, lipoplexes and / or lipid nanoparticles comprising a therapeutic agent (e.g. a nucleic acid vector, such as a circular DNA vector).
[0129] Lipid-based formulations can be effective delivery systems for nucleic acid vectors due to their biocompatibility and ease of large-scale production. Cationic lipids have been extensively studied as synthetic materials for nucleic acid delivery. Upon mixing together, nucleic acids condense with cationic lipids to form lipid / nucleic acid complexes, known as lipoplexes. These lipoplexes are able to protect genetic material from nucleases and deliver it into cells by interacting with the negatively charged cell membrane. Lipoplexes can be prepared by directly mixing positively charged lipids with negatively charged nucleic acids at physiological pH.
[0130] Conventional liposomes include a lipid bilayer, which can be composed of cationic, anionic, or neutral phospholipids and cholesterol, surrounding an aqueous core. The lipid bilayer and aqueous interstitial space can incorporate hydrophobic or hydrophilic compounds, respectively. The in vivo characteristics and behavior of liposomes can be modified by adding a hydrophilic polymeric coating (e.g., polyethylene glycol [PEG]) to the surface of the liposome to impart steric stabilization. In addition, liposomes can be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to the surface of the liposome or to the end of the attached PEG chain.
[0131] Liposomes are colloidal lipid and surfactant-based delivery systems composed of a phospholipid bilayer surrounding an aqueous phase compartment. They can be spherical vesicles, ranging in size from 20 nm to several microns. Cationic lipid-based liposomes are able to complex with negatively charged nucleic acids through electrostatic interactions, forming complexes with the biocompatibility, low toxicity, and large-scale production possibilities required for in vivo clinical applications. Liposomes can fuse with the plasma membrane for uptake; once inside the cell, the liposome is processed through the endocytic pathway, and the genetic material is released from the endosome / carrier into the cytoplasm.
[0132] Cationic liposomes can be used as delivery systems for RNA. Cationic lipids, such as MAP (1,2-dioleoyl-3-trimethylammonium-propane) and DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-methylsulfate ammonium), can form complexes or lipoplexes with negatively charged nucleic acids, forming nanoparticles through electrostatic interactions, providing high in vitro transfection efficiency. In addition, neutral lipid-based nanoliposomes (e.g., nanoliposomes based on neutral 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC)) are available for nucleic acid vector delivery.
[0133] Accordingly, in one embodiment of the present application, the nucleic acid vector of the present application is complexed with a cationic lipid and / or a neutral lipid, thereby forming a liposome, a lipid nanoparticle, a lipoplex, or a neutral lipid-based nanoliposome.
[0134] In particular embodiments, the pharmaceutical compositions according to the present application comprise the nucleic acid vectors of the present application formulated with a cationic or polycationic compound and / or with a polymeric carrier. Thus, in another embodiment of the present application, the nucleic acid vectors as defined herein are associated or complexed with a cationic or polycationic compound or a polymeric carrier, optionally at a weight ratio of nucleic acid vector to cationic or polycationic compound and / or polymeric carrier selected from the range of about 5: 1 (w / w) to about 0.25: 1 (w / w), for example about 5: 1 (w / w) to about 0.5: 1 (w / w), for example about 4: 1 (w / w) to about 1 : 1 (w / w) or about 3: 1 (w / w) to about 1 : 1 (w / w), for example about 3: 1 (w / w) to about 2: 1 (w / w); or optionally at a nitrogen / phosphate (N / P) ratio of nucleic acid vector to cationic or polycationic compound and / or polymeric carrier in the range of about 0.1-10, for example in the range of about 0.3-4 or 0.3-1, for example, in the range of about 0.5-1 or 0.7-1, for example in the range of about 0.3-0.9 or 0.5-0.9. For example, the N / P ratio of the nucleic acid vector to the polycation(s) is in the range of about 0.1 to 10, including the range of about 0.3 to 4, about 0.5 to 2, about 0.7 to 2, and about 0.7 to 1.5.
[0135] The nucleic acid vectors described herein can also be associated with a vehicle, transfection agent or complexing agent to increase the transfection efficiency and / or expression of the modulating gene according to the present application.
[0136] In some cases, the pharmaceutical composition contains the nucleic acid vector complexed with one or more polycations (e.g., protamine or oligofectamine). Additional cationic or polycationic compounds that can be used as transfection or complexing agents can include: cationic polysaccharides, such as chitosan, polybrene; cationic polymers such as polyethylenimine (PEI); cationic lipids such as DOTMA: [1 -(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DOPE, LEAP, DOPE: dioleoylphosphatidyl ethanolamine, DOSPA, DODAB, DOIC, DMEPC, DOGS: dioctadecylamidoglycylspermin, DIMRI: dimyristyl-oxypropyl dimethylhydroxyethyl ammonium bromide, MAP: dioleoyloxy-3-(trimethylammonium)propane, DC-6-14: 0,0-ditetradecanoyl-N-(a-trimethylammonium acetyl)diethanolamine chloride, CLIP1 : rac-[(2,3-dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: rac-[2(2,3-dihexadecyloxypropyl-oxy-methyloxy)ethyl]trimethylammonium, CLIP9: rac-[2(2,3-dihexadecyloxypropyl-oxy-succinoyloxy)ethyl]-trimethylammonium, oligofectamine; or cationic or polycationic polymers such as modified polyamino acids such as beta-amino acid-polymers or reverse polyamides, etc., modified polyethylenes such as PVP (poly(N-ethyl-4-vinylpyridinium bromide)), etc., modified acrylates such as pDMAEMA (poly(methylacrylic acid dimethylaminoethyl ester)), etc., modified polyamidoamines such as pAMAM (poly(amidoamine)), etc., modified polybeta amino esters (PBAEs) such as 1,4-butanediol diacrylate-co-5-amino-1 -pentanol polymers modified at the diamine termini, etc., dendrimers such as polypropylamine dendrimers or pAMAM-based dendrimers, etc., polyimines (such as PEI: poly(ethylenimine), poly(propylenimine), etc., polyallyl amines), polymers based on sugar backbones (such as polymers based on cyclodextrin, polymers based on dextran, chitosan, etc.), polymers based on silane backbones (such as PMOXA-PDMS copolymers, etc.), block polymers consisting of a combination of one or more cationic blocks (e.g., selected from cationic polymers as described above) and one or more hydrophilic or hydrophobic blocks (e.g., polyethylene glycol); etc.
[0137] According to particular embodiments, the pharmaceutical composition of the present application comprises a therapeutic agent, such as a nucleic acid vector (e.g. a circular DNA vector) encapsulated within or attached to a polymeric carrier. The polymeric carrier used according to the present application can be a polymeric carrier formed from disulfide cross-linked cationic components. The disulfide cross-linked cationic components can be identical or different from each other. The polymeric carrier can also contain additional components. It is also particularly preferred that the polymeric carrier used according to the present application comprises a mixture of a cationic peptide, protein or polymer as defined herein and optionally additional components cross-linked by disulfide bonds as described herein. In this context, the disclosure of WO 2012 / 013326 is incorporated herein by reference. In this context, the cationic components forming the basis of the polymeric carrier by disulfide cross-linking are typically selected from any suitable cationic or polycationic peptide, protein or polymer suitable for this purpose, in particular any cationic or polycationic peptide, protein or polymer capable of complexing the nucleic acid vector or additional nucleic acid contained in the composition according to the present application, thereby preferably condensing the nucleic acid vector. The cationic or polycationic peptide, protein or polymer can be a linear molecule; however, branched cationic or polycationic peptides, proteins or polymers can also be used.
[0138] Each disulfide cross-linked cationic or polycationic protein, peptide or polymer of the polymeric carrier that can be used for complexing the nucleic acid vector according to the present application as part of the pharmaceutical composition of the present application can contain at least one SH moiety (e.g. at least one cysteine residue or any additional chemical group having an SH moiety) capable of forming a disulfide linkage upon condensation with at least one additional cationic or polycationic protein, peptide or polymer as cationic component of the polymeric carrier as described herein.
[0139] Such polymeric carrier for complexing the nucleic acid vector of the present application can be formed from disulfide cross-linked cationic (or polycationic) components. In particular, such cationic or polycationic peptide or protein or polymer of the polymeric carrier comprising or additionally modified to comprise at least one SH moiety can be selected from proteins, peptides and polymers as complexing agents.
[0140] In other embodiments, the pharmaceutical composition according to the present application can be administered naked, without being associated with any additional vehicle, transfection agent or complexing agent.
[0141] IV. Kits and Articles of Manufacture
[0142] In another aspect of the application, articles of manufacture or kits containing materials useful for the above treatments are provided. The articles of manufacture comprise a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc. The containers can be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for treating, preventing and / or diagnosing the condition and can have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is a therapeutic of the application (e.g., a nucleic acid vector (e.g., a non-viral DNA vector, e.g., a circular DNA vector lacking a bacterial origin of replication, a drug resistance gene, and / or a recombination site)) or a pharmaceutical composition comprising a therapeutic of the application. The label or package insert indicates that the composition is used for treating the condition of choice (e.g., Fuchs' Dystrophy). The article of manufacture can further comprise a package insert indicating that the composition can be used to treat the particular condition (e.g., Fuchs' Dystrophy). Alternatively or additionally, the article of manufacture can further comprise a second container comprising a pharmaceutically-acceptable carrier, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution, dextrose solution, or any of the pharmaceutically-acceptable carriers disclosed herein. It can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
[0143] In particular examples of the application, a kit is provided comprising (i) any one or more of the above-described materials (e.g., any of the foregoing therapeutics of the application and / or one or more pharmaceutically-acceptable carriers) and (ii) one or more elements of an energy delivery device (e.g., a device comprising an electrode for transmitting an electric field to tissue (e.g., the retina), such as any of the suitable devices or systems described above). In some embodiments, a kit is provided herein comprising a therapeutic of the application (e.g., a nucleic acid vector (e.g., a non-viral DNA vector, e.g., a circular DNA vector)) and an electrode. In some embodiments, a kit is provided herein comprising a pharmaceutical composition comprising a therapeutic of the application (e.g., a nucleic acid vector (e.g., a non-viral DNA vector, e.g., a circular DNA vector)) and an electrode.
[0144] Examples
[0145] Example 1: GFP expression in corneal endothelium by C 3 DNA by electroporation
[0146] A Dutch Black rabbit was anesthetized and its eye prepared aseptically. Approximately 100 microliters of C3 DNA containing the reporter gene GFP was injected into the anterior chamber of the rabbit eye. At C 3Immediately after DNA injection, electroporation was performed. The COMET electrode was placed in the anterior chamber close to the posterior surface of the cornea. Figure 1A The relative position of the injection needle and the electrode is shown.
[0147] Eight pulses of -20 V with a duration of 20 ms were applied. On day 7 after surgery, GFP expression in the cornea was observed in vivo using a RetCam with gonioscopic and fluorescent filters. Surprisingly, extensive GFP expression was observed on most of the corneal surface ( Figure 1B ). The rabbits were then sacrificed, their eyeballs were enucleated and processed for histological analysis. The localization of GFP within the corneal stroma was confirmed by immunofluorescence microscopy using an anti-GFP antibody ( Figure 1C ).
[0148] Example 2: GFP expression in the corneal stroma by COMET 3 DNA electroporation
[0149] Dutch Black rabbits were anesthetized and their eyes were prepared aseptically. About 50 microliters of C 3 DNA was injected into the corneal stroma of the rabbit eye. Whitening of the cornea proved delivery of the liquid into the corneal stroma. In C 3 Immediately after DNA injection, electroporation was performed. The COMET electrode was placed in the anterior chamber close to the posterior surface of the cornea. Figure 2A The relative position of the injection needle and the electrode is shown.
[0150] Eight pulses of -20 V with a duration of 20 ms were applied. On day 7 after surgery, GFP expression in the cornea was observed in vivo using a RetCam with gonioscopic and fluorescent filters. Surprisingly, extensive GFP expression was observed on most of the corneal surface ( Figure 2B ). The rabbits were then sacrificed, their eyeballs were enucleated and processed for histological analysis. The localization of GFP within the corneal stroma was confirmed by immunofluorescence microscopy using an anti-GFP antibody ( Figure 2C ).
[0151] Sequences
[0152]
[0153] Other embodiments
[0154] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each independent publication, or patent application, was specifically and individually indicated to be incorporated by reference.
[0155] While this application has been described in connection with particular embodiments thereof, it will be understood that it is capable of further modifications. This application is intended to cover any variations, uses or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice in the art to which the application pertains and fall within the scope of the appended claims.
[0156] Other embodiments are within the scope of the following claims.
Claims
1. A method for expressing a transgene in ocular cells of the anterior segment of the eye in an individual, the method comprising: (a) Applying a circular DNA vector to the anterior segment of the eye, wherein the circular DNA vector lacks one or more components of the plasmid backbone and encodes the transgene; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the circular DNA vector to the anterior segment of the eye cells, electrical energy is transmitted through the one or more electrodes to express the transgene in the anterior segment of the eye cells.
2. The method of claim 1, wherein the circular DNA vector is expressed in the anterior segment of the eye cells eight days after administration.
3. The method of claim 1 or 2, wherein the transgene expressed by the circular DNA vector in the anterior segment of the eye cell is more persistent than the transgene encoded by the plasmid DNA vector encoding the transgene.
4. The method of any one of claims 1-3, wherein the immunogenicity of the circular DNA vector in the anterior segment of the eye cell is lower than that of the plasmid DNA vector encoding the transgene.
5. The method of any one of claims 1-4, wherein one or more components of the plasmid backbone missing in the circular DNA vector comprise a drug resistance gene and / or an origin of replication.
6. The method according to any one of claims 1-5, wherein the circular DNA vector is a non-viral circular DNA vector.
7. The method of claim 6, wherein the non-viral circular DNA vector is a naked circular DNA vector.
8. The method of claim 6 or 7, wherein the DNA vector is a synthetic circular DNA vector.
9. The method of any one of claims 1-7, wherein the DNA vector comprises a replication origin.
10. The method of any one of claims 1-9, wherein the DNA vector lacks a selective marker.
11. The method of claim 9, wherein the replication origin is a ColE2-P9 replication origin or a functional variant thereof.
12. The method of any one of claims 1-11, wherein step (a) comprises administering the circular DNA vector into the anterior chamber or administering the circular DNA vector into the corneal stroma.
13. The method of any one of claims 1-12, wherein step (b) comprises placing the one or more electrodes in the anterior chamber, and step (c) comprises transmitting electrical energy through the one or more electrodes placed in the anterior chamber.
14. The method of claim 12 or 13, wherein the one or more electrodes are located within 5 mm of the corneal endothelium in the anterior chamber.
15. The method of any one of claims 1-14, wherein at least one of the one or more electrodes is a needle electrode.
16. The method of any one of claims 1-5, wherein the eye cells expressing the anterior segment of the circular DNA vector are corneal cells, trabecular meshwork cells, iris cells, lens cells, ciliary body cells, and / or Schlem tube cells.
17. The method of claim 16, wherein the corneal cells are corneal endothelial cells or corneal stromal cells.
18. The method of any one of claims 1-17, wherein the transgene encodes a protective factor that promotes the survival of corneal endothelial cells.
19. The method of claim 18, wherein the protection factor regulates the Nrf2 signal transduction path, the ROCK signal transduction path, the TGF-B signal transduction path, or the FGF-1 signal transduction path.
20. The method of any one of claims 1-19, wherein the circular DNA vector silences, corrects, or replaces the mutated gene associated with Fuchs malnutrition.
21. The method of claim 19, wherein the gene associated with Fuchs malnutrition is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.
22. A method for expressing a therapeutic protein in anterior segment eye cells of an individual, the method comprising: (a) Applying a nucleic acid vector to the anterior segment of the eye, wherein the nucleic acid vector encodes the therapeutic protein; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the nucleic acid carrier to the anterior segment of the eye cells, electrical energy is transmitted through the one or more electrodes to express the therapeutic protein in the anterior segment of the eye cells.
23. The method of claim 22, wherein the therapeutic protein is a protective factor that promotes the survival of corneal endothelial cells.
24. The method of claim 23, wherein the protection factor regulates the Nrf2 signal transduction path, the ROCK signal transduction path, the TGF-B signal transduction path, or the FGF-1 signal transduction path.
25. The method of any one of claims 22-24, wherein the nucleic acid vector silences, corrects, or replaces the mutated gene associated with Fuchs malnutrition.
26. The method of claim 25, wherein the gene associated with Fuchs malnutrition is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.
27. The method of claim 25 or 26, wherein the individual suffers from Fuchs malnutrition.
28. A method for treating Fuchs malnutrition in individuals in need, the method comprising: (a) Applying a nucleic acid vector to the anterior segment of the eye in the individual, wherein the nucleic acid vector encodes a protective factor that promotes the survival of corneal endothelial cells; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the nucleic acid carrier to the anterior segment of the eye cells, electrical energy is transmitted through the one or more electrodes to express the protective factor in the anterior segment of the eye cells in an amount sufficient to treat Fuchs dystrophy.
29. A method for treating Fuchs malnutrition in individuals in need, the method comprising: (a) Applying a nucleic acid vector to the anterior segment of the eye in the individual, wherein the nucleic acid vector silences, corrects, or replaces a mutant gene associated with Fuchs dystrophism; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the nucleic acid carrier to the anterior segment of the eye cells, electrical energy is transmitted through the one or more electrodes to silence, correct, or replace the mutated gene in an amount sufficient to treat Fuchs dystrophy.
30. The method of claim 28 or 29, wherein the nucleic acid vector lacks one or more components of the plasmid backbone.
31. The method of any one of claims 28-30, wherein the nucleic acid vector comprises a replication origin.
32. The method of any one of claims 28-31, wherein the DNA vector lacks a selective marker.
33. The method of claim 31, wherein the replication origin is a ColE2-P9 replication origin or a functional variant thereof.
34. A circular DNA vector comprising: (a) Eukaryotic promoters; (b) an encoded sequence, wherein the encoded sequence: (i) Encoding protective factors that promote corneal endothelial cell survival; or (ii) Silencing, correcting, or replacing mutated genes associated with Fuchs malnutrition; and (c) Bacterial replication origins less than 50 bp in length, wherein the circular DNA vector lacks a selectability marker.
35. The circular DNA vector of claim 34, wherein the protective factor regulates the Nrf2 signaling pathway, the ROCK signaling pathway, the TGF-B signaling pathway, or the FGF-1 signaling pathway.
36. The circular DNA vector of claim 34, wherein the gene associated with Fuchs malnutrition is SLC4A11, TCF8, TCF, LOXHD1, AGBL1, DMPK, ZEB1, or COL8A2.
37. The circular DNA vector of any one of claims 34-36, wherein the 3' end of the coding sequence is connected to the 5' end of the promoter via a sequence containing the bacterial origin of replication, wherein the length of the sequence containing the bacterial origin of replication is less than 100 bp.
38. A pharmaceutical composition comprising: (a) The circular DNA vector as described in any one of claims 34-37, and (b) A suitable carrier for use in delivering the pharmaceutical composition to an individual.
39. A method of delivering a circular DNA vector as described in any one of claims 34-38 to anterior segment eye cells of an individual, the method comprising: (a) Applying the circular DNA vector to the anterior segment of the eye; (b) Placing one or more electrodes inside and / or around the eye; as well as (c) Under conditions suitable for electrotransferring the circular DNA vector to the anterior segment of the eye cells, electrical energy is transferred through the one or more electrodes to deliver the circular DNA vector to the anterior segment of the eye cells.
Citation Information
Patent Citations
Production of closed linear DNA
US20150329902A1
Modified closed-ended DNA (CEDNA)
US20200283794A1
Closed-ended DNA vectors obtainable from cell-free synthesis and process for obtaining cedna vectors
US20210071197A1
Circular nucleic acid vectors, and methods for making and using the same
US8828726B2
Minicircle DNA vector preparations and methods of making and using the same
US9233174B2