Liposome compositions of Archexin

Abstract

Described herein are lipid nanoparticle (LNP) formulations for the delivery of active agents, including Archexin.

Description

Cross Reference to Related Applications

[0001] This application claims priority to and the benefit of U.S. Provisional Application No. 63 / 493,576, filed March 31, 2023, the contents of which are incorporated in their entirety. Reference to a Sequence Listing

[0002] The sequence listing submitted March 21, 2024, as a text file named “11650-003PV1_2023_03_30_Sequence_Listing” created on March 30, 2023, having a size of 2,566 bytes, is incorporated by reference herein under 37 C.F.R. § 1.52(e)(5). BACKGROUND

[0003] AKT-1 (Archexin) is a protein product of the akt-1 proto-oncogene that plays a role in cancer progression by promoting cell proliferation and inhibiting apoptosis of cancer cells (see Revathidevi S, et al., Semin Cancer Biol. 2019; 59: 80-91; and Uko NE, et al., Curr Top Med Chem. 2020; 20(10): 883-900). Archexin is a fully thioated 20-mer antisense oligonucleotide that can specifically bind AKT-1 mRNA, leading to RNAse H-based downregulation of AKT-1. Archexin inhibits AKT-1 mRNA translation and suppresses tumor growth. However, Archexin is limited by the inherent challenges of antisense oligonucleotides due to its poor membrane permeability and in vivo stability, as well as the further requirement for a 14-day continuous infusion dosing regimen.

[0004] There is a need for enhanced intracellular delivery and circulation time of oligonucleotides, such as Archexin.

[0005] The compositions and methods disclosed herein address these and other needs. SUMMARY

[0006] Pharmaceutical compositions comprising lipid nanoparticles encapsulating an active agent are described herein. The lipid nanoparticles can include 2.5 mol% to 15 mol% of one or more cationic lipids; 30 mol% to 50 mol% of one or more ionizable lipids; 30 mol% to 65 mol% of one or more neutral lipids; and 2.5 mol% to 15 mol% of one or more PEGylated lipids. In some embodiments, the active agent can include RX-0201, 5’gctgcatuatctccttggcg3’, SEQ. ID. NO. 1.

[0007] Also described herein are methods for treating cancer, preventing cancer, preventing metastasis of cancer, preventing recurrence of cancer, or preventing angiogenesis. These methods can include administering to a subject in need thereof a pharmaceutical composition described herein.

[0008] Also described herein are methods of inducing cytotoxicity in a cancer cell. These methods can include contacting the cell with a pharmaceutical composition described herein.

[0009] Also described herein are methods of producing a population of lipid nanoparticles encapsulating an active agent. The method can include (a) mixing one or more ethanol solutions comprising a lipid mixture with an aqueous solution and acidifying to induce formation of a population of empty lipid nanoparticles; (b) contacting the population of empty lipid nanoparticles with an aqueous solution comprising an active agent, thereby encapsulating the active agent in the population of empty lipid nanoparticles, to produce the population of lipid nanoparticles encapsulating the active agent; and (c) subjecting the population of lipid nanoparticles encapsulating the active agent to tangential flow filtration to replace the buffer and remove residual ethanol. In some embodiments, the lipid mixture comprises 2.5 mol% to 15 mol% of one or more cationic lipids; 30 mol% to 50 mol% of one or more ionizable lipids; 30 mol% to 65 mol% of one or more neutral lipids; and 2.5 mol% to 15 mol% of one or more PEGylated lipids. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figures 1A-1B Graphs showing the effect of WGI-0301 on tumor growth ( Figure 1A ) and survival ( Figure 1B ) in a Hepa1-6 syngeneic hepatocellular carcinoma model.

[0011] Figures 2A-2B Graphs of the number of branch points versus concentration ( Figure 2A ) and capillary length versus concentration ( Figure 2B ).

[0012] Figures 3A-3C Graphs showing the anti-angiogenic effect of WGI-0301 alone and in combination therapy (0.1% DMSO and WGI-0301 ( Figure 3A ), 2 μΜ Sorafenib and WGI-0301 ( Figure 3B ), 5 μΜ Lenvatinib and WGI 0301 ( Figure 3C )).

[0013] Figure 4 Flowchart showing the manufacturing process of the lipid nanoparticles described herein.

[0014] Figure 5 The effect of the test substance on the body weight of mice in the Hepa 1-6 model was shown.

[0015] Figure 6 The effect of the test substance on the change in body weight in mice in the Hepa 1-6 model was shown.

[0016] Figure 7 The effect of the test sample on tumor volume in the Hepa 1-6 model was shown.

[0017] Figure 8 The survival curves of the test samples in the Hepa 1-6 model are shown.

[0018] Figure 9 A diagram showing the command voltage procedure for hERG testing using a manual patch clamp is displayed.

[0019] Figure 10 The Archex free acid concentration response curve is shown.

[0020] Figure 11 The changes in body weight in female Balb / c nude mice carrying Hep3B-luc tumor cells are shown. Data points represent the group mean body weight. Error bars represent the standard error (SEM) of the mean.

[0021] Figure 12 This shows the percentage change in body weight (BW) in female Balb / c nude mice carrying Hep3B-luc tumor cells after administration of the test substance. BW change was calculated based on animal body weight on PG-D0. Data points represent the group mean percentage change in BW. Error bars represent the standard error (SEM) of the mean.

[0022] Figure 13 The changes in body weight of female Balb / c nude mice carrying the Hep3B-luc model are shown.

[0023] Figure 14 The bioluminescent trajectories of female Balb / c nude mice carrying the Hep3B-luc model are shown.

[0024] Figure 15 Survival curves of WGI-0301 and lenvatinib monotherapy or combination therapy in female Balb / c nude mice in an in situ model of human hepatocellular carcinoma Hep3B-luc are shown.

[0025] Figure 16 Survival curves of human hepatocellular carcinoma Hep3B-luc in situ model in female Balb / c nude mice were shown using WGI-0301 and sorafenib monotherapy or in combination therapy.

[0026] Figure 17Survival curves of WGI-0301 and cabozantinib monotherapy or combination therapy in female Balb / c nude mice in an in situ model of human hepatocellular carcinoma Hep3B-luc are shown.

[0027] Figure 18 A table showing images with bioluminescence results. Detailed description

[0028] Before disclosing and describing these methods and systems, it should be understood that these methods and systems are not limited to specific synthesis methods, specific components, or specific compositions. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0029] As used in this specification and the appended claims, the terms “comprising” (and its various forms, derivatives, or variations) and “including” (and its various forms, derivatives, or variations) are inclusive (i.e., open-ended) and do not exclude other elements or steps. For example, when used in this specification, the terms “comprising” and / or “including” specify the presence of the stated feature, integer, step, operation, element, and / or component, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. Unless otherwise stated, all figures used in the specification and claims to indicate amounts of ingredients, reaction conditions, geometries, dimensions, etc., should be understood, at least as not an attempt to limit the application of the equivalence principle to the scope of the claims, and should be interpreted according to the number of significant figures and ordinary rounding methods.

[0030] Therefore, these terms are intended to cover not only the listed elements or steps, but also other elements or steps not explicitly listed. Furthermore, as used herein, the terms “an,” “a,” and “the” used with an element can mean “an,” but also “one or more,” “at least one,” and “one or more.” Thus, without further limitation, an element beginning with “an” or “a” does not exclude the existence of other identical elements.

[0031] A range may be expressed herein as from “about” a particular value and / or to “about” another particular value. “About” means within 5% of the value, such as within 4%, 3%, 2%, or 1% of the value. When such a range is expressed, the other aspect includes from one particular value and / or to another particular value. Similarly, when a value is expressed as an approximation, it can be understood that the particular value forms another aspect by using the antecedent “about”. It will be further understood that each endpoint of a range is significant relative to and independent of the other endpoint. It should also be understood that many values ​​are disclosed herein, and each value is also disclosed herein as “about” that particular value, in addition to being the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. A range may be interpreted as including both the beginning and the end of the range. For example, a range of 10% to 20% (i.e., the 10%-20% range) may include 10%, may include 20%, and includes percentages between 10% and 20%, unless otherwise expressly stated herein.

[0032] As used herein, the terms “may,” “optionally,” and “may optionally” are used interchangeably and mean both the condition occurring and the condition not occurring. Thus, for example, the statement that a formulation “may contain excipients” means both the condition containing excipients and the condition not containing excipients.

[0033] It should be understood that when combinations, subsets, groups, etc. of elements are disclosed (e.g., combinations of components in a composition, or combinations of steps in a method), each of these elements is specifically considered and described herein, although specific references to each of the various individual and collective combinations and arrangements of these elements may not be explicitly disclosed.

[0034] "Administration" to a subject includes any route of introducing or delivering the reagent to the subject. Administration can be performed via any suitable route, including oral, local, percutaneous, transdermal, intra-articular, intra-arterial, intradermal, intravenous, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injection or infusion techniques), etc. As used herein, "parallel administration," "combined administration," "simultaneous administration," or "simultaneous administration" means that multiple compounds are administered at the same time point or substantially immediately after each other. In the latter case, the administration times of the two compounds are close enough that the observed results are indistinguishable from those obtained when the compounds are administered at the same time point. "Systemic administration" means introducing or delivering the reagent to a subject by means of introducing or delivering the reagent to a wide area of ​​the subject's body (e.g., more than 50% of the body), such as by entering the circulatory or lymphatic system. In contrast, "topical application" refers to the introduction or delivery of a reagent to a subject by means of introducing or delivering the reagent to the application site or an area immediately adjacent to the application site, without systemic introduction of the reagent in a therapeutically significant amount. For example, a locally applied reagent is readily detectable in the vicinity of the application site, but undetectable or detectable in negligible amounts in distal parts of the subject's body. Application includes self-application and application by another person.

[0035] As used herein, the terms “controlled release” or “controlled-release drug delivery” or “sustained release” refer to the controlled release or administration of a drug from a given dosage form to achieve the desired pharmacokinetic characteristics in vivo. One aspect of “controlled” drug delivery is the ability to manipulate the formulation and / or dosage form to establish the desired drug release kinetics.

[0036] As used herein, the terms “beneficial reagent” and “active agent” are used interchangeably to refer to compounds or compositions having beneficial biological effects. Beneficial biological effects include therapeutic effects, i.e., treating a disease or other adverse physiological condition, and preventive effects, i.e., preventing a disease or other adverse physiological condition. The term also covers pharmaceutically acceptable pharmacologically active derivatives of the beneficial reagents specifically mentioned herein, including but not limited to salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, etc. When the terms “beneficial reagent” or “active agent” are used, or when a specific pharmaceutical agent is specifically identified, it should be understood that the term includes the reagent itself as well as pharmaceutically acceptable pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0037] "Therapeutic agent" means any composition having a beneficial biological effect. Beneficial biological effects include therapeutic effects, such as treating a disease or other adverse physiological condition, and preventive effects, such as preventing a disease or other adverse physiological condition. The term also covers pharmaceutically acceptable pharmacologically active derivatives of the beneficial agents specifically mentioned herein, including but not limited to salts, esters, amides, precursors, active metabolites, isomers, fragments, analogs, etc. When the term "therapeutic agent" is used, or when a specific pharmaceutical agent is specifically identified, it should be understood that the term includes the agent itself as well as pharmaceutically acceptable pharmacologically active salts, esters, amides, precursors, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0038] "Reduction" can refer to any change that results in a smaller amount of symptoms, disease, composition, condition, or activity. If the genetic output of a gene product is less in the presence of a substance compared to the absence of that substance, then that substance is also understood to reduce the genetic output of that gene. Furthermore, for example, reduction can be a change in the symptoms of a disease, resulting in fewer symptoms than previously observed. A reduction can be a statistically significant decrease in any single, median, or mean amount of a condition, symptom, activity, or composition. Therefore, as long as the reduction is statistically significant, it can be a reduction of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%.

[0039] "Inhibition" refers to a reduction in activity, response, condition, disease, or other biological parameters. This can include, but is not limited to, the complete elimination of activity, response, condition, or disease. It can also include, for example, a 10% reduction in activity, response, condition, or disease compared to native or control levels. Therefore, the reduction compared to native or control levels can be a reduction of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount between these values.

[0040] "Inactivation" refers to the reduction or elimination of activity, response, condition, disease, or other biological parameters due to the chemical (covalent bond formation) interaction between the ligand and its biological target.

[0041] "Reduction," or other forms of the term, refers to a decrease in an event or characteristic (e.g., tumor growth). It should be understood that this is often related to certain standards or expected values; in other words, it is relative, but not always requires a reference standard or relative value. For example, "reduced tumor growth" means a reduction in the rate of tumor growth relative to a standard or control.

[0042] As used herein, the term "treatment" or "management" for a subject includes administering a medicine to a subject for the purpose of preventing, curing, healing, reducing, alleviating, altering, remedying, improving, stabilizing, or influencing a disease or condition or its symptoms. The terms "treatment" and "management" may also refer to reducing the severity and / or frequency of symptoms, eliminating symptoms and / or their underlying causes, preventing the occurrence of symptoms and / or their underlying causes, and improving or remedying damage.

[0043] "Prevention," or other forms of the term, refers to stopping a particular event or trait, stabilizing or delaying the development or progression of a particular event or trait, or minimizing the chance of its occurrence. Prevention does not require comparison with a control, as it is generally more absolute than, for example, "reduction." As used herein, some things can be reduced but not prevented, but some things that can be reduced can also be prevented. Similarly, some things can be prevented but not reduced, but some things that can be prevented can also be reduced. It should be understood that when "reduction" or "prevention" is used, the use of the other term is also explicitly disclosed unless otherwise explicitly stated. For example, the terms "prevention" or "inhibition" can refer to a treatment that preemptively stops or slows the onset of a disease or condition or reduces the severity of a disease or condition. Thus, if a treatment can treat a disease in a subject with symptoms of the disease, then it can also prevent or inhibit the disease in a subject who does not yet have some or all of the symptoms. As used herein, the term "prevention" of a symptom or undesirable physiological event in a subject specifically refers to the prevention of the occurrence of symptoms and / or their underlying causes, where the subject may or may not exhibit a high susceptibility to the symptom or event.

[0044] The term "effective amount" refers to a therapeutic agent that is non-toxic but sufficient to provide the desired effect. The amount of an "effective" beneficial agent will vary from subject to subject, depending on the subject's age and general condition, the specific beneficial agent, etc. Therefore, an exact "effective amount" cannot always be specified. However, the appropriate "effective" amount in any subject's situation can be determined by a person skilled in the art using routine experiments. Furthermore, as used herein, unless otherwise expressly stated, a beneficial "effective amount" may also refer to an amount that encompasses both therapeutic and preventative effective amounts.

[0045] The "effective dose" of medication necessary to achieve a therapeutic effect may vary depending on factors such as age, sex, and weight of the subject. Dosing regimens can be adjusted to provide the best therapeutic response. For example, several separate doses may be administered daily, or the dose may be reduced proportionally depending on the urgency of the treatment situation.

[0046] As used herein, a “therapeutic effective amount” of a therapeutic agent refers to the amount that effectively achieves the desired therapeutic outcome, while a “preventive effective amount” of a therapeutic agent refers to the amount that effectively prevents an undesirable physiological condition. The therapeutic and preventive effective amounts of a given therapeutic agent typically vary depending on factors such as the type and severity of the condition or disease being treated, and the subject’s age, sex, and weight. The term “therapeutic effective amount” can also refer to the amount of therapeutic agent that effectively promotes the desired therapeutic effect or the rate of delivery of the therapeutic agent (e.g., an amount that varies over time). The exact expected therapeutic effect will vary depending on the condition being treated, the subject’s tolerance, the drug and / or drug formulation to be administered (e.g., the potency of the therapeutic agent (drug), the concentration of the drug in the formulation, etc.), and a variety of other factors as understood by one of ordinary skill in the art.

[0047] As used herein, the term "pharmaceuticalally acceptable" component can refer to a component that is not biologically or otherwise undesirable, i.e., that the component can be incorporated into a pharmaceutical formulation of the present invention and administered to a subject as described herein without causing any significant undesirable biological effects or interacting in a harmful manner with any other component in the formulation containing it. When the term "pharmaceuticalally acceptable" is used to refer to an excipient, it generally implies that the ingredient has met the requirements of toxicological and manufacturing testing standards, or that it is included in the inactive ingredient guidelines established by the U.S. Food and Drug Administration.

[0048] In addition, as used herein, the term “pharmacological activity” (or simply “activity”) may, in the case of derivatives or analogs of “pharmacological activity”, refer to derivatives or analogs that have the same type of pharmacological activity as the parent compound and are substantially equivalent in degree (e.g., salts, esters, amides, conjugates, metabolites, isomers, fragments, etc.).

[0049] A "control" is a surrogate subject or sample used for comparison purposes in an experiment. Controls can be "positive" or "negative".

[0050] As used herein, "subject" refers to an individual. Therefore, "subject" can include domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mice, rabbits, rats, guinea pigs, goats, sheep, pigs, dogs, cats, etc.), and birds (e.g., chickens, turkeys, songbirds, etc.). "Subject" can also include mammals, such as primates or humans. Therefore, a subject can be a human or a veterinary patient. The term "patient" refers to a subject receiving treatment from a clinician (e.g., a physician). Administration of the therapeutic agent can be performed at a dose and for a period of time that is effective in treating the subject. In some embodiments, the subject is a human.

[0051] As used herein, the term “nucleic acid” refers to a polymer composed of nucleotides, such as deoxyribonucleotides or ribonucleotides.

[0052] As used in this article, the terms “ribonucleic acid” and “RNA” refer to polymers composed of ribonucleotides.

[0053] As used in this article, the terms “deoxyribonucleic acid” and “DNA” refer to polymers composed of deoxyribonucleotides.

[0054] The term "oligonucleotide" refers to a single-stranded or double-stranded nucleotide polymer of about 2 to at most about 100 nucleotides in length. Suitable oligonucleotides can be prepared by the phosphoramidite method described in Beaucage and Carruthers, Tetrahedron Lett., 22:1859-1862 (1981) or by the triester method according to Matteucci, et al., J. Am. Chem. Soc., 103:3185 (1981), both of which are incorporated herein by reference, or by using a commercially available automated oligonucleotide synthesizer or VLSIPS. TM Other chemical methods of preparation of oligonucleotides. When an oligonucleotide is referred to as “double-stranded,” those skilled in the art will understand that a pair of oligonucleotides exists as a helical array of hydrogen bonds, typically associated with, for example, DNA. In addition to the 100% complementary form of double-stranded oligonucleotides, the term “double-stranded” as used herein also refers to those forms involving structural features such as protrusions and loops, which are more fully described in such biochemical texts such as Strayer, Biochemistry, Third Ed., (1988), which is incorporated herein by reference for all purposes.

[0055] In the context of two or more nucleic acid or polypeptide sequences, the term "identical" or "identity" percentage refers to a specific percentage of two or more sequences or subsequences that are identical or have the same amino acid residues or nucleotides when compared and aligned to the maximum correspondence within a comparison window or specified region (i.e., approximately 60% identity within a specific region, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%). 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher of identity is measured using the BLAST or BLAST2.0 sequence comparison algorithm with the default parameters described below or by manual alignment and visual inspection (see, for example, NCBI web loci, etc.). Such sequences are then referred to as “substantially identical.” This definition also relates to or can be applied to complement in the test sequence. The definition also includes sequences with deletions and / or additions, as well as sequences with substitutions. Preferred algorithms can interpret gaps, etc., as described below. Preferably, identity is present in regions of at least about 10 amino acids or 20 nucleotides in length, or more preferably in regions of 10-50 amino acids or 20-50 nucleotides in length. As used herein, the percentage of amino acid sequence identity (%) is defined as the percentage of amino acids in a candidate sequence that are identical to those in a reference sequence after alignment and the introduction of gaps (if necessary) to achieve the maximum percentage of sequence identity. Alignments used to determine the percentage of sequence identity can be performed in various ways well known to those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2, or Megalign (DNASTAR) software. Appropriate parameters used to measure the alignment, including any algorithms required to achieve maximum alignment on the full-length sequences being compared, can be determined by known methods.

[0056] For sequence comparisons, typically one sequence is used as a reference sequence, and the test sequence is compared to it. When using a sequence comparison algorithm, the test and reference sequences are input into the computer, the coordinates of the subsequences are specified (if necessary), and the sequence algorithm program parameters are specified. Preferably, default program parameters can be used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the percentage of sequence identity between the test sequence and the reference sequence based on the program parameters.

[0057] An example of an algorithm suitable for determining the percentage of sequence identity and the percentage of sequence similarity is the BLAST and BLAST 2.0 algorithms, described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402 and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analysis is publicly available from the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). The algorithm involves first identifying high-scoring sequence pairs (HSPs) in the query sequence by identifying short characters of length W that match or satisfy a positive threshold score T when compared to characters of the same length in a database sequence. T is called the neighbor character score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighbor character hits act as seeds for initiating a search to find longer HSPs containing them. Character hits extend in both directions along each sequence until the cumulative alignment score can increase. For nucleotide sequences, the cumulative score is calculated using parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatched residues; always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of character hits in each direction stops when: the cumulative alignment score decreases by an amount X from its maximum realized value; the cumulative score becomes zero or below due to the accumulation of one or more negatively scored residues; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) defaults to: character length (W) 11, expected value (E) 10, M = 5, N = -4, and a comparison of two strands. For amino acid sequences, the BLASTP program defaults to a word length of 3, an expected value (E) of 10, and a BLOSUM62 score matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) with an alignment (B) of 50, an expected value (E) of 10, M=5, N=-4, and a comparison of the two strands.

[0058] The BLAST algorithm also performs statistical analysis on the similarity between two sequences (see, for example, Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indication of the probability that a match will occur by chance between two nucleotide or amino acid sequences. For example, if the minimum sum probability in a comparison of the test nucleic acid with a reference nucleic acid is less than about 0.2, more preferably less than about 0.01, the nucleic acid is considered similar to the reference sequence.

[0059] The term "nucleobase" refers to the portion of a nucleotide that performs Watson / Crick base pairing. The most common naturally occurring nucleobases, adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T), have hydrogen bonding capabilities, binding one nucleic acid strand to another in a sequence-specific manner.

[0060] Antisense compounds are tools that can be used to introduce modifications into nucleic acids found in living cells. The term "antisense" refers to the concept that nucleic acids "encode" proteins. That is, the sequence of nucleotides found in a given nucleic acid determines what protein will be produced. A "sense" sequence of a complete gene will respond to a given stimulus and produce the usual amount of normal protein. A "sense" oligonucleotide will hybridize with a normal gene sequence and will not affect the amount or properties of the protein. A "senseless" sequence will not produce a product, or may produce a nonfunctional product. For example, if a "senseless" codon or oligomer is inserted into a gene, it can produce a truncated, nonfunctional protein. An "antisense" oligonucleotide will hybridize with a normal gene but will produce a protein with altered structure or quantity. Antisense oligomers, relatively short antisense compounds, have been found that can be easily inserted into cells, where they alter gene function.

[0061] Antisense compounds are commonly used as reagents in the study of gene function because they can alter gene expression with high specificity and can be used to elucidate the function of specific genes. For example, antisense compounds can be used to distinguish the functions of multiple members of a biological pathway.

[0062] Antisense oligonucleotides can be used to selectively block disease-causing genes, thereby inhibiting the production of disease-related proteins. Some antisense oligonucleotides have been safely and effectively administered to humans, and numerous clinical trials are underway. Oligonucleotides may be used to treat cells, tissues, and animals, particularly humans. In the context of this invention, the term "oligonucleotide" refers to oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or their analogs. The term includes oligonucleotides composed of naturally occurring nucleotides, sugars, and covalently linked nucleotides (backbone) bonds, as well as oligonucleotides with similar functions that include non-naturally occurring portions. These modified or substituted oligonucleotides are generally preferred over their natural forms because they possess desired properties, such as enhanced cellular uptake, increased affinity for nucleic acid targets, and increased stability in the presence of nucleotides.

[0063] The compositions and methods described herein use oligonucleotide compounds, particularly antisense oligonucleotides, that target the nucleotide moieties encoding Akt-1 and regulate Akt-1 expression. The oligonucleotide compounds are designed to specifically hybridize with one or more nucleic acids encoding Akt-1.

[0064] Antisense compounds targeting specific genes involve identifying the target nucleic acid sequence and selecting one or more sites within that sequence to be modified. Once the target site is identified, oligonucleotides that are sufficiently complementary to that target site are selected so that they will specifically hybridize with that site—that is, hybridize well and specifically enough to obtain the desired effect.

[0065] As used herein, the phrase "nucleic acid encoding Akt-1" includes DNA encoding Akt-1, RNA transcribed from that DNA (including pre-mRNA), and DNA derived from that RNA. The specific hybridization of antisense oligomers with their target nucleic acids interferes with the normal function of those nucleic acids. The functions of the DNA to be interfered with include replication and transcription. The functions of the RNA to be interfered with include all important functions, such as translocation of RNA to protein translation sites, transcription of proteins from that RNA, splicing of that RNA to produce one or more types of mRNAs, and catalytic activities that RNA participates in or promotes. The overall effect of this interference with the function of the target nucleic acid is to regulate protein expression or production. In the context of this invention, "regulation" refers to an increase (stimulation) or decrease (inhibition) in gene expression.

[0066] In the context of this invention, "hybridization" refers to hydrogen bonds between complementary nucleosides or nucleotide bases, which can be formed by Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds. For example, adenine and thymine are complementary nucleosides that pair via hydrogen bonds. As used herein, "complementary" refers to the ability of two nucleotides to precisely pair. For example, if a nucleotide at a certain position in an oligonucleotide can hydrogen bond with a nucleotide at the same position in a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered complementary at that position. An oligonucleotide and DNA or RNA are complementary when a sufficient number of corresponding positions in each molecule of oligonucleotide and DNA or RNA are occupied by nucleotides that can hydrogen bond with each other. Thus, the terms "specifically hybridizable" and "complementary" are used to indicate a sufficient degree of complementarity or precise pairing to result in stable and specific binding between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound does not need to be 100% complementary to the target nucleic acid it will specifically hybridize with. When the binding of an antisense compound to a target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, resulting in a loss of utility, the antisense compound is specifically hybridizable and has a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to a non-target sequence under the conditions desired for specific binding, namely, physiological conditions for in vivo assays or therapeutic treatments, and the conditions under which the assay is performed for in vitro assays.

[0067] While antisense oligonucleotides are the preferred form of antisense compounds, the present invention also includes other oligomeric antisense compounds, including but not limited to oligonucleotide mimics described below. Antisense compounds according to the invention preferably comprise about 10 to about 30 nucleosides. Particularly preferred are antisense oligonucleotides comprising about 20 nucleosides (i.e., about 20 linked nucleosides). Nucleosides are known in the art to be base-sugar linkages. The base moiety of a nucleoside is typically a heterocyclic base. The two most common types of such heterocyclic bases are purines and pyrimidines. A nucleotide is a nucleoside that also includes a phosphate group covalently linked to the sugar moiety of the nucleoside. For those nucleosides comprising furanylpentanoside sugars, the phosphate group may be linked to the 2′, 3′, or 5′ hydroxyl moiety of the sugar. In the formation of oligonucleotides, the phosphate group covalently links adjacent nucleosides to form a linear polymeric compound. The respective ends of this linear polymeric structure may further link to form a cyclic structure; however, a linear structure is generally preferred. Within the oligonucleotide structure, the phosphate group is generally referred to as the internucleotide backbone forming the oligonucleotide. The normal bonds or backbone of RNA and DNA are 3′ to 5′ phosphodiester bonds.

[0068] Specific examples of preferred antisense compounds used in this invention include oligonucleotides comprising a modified backbone or non-natural nucleoside interchains. As defined in this application, oligonucleotides having a modified backbone include those that retain a phosphorus atom in the main chain and those that do not have a phosphorus atom in the main chain. For the purposes of this specification, and as sometimes referred to in the art, modified oligonucleotides that do not have a phosphorus atom in their nucleoside interchain may also be considered oligonucleotides.

[0069] Preferred modified oligonucleotide backbones include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonic acids, including 3'-alkylenephosphonates and chiral phosphonates, phosphonites, phosphorimides, including 3'-aminophosphonamides and aminoalkylphosphonamides, thiophosphonamides, thioalkylphosphonates, thioalkylphosphonate triesters, and boroalkyl phosphates having normal 3'-5' bonds, and analogs of these linked to 2'-5', and those compounds having inverted polarity, wherein adjacent nucleoside units are linked from 3'-5' to 5'-3' or 2'-5' or 5'-2'. Various salts, mixed salts, and free acid forms are also included.

[0070] Preferred modified oligonucleotide backbones that do not contain phosphorus atoms are formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatom or alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatom or heterocyclic nucleoside bonds. These backbones include backbones with morpholino bonds (partially formed from the sugar moiety of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formylacetyl and thioformylacetyl backbones; methyleneformylacetyl and thioformylacetyl backbones; backbones containing alkenes; aminosulfonate backbones; methyleneimino and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and other backbones having mixed N, O, S, and CH2 components.

[0071] In other preferred oligonucleotide mimics, the sugar and nucleoside bonds of the nucleotide units, i.e., the backbone, are replaced by new groups. The base units are retained to hybridize with suitable nucleic acid target compounds. One such oligomeric compound is an oligonucleotide mimic that has exhibited excellent hybridization properties, known as peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the oligonucleotide is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and directly or indirectly bind to the nitrogen atom of the amide portion of the backbone.

[0072] The most preferred embodiments of the present invention are oligonucleotides having a thiophosphate backbone and oligonucleotides having a heteroatom backbone, particularly -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- [referred to as a methylene (methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -ON(CH3)-CH2-CH2- [wherein the natural phosphodiester backbone is given as -OPO-CH2-]. Oligonucleotides having a morpholinoyl backbone structure are also preferred.

[0073] The modified oligonucleotide may also contain one or more substituted sugar moieties. Preferred oligonucleotides contain one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl groups may be substituted or unsubstituted C1 to C2 groups. 10 Alkyl or C2 to C 10 Alkenyl and ynyl groups. O[(CH2)] is particularly preferred. n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, where n and m are 1 to about 10. Other preferred oligonucleotides contain one of the following at the 2' position: C1 to C2. 10 Lower alkyl groups, substituted lower alkyl groups, alkylaryl groups, aryl groups, O-alkylaryl groups or O-aryl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclic alkyl groups, heterocyclic alkylaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleaving groups, reporter groups, intercalating agents, groups that improve the pharmacokinetic properties of oligonucleotides, or groups that improve the pharmacokinetic properties of oligonucleotides, and other substituents with similar properties. Preferred modifications include 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also called 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486–504), i.e. alkoxyalkoxy. Further preferred modifications include 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in the examples below.

[0074] Other preferred modifications include 2'-methoxy (2'-O-CH3), 2'-aminopropoxy (2′-OCH2CH2CH2NH2), and 2'-fluorine (2'-F). Similar modifications can also be made at other positions on the oligonucleotide, particularly at the 3' position of the sugar in the 3'-terminal nucleotide, or at the 5' position of the 5'-terminal nucleotide in 2'-5'-linked oligonucleotides. The oligonucleotide can also be a sugar mimic, such as a cyclobutyl moiety replacing the furanopentose sugar. The oligonucleotide can also include nucleobase (usually referred to simply as "base" in the literature) modifications or substitutions. The "unmodified" or "natural" nucleobases used herein include purine bases adenine (A) and guanine (G), and pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymidine Adenine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogen, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Certain nucleobases can be used in particular to increase the binding affinity of the oligomeric compounds of the present invention. These nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. It has been shown that 5-methylcytosine substitution increases the stability of the nucleic acid duplex by 0.6-1.2 °C and is a preferred base substitution in this invention, especially when combined with 2'-O-methoxyethyl sugar modification.

[0075] Another modification of the oligonucleotide of the present invention includes chemically linking one or more portions or conjugates of the oligonucleotide to enhance its activity, cellular distribution, or cellular uptake. These portions include, but are not limited to, lipid portions such as cholesterol portions, bile acids, thioethers, for example, hexyl-S-triphenylmethylthiol, thiocholesterol, aliphatic chains, for example, sebacic acid or undecyl residues, phospholipids, for example, di-hexadecyl-racemic-glycerol or triethylammonium 1,2-di-o-hexadecyl-racemic-glycerol-3-H-phosphonate, polyamines or polyethylene glycol chains, or adamantaneacetic acid, palmityl portions, or octadecylamine or hexylamino-carbonyl-oxocholesterol portions.

[0076] Not all positions in a given compound need to be uniformly modified; in fact, more than one of the aforementioned modifications can be incorporated into a single compound or even a single nucleoside within an oligonucleotide. This invention also includes antisense compounds, which are chimeric compounds. In the context of this invention, a "chimeric" antisense compound or "chimera" is an antisense compound, particularly an oligonucleotide, containing two or more chemically distinct regions, each region consisting of at least one monomeric unit, i.e., for an oligonucleotide, the monomeric unit is a nucleotide. These oligonucleotides typically contain at least one region in which the oligonucleotide is modified to confer greater resistance to nuclease degradation, stronger cellular uptake, and / or greater binding affinity to target nucleic acids. This additional region of the oligonucleotide can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrid molecules. As an example, RNase H is an intracellular nuclease that cleaves the RNA strand of an RNA:DNA duplex. Therefore, activation of RNase H leads to cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotides in repressing gene expression. Therefore, when using chimeric oligonucleotides, shorter oligonucleotides often yield comparable results compared to deoxythiophosphate oligonucleotides that hybridize to the same target region. RNA target cleavage can be routinely detected by gel electrophoresis, and if necessary, can be combined with well-known nucleic acid hybridization techniques.

[0077] The chimeric antisense compounds of the present invention can form complex structures of two or more oligonucleotides, modified oligonucleotides, oligonucleotides, and / or oligonucleotide mimics as described above. These compounds are referred to in the art as hybrids or gapmers.

[0078] The antisense compounds used according to the present invention can be conveniently and routinely synthesized using well-known solid-phase synthesis techniques. Equipment for such synthesis is available from several vendors, including, for example, Applied Biosystems (Foster City, Calif.). Any other methods known in the art for such synthesis may be used additionally or alternatively. The preparation of oligonucleotides, such as phosphate thioides and alkylated derivatives, using similar techniques is well known.

[0079] The antisense compounds of the present invention are synthesized in vitro and do not include antisense compositions of gene vector constructs designed to guide the in vivo synthesis of antisense molecules. The compounds of the present invention can also be mixed, encapsulated, conjugated, or otherwise associated with other molecules, molecular structures, or mixtures of compounds, such as liposomes, receptor target molecules, and oral, rectal, topical, or other formulations, to aid in uptake, distribution, and / or absorption.

[0080] The antisense compounds of this invention include any pharmaceutically acceptable salt, ester, or salt of such esters, or any other compound that, when administered to animals, including humans, is capable of providing (directly or indirectly) a biologically active metabolite or its residues. Therefore, for example, this disclosure also relates to prodrugs and pharmaceutically acceptable salts of the compounds of this invention, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents.

[0081] The term "prodrug" refers to a therapeutic agent prepared in an inactive form, which is converted into its active form (i.e., the drug) in the body or within the body's cells by the action of endogenous enzymes or other chemicals and / or conditions. Specifically, the prodrug form of the oligonucleotide of the present invention is prepared as a SATE [(S-acetyl-2-thioethyl)phosphate] derivative.

[0082] The term "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of the compounds of the present invention, that is, a salt that retains the desired biological activity of the parent compound without conferring undesirable toxicological effects.

[0083] Preferred examples of pharmaceutically acceptable salts for oligonucleotides include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, and polyamines such as spermine and spermidine; (b) acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and nitric acid; (c) salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, etc.; and (d) salts formed from basic anions such as chlorine, bromine, and iodine.

[0084] Composition

[0085] This article describes pharmaceutical compositions comprising lipid nanoparticles encapsulating an active agent.

[0086] In some embodiments, the active agent may include RX-0201, 5′gctgcatgatctccttggcg 3′, SEQ.ID.NO.1. RX-0201 targets a site in the coding region of the Akt-1 gene having the following sequence: 5′cgccaaggagatcatgcagc 3′ at position 1478 of the Akt-1 gene (Genebank#BC000479) (Seq.Id.No.2). The backbone sequence of RX-0201 is complementary to this site. Archexin (RX-0201) is described in U.S. Patent No. 7,122,527, the entire contents of which are incorporated herein by reference. In some embodiments, the compound is an antisense oligonucleotide. In some embodiments, the antisense oligonucleotide has at least one modified nucleotide internucleotide bond, i.e., a phosphate thiophosphate bond.

[0087] Suitable cationic lipids may include, but are not limited to, DOTMA: [1-(2,3-methoxyloxy)propyl]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DODAP, DOSPA (2,3-dioleoyloxy-N-[2-(sperminecarbamoylamino)ethyl]-N,N-dimethyl-1-propanediamine trifluoroacetate), DORIE (N -[1-(2,3-dioleoyloxypropyl)]-N,N-dimethyl-N-hydroxyethylammonium bromide), DODAB, DOIC, DMEPC, DOGS: bis(octadecylamide)glycidylamine, DIMRI: dimyristoxypropyl dimethylhydroxyethylammonium bromide, DOTAP: dioleoyloxy-3-(trimethylammonium)propane, DC-6-14: O,O-teicosanoyl-N-α-trimethylaminoacetyl)diethanolamine chloride, CLIP 1: Racemic-[(2,3-octacosyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: Racemic-[2(2,3-hexacosyloxypropoxymethoxy)ethyl]-trimethylammonium, CLIP9: Racemic-[2(2,3-hexacosyloxypropoxysuccinoxy)ethyl]-trimethylammonium, oligofectamine, lipids described in U.S. Patent No. 5,049,386, N-[1-( 2,3-Dioleoyloxypropyl)]-N,N-dimethyl-N-hydroxyethylammonium bromide (DORIE), 2,3-dioleoyloxy-N-[2-(sperminecarbamoylamino)ethyl]-N,N-dimethyl-1-propylamine trifluoroacetate (DOSPA), etc.; and (3R,4R)-3,4-bis((Z)-hexadecyl-9-enoxy)-1-methylpyrrolidine and N-methyl-N,N-bis(2-((Z)-octadecyl-6-enoxy)ethyl)amine, etc., or any combination thereof, as disclosed in International Publication No. WO2011 / 13636.

[0088] In some embodiments, lipid nanoparticles may include 2.5 mol% to 15 mol% of one or more cationic lipids.

[0089] In some embodiments, one or more cationic lipids may be present in the lipid nanoparticles in an amount of at least 2.5 mol% (e.g., at least 5 mol%, at least 7.5 mol%, at least 10 mol%, or at least 12.5 mol%). In some embodiments, one or more cationic lipids may be present in the lipid nanoparticles in an amount of 15 mol% or less (e.g., 12.5 mol% or less, 10 mol% or less, 7.5 mol% or less, or 5 mol% or less).

[0090] One or more cationic lipids may be present in the lipid nanoparticles in amounts ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, one or more cationic lipids may be present in the lipid nanoparticles in amounts from 2.5 mol% to 15 mol% (e.g., 2.5 mol% to 12.5 mol%, 2.5 mol% to 10 mol%, 2.5 mol% to 7.5 mol%, 2.5 mol% to 5 mol%, 5 mol% to 15 mol%, 5 mol% to 12.5 mol%, 5 mol% to 10 mol%, or 5 mol% to 7.5 mol%).

[0091] Suitable neutral lipids may include, but are not limited to, dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylethanolamine (DOPE), 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DOPC), palmitoyloleoylphosphatidylcholine (POPC), lecithinylcholine (EPC), distearatelphosphatidylcholine (DSPC), cholesterol, or any combination thereof. In some embodiments, one or more neutral lipids may include cholesterol, DOPE, DOPC, or combinations thereof. In some embodiments, one or more neutral lipids may include (1) cholesterol; and (2) DOPE, DOPC, or combinations thereof.

[0092] In some embodiments, lipid nanoparticles may include 30 mol% to 65 mol% of one or more neutral lipids.

[0093] In some embodiments, the one or more neutral lipids are present in the lipid nanoparticles in an amount of at least 30 mol% (e.g., at least 35 mol%, at least 40 mol%, at least 45 mol%, at least 50 mol%, at least 55 mol%, or at least 60 mol%). In some embodiments, the one or more neutral lipids are present in the lipid nanoparticles in an amount of 65 mol% or less (e.g., 60 mol% or less, 55 mol% or less, 50 mol% or less, 45 mol% or less, 40 mol% or less, or 35 mol% or less).

[0094] One or more neutral lipids may be present in the lipid nanoparticles in amounts ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, one or more neutral lipids are present in the lipid nanoparticles in amounts from 30 mol% to 65 mol% (e.g., 35 mol% to 60 mol%, 40 mol% to 55 mol%, or 45 mol% to 50 mol%).

[0095] Suitable PEGylated lipids may include, but are not limited to, PEG-bistetradecylacetamide, PEG-myristoyl diglyceride, PEG-diacylglycerol, PEG-dialkoxypropyl, PEG-phospholipid, PEG-ceramide, PEG-DMG, PEG-DSPE, or any combination thereof. In some embodiments, one or more PEGylated lipids include 1,2-dimyristoyl-sn-glycerol (DMG-PEG).

[0096] In some embodiments, the lipid nanoparticles may include 2.5 mol% to 15 mol% of one or more PEGylated lipids. In some embodiments, one or more PEGylated lipids may be present in the lipid nanoparticles in an amount of at least 2.5 mol% (e.g., at least 5 mol%, at least 7.5 mol%, at least 10 mol%, or at least 12.5 mol%). In some embodiments, one or more PEGylated lipids may be present in the lipid nanoparticles in an amount of 15 mol% or less (e.g., 12.5 mol% or less, 10 mol% or less, 7.5 mol% or less, or 5 mol% or less).

[0097] One or more PEGylated lipids may be present in the lipid nanoparticles in amounts ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, one or more PEGylated lipids may be present in the lipid nanoparticles in amounts from 2.5 mol% to 15 mol% (e.g., 2.5 mol% to 10 mol%, 2.5 mol% to 7.5 mol%, 2.5 mol% to 5 mol%, 5 mol% to 15 mol%, 5 mol% to 10 mol%, 5 mol% to 7.5 mol%, 7.5 mol% to 10 mol%, 7.5 mol% to 15 mol%, 7.5 mol% to 12.5 mol%, 10 mol% to 12.5 mol%, 10 mol% to 15 mol%, or 12.5 mol% to 15 mol%).

[0098] Suitable ionizable lipids may include, but are not limited to, N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA), [(4-hydroxybutyl)azadiyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), 8-{(2-hydroxyethyl)[6-oxo-6-(undecapoxy)hexyl]amino}octanoate 9-heptadecyl ester (SM-102), such as DLin-MC3-DMA, DLin-KC2-DMA, DLinDMA, etc. disclosed in International Publication No. WO2005 / 121348, such as DLin-K-DMA, etc. disclosed in International Publication No. WO2009 / 086558, 1-(2,3-bis(((9Z,12Z)-octadec-9,12-dien-1-yl)oxy)propyl)pyrrolidine (A066), or any combination thereof. In some embodiments, one or more ionizable lipids include N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA).

[0099] In some embodiments, the lipid nanoparticles may comprise 30 mol% to 50 mol% of one or more ionizable lipids. In some embodiments, one or more ionizable lipids may be present in the lipid nanoparticles in an amount of at least 30 mol% (e.g., at least 35 mol%, at least 40 mol%, or at least 45 mol%). In some embodiments, one or more ionizable lipids may be present in the lipid nanoparticles in an amount of 50 mol% or less (e.g., 45 mol% or less, 40 mol% or less, or 35 mol% or less).

[0100] One or more ionizable lipids may be present in the lipid nanoparticles in amounts ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, one or more ionizable lipids may be present in the lipid nanoparticles in amounts from 30 mol% to 50 mol% (e.g., 30 mol% to 45 mol%, 30 mol% to 40 mol%, 30 mol% to 35 mol%, 35 mol% to 50 mol%, 35 mol% to 45 mol%, 35 mol% to 40 mol%, 40 mol% to 50 mol%, 40 mol% to 45 mol%, or 45 mol% to 50 mol%).

[0101] In some embodiments, the lipid nanoparticles include DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG. In some embodiments, DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG may be present in a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:25:20:10, 5:40:27.5:20:7.5, or 5:40:30:20:5. In some embodiments, DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG may be present in a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:27.5:20:7.5.

[0102] In some embodiments, the lipid nanoparticles and the active agent may be present in a weight ratio of lipid nanoparticles to active agent of 5:1 to 20:1, 7.5:1 to 15:1, 7.5:1 to 10:1, 7.5:1 to 12:1, 10:1 to 12:1, 10.1 to 15:1, or 12:1 to 15:1. In some embodiments, the lipid nanoparticles and the active agent are present in a weight ratio of lipid nanoparticles to active agent of 15:1, 12:1, 10:1, or 7.5:1.

[0103] In some embodiments, the composition may include a group of lipid nanoparticles having an average particle size of at least 50 nm (e.g., at least 60 nm, at least 70 nm, at least 75 nm, or at least 65 nm) as determined by dynamic light scattering.

[0104] In some embodiments, the composition may include a group of lipid nanoparticles with an average particle size of 80 nm or less as determined by dynamic light scattering (e.g., 75 nm or less, 70 nm or less, 65 nm or less, or 60 nm or less).

[0105] The composition may include a group of lipid nanoparticles having an average particle size, as determined by dynamic light scattering, ranging from any of the aforementioned minimum to any of the aforementioned maximum values. For example, in some embodiments, the composition may include a group of lipid nanoparticles having an average particle size, as determined by dynamic light scattering, of 50 nm to 80 nm (e.g., 50 nm to 70 nm, 50 nm to 60 nm, 55 nm to 70 nm, 55 nm to 65 nm, 55 nm to 60 nm, 60 nm to 80 nm, 55 nm to 75 nm, 60 nm to 75 nm, 60 nm to 65 nm, 65 nm to 80 nm, 65 nm to 70 nm, 70 nm to 75 nm, 70 nm to 80 nm, or 75 nm to 80 nm). In some embodiments, the group of lipid nanoparticles may have an average particle size of about 55 nm as determined by dynamic light scattering.

[0106] In some embodiments, the composition may include a group of lipid nanoparticles having an average zeta potential of at least -0.6 mV (e.g., at least -0.1 mV, at least 0.5 mV, at least 1 mV, at least 1.5 mV, or at least 2 mV).

[0107] In some embodiments, the composition may include a group of lipid nanoparticles having an average zeta potential of 2.5 mV or less (e.g., 2 mV or less, 1.5 mV or less, 1 mV or less, 0.5 mV or less, 0.1 mV or less, or -0.1 mV or less).

[0108] The composition may include a group of lipid nanoparticles having an average zeta potential ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, the composition may include a group of lipid nanoparticles having an average zeta potential of -0.6 mV to 2.5 mV (e.g., -0.6 mV to 2 mV, -0.6 mV to 1.5 mV, -0.6 mV to 1 mV, -0.6 mV to 0.5 mV, -0.6 mV to 0.1 mV, -0.1 mV to 2.5 mV, -0.1 mV to 2 mV, -0.1 mV to 1.5 mV, -0.1 mV to 1 mV, -0.1 mV to 0.5 mV, 0.5 mV to 2 mV, 0.5 mV to 1.5 mV, 0.5 mV to 1 mV, 1 mV to 2 mV, 1 mV to 1.5 mV, 1.5 mV to 2 mV, 1.5 mV to 2.5 mV, or 2 mV to 2.5 mV). In some implementations, the lipid nanoparticle clusters can have an average ζ potential of -5.5 mV.

[0109] In some embodiments, the composition may include a group of lipid nanoparticles with a polydispersity index (PDI) of at least 0.15 (e.g., at least 0.2, at least 0.25, at least 0.3, at least 0.35, at least 0.4, or at least 0.45).

[0110] In some embodiments, the composition may include a group of lipid nanoparticles with a polydispersity index (PDI) of 0.5 or lower (e.g., 0.45 or lower, 0.4 or lower, 0.35 or lower, 0.3 or lower, 0.25 or lower, 0.2 or lower, or 0.15 or lower).

[0111] The composition may include a group of lipid nanoparticles having a polydispersity index (PDI) ranging from any of the minimum to any of the maximum values ​​described above. For example, in some embodiments, the composition may include a group of lipid nanoparticles with a polydispersity index (PDI) of 0.15 to 0.5 (e.g., 0.15 to 0.4, 0.15 to 0.3, 0.15 to 0.2, 0.2 to 0.3, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 0.4, 0.3 to 0.5, or 0.4 to 0.5).

[0112] In some implementations, lipid nanoparticles are dispersed in a pharmaceutically acceptable carrier.

[0113] "Pharmaceutically acceptable carrier" (sometimes referred to as "carrier") means a carrier or excipient that can be used to prepare a generally safe and non-toxic pharmaceutical or therapeutic composition, and includes carriers acceptable for veterinary and / or human pharmaceutical or therapeutic use. The term "carrier" or "pharmaceutically acceptable carrier" may include, but is not limited to, phosphate-buffered saline solutions, water, emulsions (such as oil / water or water / oil emulsions), and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, or other material known in the art for pharmaceutical formulations and further described herein.

[0114] "Excipients" include any and all solvents, diluents or other liquid media, dispersants or suspending agents, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, etc., suitable for the desired specific dosage form. General considerations for formulation and / or manufacturing can be found in, for example, Remington's Pharmaceutical Sciences, Sixteenth Edition, EW Martin (Mack Publishing Co., Easton, Pa., 1980) and Remington: The Science and Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005).

[0115] Exemplary excipients include, but are not limited to, any non-toxic inert solid, semi-solid, or liquid filler, diluent, encapsulating material, or any type of formulation aid. Examples of materials that can act as excipients include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered astragalus; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil; safflower oil; sesame oil; olive oil; corn oil and soybean oil; ethylene glycol such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; detergents such as Tween 80; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; and phosphate buffer solutions and other non-toxic, compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as colorants, release agents, coating agents, sweeteners, flavoring agents, and aroma agents. Preservatives and antioxidants may also be present in the composition at the discretion of the blender. As those skilled in the art will understand, excipients can be selected based on the intended use of the composition. For example, in the case of a pharmaceutical composition, the choice of excipient will depend on the route of administration, the agent being delivered, the timing of the delivery, etc., and can be administered orally, rectally, parenterally, intracerebrospinal, vaginally, nasally, peritoneally, topically (e.g., by powder, cream, ointment, or drops), buccally, or as an oral or nasal spray to humans and / or animals. In some embodiments, the active compounds disclosed herein are for topical application.

[0116] Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and combinations thereof.

[0117] Exemplary granulating agents and / or dispersants include potato starch, corn starch, cassava starch, sodium glycolate starch, clay, alginate, guar gum, citrus pomace, agar, bentonite, cellulose and wood products, natural sponges, cation exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinylpyrrolidone) (cross-linked polyvinylpyrrolidone), sodium carboxymethyl starch (sodium glycolate starch), carboxymethyl cellulose, cross-linked sodium carboxymethyl cellulose (cross-linked carboxymethyl cellulose), methyl cellulose, pregelatinized starch (starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and combinations thereof.

[0118] Exemplary surfactants and / or emulsifiers include natural emulsifiers (e.g., gum arabic, agar, alginic acid, sodium alginate, tragacanth gum, chondrux, cholesterol, xanthan gum, pectin, gelatin, egg yolk, casein, lanolin, cholesterol, waxes, and lecithin), colloidal clays (e.g., bentonite [aluminum silicate] and Viglam [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetyl ester, monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomer (e.g.) Examples include carboxyethylene, polyacrylic acid, acrylic polymers and carboxyvinyl polymers, carrageenan, cellulose derivatives (e.g., sodium carboxymethyl cellulose, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose), and sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40]). 40), Sorbitan monostearate [Span 60], Sorbitan tristearate [Span 65], Glyceryl monooleate, Sorbitan monooleate ([Span 80]), Polyoxyethylene esters (e.g., polyoxyethylene monostearate [Myrj 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate and Solutol), Sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., Cremophor), Polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [Brij 30]), Poly(vinylpyrrolidone), Diethylene glycol monolaurate, Triethanolamine oleate, Sodium oleate, Potassium oleate, Ethyl oleate, Oleic acid, Ethyl lauryl ester, Sodium lauryl sulfate, Pluronic F-68, Poloxamer-188, Cetrimonium bromide bromide, cetylpyridinium chloride, benzalkonium chloride, sodium docusate and / or combinations thereof.

[0119] Exemplary adhesives include starch (e.g., corn starch and starch paste), gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol, etc.), natural and synthetic gums (e.g., gum arabic, sodium alginate, extracts of Irish moss, panwar gum, ghatti gum, mucilage of isapol husks, carboxymethyl cellulose, methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, microcrystalline cellulose, cellulose acetate, poly(vinylpyrrolidone), magnesium aluminum silicate (Wigum), and larch arabinogalactan), alginate, polyethylene oxide, polyethylene glycol, inorganic calcium salts, silicic acid, polymethyl methacrylate, waxes, water, alcohols, etc., and / or combinations thereof.

[0120] Exemplary preservatives include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acid preservatives, and other preservatives.

[0121] Exemplary antioxidants include alpha-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite.

[0122] Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA) and its salts and hydrates (e.g., sodium edetate, disodium edetate, trisodium edetate, calcium sodium edetate, dipotassium edetate, etc.), citric acid and its salts and hydrates (e.g., citric acid monohydrate), fumaric acid and its salts and hydrates, malic acid and its salts and hydrates, phosphoric acid and its salts and hydrates, and tartaric acid and its salts and hydrates.

[0123] Exemplary antimicrobial preservatives include benzalkonium chloride, benzyl chloride, benzyl alcohol, bromonitrol, cetrimonium bromide, cetylpyridine chloride, chlorhexidine, chlorobutanol, chlorocresol, xyloxyphenol, cresol, ethanol, glycerin, hexetidine, imidureurium, phenol, phenoxyethanol, phenethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal.

[0124] Exemplary antifungal preservatives include butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid.

[0125] Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoates, and phenylethanol.

[0126] Exemplary acidic preservatives include vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopheryl acetate, deferoxamine mesylate, cetrimonium bromide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Phenonip, methylparaben, Germall 115, Germaben II, Neolone, Kathon, and Euxyl. In some embodiments, the preservative is an antioxidant. In other embodiments, the preservative is a chelating agent.

[0127] Exemplary buffers include citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium gluconate, calcium gluconate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propionic acid, calcium levulinate, valeric acid, diphosphate, phosphoric acid, triphosphate, calcium hydroxide, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, diphosphate, monophosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, diphosphate, monophosphate, sodium phosphate mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginate, pyrogen-free water, isotonic saline, Ringer's solution, ethanol, and combinations thereof.

[0128] Exemplary lubricants include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0129] Exemplary natural oils include almond oil, apricot kernel oil, avocado oil, babassu oil, bergamot oil, blackcurrant seed oil, borage oil, juniper oil, chamomile oil, canola oil, caraway oil, galopa oil, castor oil, cinnamon oil, cocoa butter, coconut oil, cod liver oil, coffee oil, corn oil, cottonseed oil, emu oil, eucalyptus oil, evening primrose oil, fish oil, flaxseed oil, geraniol oil, gourd oil, grapeseed oil, hazelnut oil, hyacinth oil, isopropyl myristate oil, jojoba oil, macadamia nut oil, and mixed lavender. Oils, including lavender oil, lemon oil, litsea cubeba oil, macadamia nut oil, mallow oil, mango seed oil, meadowfoam seed oil, mink oil, nutmeg oil, olive oil, orange oil, orange salmon oil, palm oil, palm kernel oil, peach kernel oil, peanut oil, poppy seed oil, pumpkin seed oil, rapeseed oil, rice bran oil, rosemary oil, safflower oil, sandalwood oil, camellia oil, peppermint oil, sea buckthorn oil, sesame oil, shea butter, silicone oil, soybean oil, sunflower oil, tea tree oil, thistle oil, ailanthus oil, vetiver oil, walnut oil, and wheat germ oil. Exemplary synthetic oils include, but are not limited to, butyl stearate, caprylic triglyceride, caprylic triglyceride, cyclomethicone, diethyl sebate, dimethicone 360, isopropyl myristate, mineral oil, octyl dodecyl alcohol, oleyl alcohol, silicone oil, and combinations thereof.

[0130] Liquid compositions include emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, liquid compositions may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers, and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butanediol, dimethylformamide, oils (specifically, cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan, as well as mixtures thereof. In addition to inert diluents, oral compositions may also include adjuvants such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents, and aromatizers.

[0131] Injectable compositions (e.g., injectable aqueous or oily suspensions) can be formulated using suitable dispersants or wetting agents and suspending agents according to known techniques. Sterile injectable formulations can also be injectable solutions, suspensions, or emulsions in non-toxic, parenteral-acceptable diluents or solvents, such as solutions in 1,3-butanediol. Water, Ringer's solution, USP, and isotonic sodium chloride solution are among the acceptable media and solvents for pharmaceutical or cosmetic compositions that can be used. Additionally, sterile fixed oils are routinely used as solvents or suspension media. Any mild fixed oil can be used, including synthetic monoglycerides or diglycerides. Furthermore, fatty acids such as oleic acid are used to prepare injectables. In some embodiments, particles are suspended in a carrier fluid containing 1% (w / v) sodium carboxymethyl cellulose and 0.1% (v / v) Tween 80. Injectable compositions can be sterilized, for example, by filtering through a bacterial trap or by incorporating a sterilizing agent in the form of a sterile solid composition, which can be dissolved or dispersed in sterile water or other sterile injectable media only before use.

[0132] Solid compositions include capsules, tablets, pills, powders, and granules. In such solid compositions, the granules are mixed with at least one excipient and / or a) a filler or extender, such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; b) a binder, such as carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and gum arabic; c) a humectant, such as glycerin; d) a disintegrant, such as agar-agar, calcium carbonate, potato or cassava starch, alginate, certain silicates, and sodium carbonate; e) a solution barrier, such as paraffin; f) an absorption accelerator, such as a quaternary ammonium compound; g) a humectant, such as cetyl alcohol and glyceryl monostearate; h) an adsorbent, such as kaolin and bentonite; and i) a lubricant, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosage form may also contain a buffer. Similar solid compositions can also be used as fillers in soft-filled and hard-filled gelatin capsules, which use excipients such as lactose or toffee and high molecular weight polyethylene glycol.

[0133] Tablets, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings well known in the field of pharmaceutical formulation. The dosage forms may optionally contain emulsifiers and may have a composition that allows for the optional delayed release of the active ingredient only or preferentially in certain portions of the intestine. Examples of encapsulation compositions that can be used include polymeric substances and waxes. Similar types of solid compositions can also be used as fillers in soft-filled and hard-filled gelatin capsules that use excipients such as lactose or toffee and high molecular weight polyethylene glycol.

[0134] Compositions for topical or transdermal application include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalers, or patches. The active compound is mixed with excipients and any necessary preservatives or buffers.

[0135] In addition to active compounds, ointments, pastes, creams and gels may also contain excipients such as animal and vegetable fats, oils, waxes, paraffins, starches, astragalus gum, cellulose derivatives, polyethylene glycol, silicones, bentonite, silicic acid, talc and zinc oxide or mixtures thereof.

[0136] In addition to the active compound, powders and aerosols may also contain excipients such as lactose, talc, silica, aluminum hydroxide, calcium silicate, and polyamide powders or mixtures thereof. Aerosols may also contain conventional propellants such as chlorofluorocarbons (CFCs).

[0137] Transdermal patches offer the added advantage of providing controlled delivery of compounds into the body. These dosage forms can be prepared by dissolving or dispersing nanoparticles in a suitable medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by providing a rate-controlled membrane or by dispersing the particles in a polymer matrix or gel.

[0138] How to use

[0139] This document also describes methods for treating cancer, preventing cancer, preventing cancer metastasis, preventing cancer recurrence, or preventing angiogenesis. In some embodiments, the methods may include administering the pharmaceutical composition described herein to a subject in need. In some embodiments, the cancer may be hepatocellular carcinoma.

[0140] The compositions used in the methods described herein can be administered by any suitable method or technique currently known or anticipated by those skilled in the art. For example, the active ingredients described herein can be formulated in a physiologically or pharmaceutically acceptable form and can be administered by any suitable route known in the art, including, for example, oral and parenteral administration. As used herein, the term “parenteral” includes subcutaneous, intradermal, intravenous, intramuscular, intraperitoneal, and intrasternal administration, such as by injection. The active agent can be administered by any route. In some embodiments, the active agent is administered via multiple routes, including oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subcutaneous, intraventricular, percutaneous, intradermal, rectal, vaginal, intraperitoneal, local (e.g., by powder, ointment, cream, and / or drops), mucosal, nasal, buccal, intestinal, sublingual, intratracheal instillation, bronchial instillation, and / or inhalation and / or in the form of oral spray, nasal spray, and / or aerosol. Generally, the most appropriate route of administration will depend on a variety of factors, including the nature of the active ingredient (e.g., its stability in the gastrointestinal environment), the patient's condition (e.g., whether the patient can tolerate oral administration), etc. The active component of the composition can be administered as a single dose, or at consecutive and varying intervals as readily determined by those skilled in the art.

[0141] In some embodiments, it may be desirable to provide continuous delivery of one or more compounds to a patient in need. For intravenous or intra-arterial routes, this can be accomplished via an infusion system, such as intravenous administration. For topical application, repeated applications can be made, or a patch can be used to provide continuous administration of the compound over an extended period of time.

[0142] The active ingredient can be administered in the amount, at the time, and via the route deemed necessary to achieve the desired outcome. The precise amount of the active ingredient will vary from subject to subject, depending on the subject's species, age and general condition, severity of infection, the specific active ingredient, its administration method, its mode of activity, etc. The active ingredient, whether the active compound itself or in combination with a pharmaceutical agent, is preferably formulated in dose units to facilitate administration and uniformity of dosage. However, it should be understood that the total daily dose of the active ingredient will be determined by the attending physician within the bounds of reasonable medical judgment. The specific therapeutically effective dose level for any particular subject will depend on a variety of factors, including the condition being treated and its severity; the activity of the active ingredient used; the specific combination used; the patient's age, weight, general health condition, sex, and diet; the time of administration, route of administration, and the excretion rate of the specific active ingredient used; the duration of treatment; the medications combined with or consistent with the specific active ingredient used; and similar factors well-known in the medical field.

[0143] The exact amount of "active ingredient" required to achieve a therapeutic or preventative effective dose will vary from subject to subject, depending on factors such as the subject's species, age and general condition, severity of side effects or symptoms, identity of the specific compound, mode of administration, etc. The amount to be administered, for example, to children or adolescents, can be determined by a medical practitioner or technician in the field and may be lower than or the same as the amount administered to adults.

[0144] The usable dosage of the compositions disclosed herein can be determined by comparing their in vitro and in vivo activities in animal models. Methods for extrapolating effective dosages from mice and other animals to humans are well-known.

[0145] The dosage range used for the application of the composition is a range large enough to produce the desired effect where the symptoms or condition are affected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, allergic reactions, etc. Generally, the dosage will vary depending on the patient's age, symptoms, sex, and severity of the disease, and can be determined by a person skilled in the art. In the event of any contraindications, the dosage may be adjusted by an individual physician. The dosage may be varied and may be administered once or multiple times daily for one or more days.

[0146] In some embodiments, the compositions described herein may be administered in combination with additional active agents or therapies.

[0147] Surfactant

[0148] As used herein, "active agent" refers to a therapeutic agent, diagnostic agent, or preventative agent. As discussed herein, therapeutic agents can be released in their biologically active form from the disclosed compounds, compositions, and systems.

[0149] It should also be understood that, as used herein, the term "therapeutic agent" refers to one or more therapeutic agents, active ingredients, or substances that can be used to treat a medical condition. Therapeutic agents include any synthetic or naturally occurring bioactive compound or substance composition that, when administered to a living organism (human or non-human animal), induces desired pharmacological, immunogenic, and / or physiological effects through local and / or systemic action. The term therefore covers those compounds or chemicals traditionally considered to comprise drugs, vaccines, and biological agents such as proteins, peptides, hormones, nucleic acids, and gene constructs. Examples of therapeutic agents are described in well-known literature references such as the Merck Index (14th edition), Physicians' Desk Reference (64th edition), and The Pharmacological Basis of Therapeutics (12th edition), and they include, but are not limited to, medicines; vitamins and minerals such as essential amino acids, calcium, iron, potassium, zinc, vitamin B12, etc.; substances used to treat, prevent, diagnose, cure, or alleviate diseases or ailments; substances that affect the structure or function of the body, or prodrugs, which become biologically active or more active when placed in a physiological environment. For example, the term "therapeutic agent" includes compounds or compositions used in all major therapeutic areas, including but not limited to adjuvants; antimicrobial agents (including antibiotics, antiviral agents, antiparasitic agents, and antifungal agents), anti-inflammatory agents (including steroidal and nonsteroidal anti-inflammatory agents), anticoagulants, ophthalmic agents, gastrointestinal agents, antiplatelet agents, and antibacterial agents, steroidal agents, antitumor agents, anticancer agents, antigens, antibodies, contraceptives, progestins, anticholinergics, nutritional agents, analgesics, and analgesic combinations such as acetaminophen and acetylsalicylic acid; anesthetics such as lidocaine and serocaine, appetite suppressants such as dexthyroxine and benzotriazine tartrate; antiepileptics, local and general anesthetics, hypnotics, sedatives, antipsychotics, tranquilizers, and antidepressants such as isocarboxazid and amoxapine; anxiolytics, antagonists, and neuroleptics. Mesotherapy blockers, anticholinergics and cholinergic drugs, antimuscarinic agents and muscarinic agents, anti-Parkinson's drugs, anti-Alzheimer's drugs, antiadrenergic drugs, antiarrhythmic drugs, antihypertensive drugs, hormones such as insulin, progesterone, estrogen, corticosteroids, glucocorticoids, and androgens; as well as nutrients, anti-arthritis drugs such as methylprednisolone and ibuprofen; bronchodilators such as terbutaline sulfate, theophylline, and ephedrine; anticonvulsants such as phenytoin sodium and diazepam; antihistamines, antihistamines such as diphenhydramine hydrochloride and chlorpheniramine maleate; antinausea drugs, antitumor drugs, antipruritics, and antipyretics; antispasmodics such as belladonna alkaloids and bicyclolamine hydrochloride; cardiovascular drugs such as prazosin hydrochloride, nitroglycerin, propranolol hydrochloride, hydralazine hydrochloride, pancreatic lipase, and succinate dehydrogenase;Vasodilators, cardiovascular agents (including calcium channel blockers, beta-blockers, beta-agonists, and antiarrhythmics), antihypertensives, diuretics such as furosemide and spironolactone; vasodilators; central nervous system stimulants; cough and cold remedies; decongestants; diagnostic agents; bone growth stimulants and bone resorption inhibitors; muscle relaxants; psychostimulants; sedatives; tranquilizers such as chlorpromazine, diazepam, chlorpromazine hydrochloride, reserpine, and chlordiazepoxide hydrochloride; antiulcer drugs such as ranitidine hydrochloride and cimetidine hydrochloride; antiasthmatic agents, antidiarrheal agents, antiobesity agents, antithrombotic agents, antitussive agents, antiuric agents, antianginal agents, appetite suppressants, expectorants, hyperglycemic agents, hypoglycemic agents, thyroid drugs. Drugs and antithyroid agents, tissue growth agents, uterine relaxants, immunomodulators, including cytokines, interleukins, interferons, colony-stimulating factors, tumor necrosis factors, etc.; immunosuppressants, such as rapamycin, tacrolimus, etc.; immunizing agents; antigens, factors, growth factors, amino acids, peptides and proteins and their fragments (whether naturally occurring, chemically synthesized or recombinant), such as LHRH, somatostatin, calcitonin, growth hormone, glucagon-like peptide, growth-releasing factor, angiotensin, FSH, EGF, bone morphogenetic protein (BMP), erythropoietin (EPO), interferon, interleukins, collagen, fibrinogen, insulin, factor VIII, factor IX, etc. α-glucosidase, Vasopressin, ACTH, human serum albumin, gamma globulin, structural proteins, blood product proteins, complex proteins, antigens or antigenic peptides, enzymes, antibodies, monoclonal antibodies, etc.; and nucleic acid molecules (polymeric forms of two or more nucleotides, polynucleotides, ribonucleotides (RNA) or deoxyribonucleotides (DNA), including double-stranded and single-stranded molecules, gene constructs, expression mediators, antisense molecules, etc.), small molecules (e.g., doxorubicin) and other bioactive macromolecules, such as, for example, proteins and enzymes. The agent can be a bioactive agent for medical (including veterinary) applications and agricultural (e.g., plant) and other fields. In some embodiments of this disclosure, the agent to be delivered can be a mixture of active agents.

[0150] Representative examples of antibiotics include amikacin, amoxicillin, ampicillin, atorvaquinone, azithromycin, aztreonam, bacitracin, carbenicillin, cefadroxil, cefazolin, cefdinir, ceftolun, cefepime, cefdinir, cefoperazone, cefotetan, cefoxitin, cefotaxime, cefpodoxime, cefprozil, cefuroxime, ceftazidime, ceftriaxone, chloramphenicol, polymyxin E mesylate, cefuroxime, cefalexin, cefradine, cilastatin, sinofloxacin, ciprofloxacin, clarithromycin, clindamycin, dapavancin, dapoxetine, dapoxetine, dimecycline, dicloxacillin, donipenem, doxycycline, eracycline, ertadalafil. Southern, erythromycin, fendamycin, fosfomycin, gatifloxacin, gemifloxacin, gentamicin, imipenem, lefamoline, lincomycin, linezolid, lomefloxacin, cephalosporin, meropenem, metronidazole, minocycline, moxifloxacin, nafcillin, nalidixic acid, neomycin, norfloxacin, ofloxacin, omalicycline, orivoxil, oxacillin, oxytetracycline, paromomycin, penicillin, pentanemidine, piperacillin, prazosin, quinupristine, rifaximin, sarecycline, secnidazole, sparfloxacin, spectinomycin, sulfamethoxazole, sulfisoxazole, tebuconazole, telithromycin, ticarcillin, tigecycline, tobramycin, trimethoprim, trovafloxacin, and vancomycin.

[0151] Representative examples of antiviral agents include, but are not limited to, abacavir, acyclovir, adefovir, amantadine, ampravir, atazanavir, balavir, balocilivir, baborol, boprevir, cidofovir, cobistat, daclatasvir, darunavir, delavudine, docasanol, dulutegravir, doravirin, ecoliever, edoururidine, efavirenz, erteiravir, emtricitabine, enfuvirtide, entecavir, ectavirin, famciclovir, fomivirsen, fossanavir, forscarnet, fosnonet, famciclovir, favipiravir, fomivirsen, foscavir, ganciclovir, ibatabine, idoxuridine, indinavir, inosine, isopyrosine, type I interferon, type II interferon, type III interferon, lamivudine, and lemovivir. Lemovivir, Lopinavir, Loviramide, Maraviro, Meinthiazone, Moroxydine, Nefernavir, Nevirapine, Nizoralide, Oseltamivir, Pegylated Interferon Alpha-2a, Pegylated Interferon Alpha-2b, Penciclovir, Peramivir, Praconadrine, Podophyllotoxin, Pyramidine, Retegvir, Remdesevir, Ribavirin, Rilpivirine, Amantadine Ratamod, Monupivir, Ritonavir, Saquinavir, Smepivir, Sofosbuvir, Stavudine, Tarabivirin, Telbivudine, Tenofovir Alammet, Tenofovir Disoproxil Flavoxate, Tenofovir, Tipplanvir, Trifluorouridine, Triclovir, Triamcinolone, Arbidol Hydrochloride, Valacyclovir, Valganciclovir, Vidarabine, Zacitabine, Zanamivir, and Zidovudine.

[0152] Representative examples of anticoagulants include, but are not limited to, heparin, warfarin, rivaroxaban, dabigatran, apixaban, edoxaban, enoxaparin, and fondaparin.

[0153] Representative examples of antiplatelet agents include, but are not limited to, clopidogrel, ticagrelor, prasugrel, dipyridamole, dipyridamole / aspirin, ticlopidine, and epitubatide.

[0154] Representative examples of antifungal agents include, but are not limited to, voriconazole, itraconazole, posaconazole, fluconazole, ketoconazole, clotrimazole, isaconazole, miconazole, caspofungin, anidoxane, micafungin, griseofulvin, terbinafine, flucytosine, terbinafine, nystatin, and amphotericin B.

[0155] Representative examples of steroidal anti-inflammatory agents include, but are not limited to, hydrocortisone, dexamethasone, prednisolone, prednisone, triamcinolone, methylprednisolone, budesonide, betamethasone, cortisone, and defcoccal. Representative examples of nonsteroidal anti-inflammatory drugs include ibuprofen, naproxen, ketoprofen, tometidine, etodoxacin, fenofosine, flurbiprofen, diclofenac, piroxicam, indomethacin, sulindax, meloxicam, nabumetone, oxaprazin, mefenamic acid, and diflunisal.

[0156] Other examples of active agents include chloroquine, hydrochloroquine, pyridoxal phosphate, vitamin D, and vitamin C.

[0157] Representative examples of anti-cytokine or immunomodulatory agents, but not limited to, tocilizumab, salimib, bevacizumab, fingolimod, imiquimod, and eculizumab.

[0158] Representative examples of contraceptive pills include, but are not limited to, progestins, estrogens, or any combination thereof. Suitable progestins include, but are not limited to, natural and synthetic compounds with fertility-promoting activity, such as progesterone, chlormadinone acetate, norethindrone, cyproterone acetate, norethindrone acetate, desogestrel, levonorgestrel, drospirenone, tramemone, norethindrone, norgestrel, methylprogesterone, etogestrel, gestadienone, and other natural and / or synthetic fertility-promoting hormones. For example, suitable estrogens include, but are not limited to, natural and synthetic compounds with estrogenic activity, such as, for example, estradiol (17β-estradiol), 17α-estradiol, estriol, estrone and their esters, such as acetates, sulfates, valerates or benzoates of these compounds, including, for example, estradiol 17β-cyclopentylpropionate, estradiol 17-propionate, estradiol 3-benzoate and piperazine estrone sulfate; ethinyl estradiol; conjugated estrogens (natural and synthetic); mesestrol; agonistic antiestrogens; and selective estrogen receptor modulators. Other examples of contraceptives include gonadotropin-releasing hormone (GnRh) or analogues such as dilorelin, avorelin, leuprorelin, triptorelin, nafarelin, goserelin, buserrelin and feterelin.

[0159] The term "steroid" refers to compounds belonging to or associated with the following exemplary families of compounds: corticosteroids, mineral steroids, and sex steroids (including, for example, potential androgens or estrogens or antiandrogens and antiestrogens). These include, for example, prednisone, prednisolone, methylprednisolone, triamcinolone, fluocinolone, aldosterone, spironolactone, danazol (also known as OPTINA), and others. In some embodiments, therapeutic agents may include steroids.

[0160] Exemplary cancer drugs or anticancer agents may include, but are not limited to, antimetabolite anticancer agents and antimitotic anticancer agents, and combinations thereof. Various antimetabolite and antimitotic anticancer agents (including single such agents or combinations thereof) may be used in the methods and compositions described herein.

[0161] Antimetabolites are typically structurally similar to natural metabolites that participate in normal metabolic processes in cancer cells, such as nucleic acid and protein synthesis. However, antimetabolites differ significantly from natural metabolites, allowing them to interfere with cancer cell metabolic processes. In cells, antimetabolites are mistaken for their similar metabolites and processed by the cell in a manner similar to normal compounds. The presence of these "decoy" metabolites prevents cells from performing vital functions, and cells cannot grow or survive. For example, antimetabolites can exert cytotoxic activity by replacing these deceptive nucleotides into cellular DNA, thereby disrupting cell division, or by inhibiting key cellular enzymes, thus preventing DNA replication.

[0162] Therefore, in one respect, antimetabolites are nucleotides or nucleotide analogs. In other respects, for example, antimetabolites may include purines (e.g., guanine or adenosine) or analogs thereof, or pyrimidines (cytidine or thymidine) or analogs thereof, with or without a linked sugar moiety.

[0163] Suitable antimetabolites and anticancer agents used in this disclosure can generally be classified according to the metabolic processes they affect, and can include, but are not limited to, analogues and derivatives of folic acid, pyrimidine, purine, and cytidine. Therefore, in one aspect, antimetabolites are selected from the group consisting of cytidine analogues, folic acid analogues, purine analogues, pyrimidine analogues, and combinations thereof.

[0164] In one particular aspect, for example, antimetabolites are cytidine analogs. According to this aspect, for example, cytidine analogs can be selected from cytarabine (cytosine arabinoside), azacytidine (5-azacytidine), and their salts, analogs, and derivatives.

[0165] In another specific aspect, for example, antimetabolites are folic acid analogs. Folic acid analogs, or antimetabolites, typically work by inhibiting dihydrofolate reductase (DHFR) (an enzyme involved in nucleotide formation); when this enzyme is blocked, nucleotides are not formed, thereby disrupting DNA replication and cell division. According to some aspects, for example, folic acid analogs can be selected from the group consisting of norpterin, methotrexate (aminopterin), pemetrexed, pteroxetine, raltitrexed, trimesartan, and their salts, analogs, and derivatives.

[0166] In another specific aspect, for example, antimetabolites are purine analogues. Purine-based antimetabolites work by inhibiting DNA synthesis, for example, by interfering with the production of purines containing nucleotides, adenine, and guanine, thereby stopping DNA synthesis and thus cell division. Purine analogues can also be incorporated into the DNA molecule itself during DNA synthesis, which can interfere with cell division. According to certain aspects, for example, purine analogues may be selected from acyclovir, allopurinol, 2-aminoadenosine, arabinoadecanine (ara-A), azacytidine, azathioprine, 8-aza-adenosine, 8-fluoroadenosine, 8-methoxy-adenosine, 8-oxo-adenosine, cladribine, deoxycofomycin, fludarabine, ganciclovir, 8-aza-guanosine, 8-fluoro-guanosine, 8-methoxy-guanosine, 8-oxo-guanosine, guanosine diphosphate, guanosine diphosphate-β-L-2-aminofucose, guanosine diphosphate-D-arabinose, guanosine diphosphate-2-fluorofucose, guanosine diphosphate-fucose, mercaptopurine (6-MP), pentostatin, thioimidapurine, thioguanine (6-TG) and their salts, analogues and derivatives.

[0167] In another specific aspect, for example, antimetabolites are pyrimidine analogs. Similar to the purine analogs discussed above, pyrimidine antimetabolites block the synthesis of pyrimidine-containing nucleotides (cytosine and thymine in DNA; cytosine and uracil in RNA). By acting as "decoys," pyrimidine compounds can prevent the production of nucleotides and / or can be incorporated into growing DNA strands and cause their termination. Depending on certain aspects, for example, pyrimidine analogs can be selected from ancitabine, azacytidine, 6-azauridine, bromouracil (e.g., 5-bromouracil), capecitabine, carmoflurane, chlorouracil (e.g., 5-chlorouracil), cytarabine (cytosine-arabinoside), cytosine, dideoxyuridine, 3′-azido-3′-deoxythymidine, 3′-dideoxycytidine-2′-ene, 3′-deoxy-3′-deoxythymidine. The group consisting of 2′-ene, dihydrouracil, deoxyfluorouracil, enoxabin, fluorouracil, 5-fluorocytosine, 2-fluorodeoxycytosine, 3-fluoro-3′-deoxythymidine, fluorouracil (e.g., 5-fluorouracil (also known as 5-FU)), gemcitabine, 5-methylcytosine, 5-propynylcytosine, 5-propynylthymidine, 5-propynyluracil, thymidine, uracil, uridine, and their salts, analogs, and derivatives. In one aspect, pyrimidine analogs are not 5-fluorouracil. In another aspect, pyrimidine analogs are gemcitabine or its salts.

[0168] In some aspects, the antimetabolite is selected from the group consisting of 5-fluorouracil, capecitabine, 6-mercaptopurine, methotrexate, gemcitabine, cytarabine, fludarabine, pemetrexed, and their salts, analogs, derivatives, and combinations thereof. In other aspects, the antimetabolite is selected from the group consisting of capecitabine, 6-mercaptopurine, methotrexate, gemcitabine, cytarabine, fludarabine, pemetrexed, and their salts, analogs, derivatives, and combinations thereof. In one particular aspect, the antimetabolite is not 5-fluorouracil. In a particularly preferred aspect, the antimetabolite is gemcitabine or a salt thereof (e.g., gemcitabine hydrochloride). ).

[0169] Other antimetabolite anticancer agents may be selected from, but are not limited to, the group consisting of: acalciferic acid, aminothiadiazole, buquina sodium, Ciba-Geigy CGP-30694, cyclopentylcytosine, cytarabine stearate phosphate, cytarabine conjugate, Lilly DATHF, Merrel Dow DDFC, dezaguanidine, dideoxycytidine, dideoxyguanosine, didox, Yoshitomi DMDC, Wellcome EHNA, Merck & Co. EX-015, fazalabin, fludarabine phosphate, N-(2′-furanyl)-5-fluorouracil, Daiichi Seiyaku FO-152, 5-FU-fibrinogen, isopropylpyrrolizine, Lilly LY-188011; Lilly LY-264618, tolprine, Wellcome MZPES, norsemine, NCI NSC-127716, NCI NSC-264880, NCI NSC-39661, NCI NSC-612567, Warner-Lambert PALA, pentostatin, pyrithione, procainoxine, Asahi Chemical PL-AC, Takeda TAC-788, thiazoflurin, Erbamont TIF, tyrosine kinase inhibitors, Taiho UFT, and uricytin, etc.

[0170] In one respect, antimitotic anticancer agents are microtubule inhibitors or microtubule stabilizers. Generally, microtubule stabilizers, such as taxanes and epoch-forming agents, bind to the inner surface of β-microtubule chains and enhance microtubule assembly by promoting the nucleation and elongation phases of polymerization and by reducing the critical concentration of tubulin subunits required for microtubule assembly. Unlike microtubule inhibitors that hinder microtubule assembly (such as vinca alkaloids), microtubule stabilizers (such as taxanes) reduce hysteresis time and significantly shift the dynamic equilibrium between tubulin dimers and microtubule polymers toward polymerization. Therefore, in one respect, microtubule stabilizers are taxanes or epoch-forming agents. In another respect, microtubule inhibitors are vinca alkaloids.

[0171] In some embodiments, the therapeutic agent may include taxane or its derivatives or analogs. Taxane may be a naturally derived compound or related form, or it may be a chemically synthesized compound or its derivative having antitumor properties. Taxanes belong to the terpenoid family, including but not limited to paclitaxel. And Dorsey These are primarily derived from the Pacific yew (Taxus spp.) and possess activity against certain tumors, particularly breast and ovarian tumors. In one respect, taxanes are docetaxel or paclitaxel. Paclitaxel is the preferred taxane and is considered an antimitotic agent, promoting the assembly of tubulin dimers into microtubules and stabilizing microtubules by preventing depolymerization. This stability leads to inhibition of the normal dynamic reorganization of the microtubule network, which is essential for interphase and mitotic cell function.

[0172] It also includes various known taxane derivatives, including hydrophilic and hydrophobic derivatives. Taxane derivatives include, but are not limited to, galactose and mannose derivatives described in International Patent Application No. WO 99 / 18113; piperazine impurities and other derivatives described in WO 99 / 14209; taxane derivatives described in WO 99 / 09021, WO 98 / 22451, and U.S. Patent No. 5,869,680; 6-thio derivatives described in WO 98 / 28288; sulfinamide derivatives described in U.S. Patent No. 5,821,263; deoxypaclitaxel compounds, such as those described in U.S. Patent No. 5,440,056; and paclitaxel derivatives described in U.S. Patent No. 5,415,869. As mentioned above, it also includes paclitaxel prodrugs, including but not limited to those described in WO 98 / 58927; WO 98 / 13059; and U.S. Patent No. 5,824,701. Taxanes can also be taxane conjugates, such as paclitaxel-PEG, paclitaxel-glucan, paclitaxel-xylose, docetaxel-PEG, docetaxel-glucan, docetaxel-xylose, etc. Other derivatives are mentioned in references such as "Synthesis and Anticancer Activity of Taxol Derivatives," DGI Kingston et al., Studies in Organic Chemistry, vol. 26, entitled "New Trends in Natural Products Chemistry" (1986), Atta-ur-Rabman, P.W. Quesne, Eds. (Elsevier, Amsterdam 1986). Each of these references is incorporated herein by reference in its entirety.

[0173] Various taxanes can be readily prepared using techniques known to those skilled in the art (see also WO 94 / 07882, WO 94 / 07881, WO 94 / 07880, WO 94 / 07876, WO 93 / 23555, WO 93 / 10076; U.S. Patent Nos. 5,294,637; 5,283,253; 5,279,949; 5,274,137; 5,202,448; 5,200,534; 5,229,529; and EP590,267) (each of which is incorporated herein by reference in its entirety), or are available from a variety of commercial sources, including, for example, Sigma-Aldrich Co., St. Louis, Mo.

[0174] Alternatively, antimitotic anticancer agents can be microtubule inhibitors; in a preferred aspect, microtubule inhibitors are vinca alkaloids. Generally, vinca alkaloids are mitotic spindle toxins. Vinca alkaloid agents act during mitosis, when chromosomes divide and begin migrating along the tubules of the mitotic spindle towards one pole before cell separation. Under the action of these spindle toxins, the spindle becomes disordered due to the dispersion of chromosomes during mitosis, affecting cell proliferation. According to certain aspects, for example, vinca alkaloids are selected from the group consisting of vincaine, vincristine, vindesine, vinorelbine, and their salts, analogues, and derivatives.

[0175] Antimitotic anticancer agents can also be epoch-forming agents. Generally, members of the epoch-forming class of compounds stabilize microtubule function through a mechanism similar to that of taxanes. Epoch-forming agents can also cause cell cycle arrest at the G2-M transition phase, leading to cytotoxicity and ultimately apoptosis. Suitable epithiazolinones include epoch-forming agents A, B, C, D, E, and F, as well as their salts, analogs, and derivatives. A specific epoch-forming agent analog is the epoch-forming agent B analog ixaprone. TM ).

[0176] In some respects, the antimitotic anticancer agent is selected from the group consisting of taxanes, epochyam, vinca alkaloids, and their salts and combinations. Thus, for example, in one respect, the antimitotic agent is taxane. In this respect, more preferably, the antimitotic agent is paclitaxel or docetaxel, still more preferably paclitaxel. In another respect, the antimitotic agent is epochyam (e.g., epochyam B analogs). In yet another respect, the antimitotic agent is vinca alkaloids.

[0177] Examples of cancer drugs that may be used in this disclosure include, but are not limited to: thalidomide; platinum coordination complexes, such as cisplatin (cis-DDP), oxaliplatin, and carboplatin; anthraquinones, such as mitoxantrone; substituted ureas, such as hydroxyurea; methylhydrazine derivatives, such as procarbazine (N-methylhydrazine, MIH); adrenocortical inhibitors, such as mitoxantrone (o,p′-DDD) and aminoglutethimide; RXR agonists, such as bexarotin; and tyrosine kinase inhibitors, such as sunitinib, imatinib, axitinib, dasatinib, erlotinib, nilotinib, and pazopanib. Additional examples of anticancer drugs include alkylating agents, antimetabolites, natural products, hormones and antagonists, and other drugs. Alternative names are indicated in parentheses. Examples of alkylating agents include nitrogen mustards such as dichloromethyldiethylamine, cyclophosphamide, ifosfamide, melphalan (melphalan flan) and chlorambucil; ethyleneimine and methylmelamine, such as hexamethylmelamine and thiotepa; alkyl sulfonates, such as busulfan; nitrosoureas, such as carmustine (BCNU), semustine (methyl-CCNU), lomustine (CCNU) and streptozotocin (streptozomycin); DNA synthesis antagonists, such as estradiol phosphate; and triazines, such as dacarbazine (DTIC, dimethyl-triazine imidazolium carboxamide) and temozolomide. Examples of antimetabolites include folic acid analogs such as methotrexate; pyrimidine analogs such as fluorouracil (5-fluorouracil, 5-FU, SFU), fluorouridine (fluorodeoxyuridine, FUdR), cytarabine (cytosine arabinoside), and gemcitabine; purine analogs such as mercaptopurine (6-mercaptopurine, 6-MP), thioguanine (6-thioguanine, TG), and pentostatin (2′-deoxycofromycin, deoxycofromycin), cladribine, and fludarabine; and topoisomerase inhibitors such as acridine. Examples of natural products include vinca alkaloids, such as vincristine (VLB) and vinblastine; taxanes, such as paclitaxel, protein-bound paclitaxel (Abraxane), and docetaxel (Taxotere); epipodophyllotoxins, such as etoposide and teniposide; camptothecins, such as topotecan and irinotecan; antibiotics, such as dermatomycin (actinomycin D), doxorubicin (erythromycin), doxorubicin, histamine, bleomycin, mitomycin (mitomycin C), idarubicin, and epirubicin; enzymes, such as L-asparaginase; and biological response modifiers, such as interferon-α and interleukin-2.Examples of hormones and antagonists include luteinizing hormone-releasing hormone agonists, such as busherin; corticosteroids, such as prednisone and related preparations; progestins, such as hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate; estrogens, such as diethylstilbestrol and ethinylestradiol and related preparations; estrogen antagonists, such as tamoxifen and anastrozole; androgens, such as testosterone propionate and flumethasone and related preparations; androgen antagonists, such as flutamide and bicalutamide; and gonadotropin-releasing hormone analogs, such as leuprorelin. Alternative names and trade names of these and other examples of cancer drugs, as well as their methods of use (including administration and dosing regimens), will be known to those skilled in the art.

[0178] In some respects, anticancer agents can include chemotherapeutic agents. Suitable chemotherapeutic agents include, but are not limited to, alkylating agents, antibiotics, antimetabolites, hormones, plant-derived agents and their synthetic derivatives, anti-angiogenic agents, differentiation inducers, cell growth arrest inducers, apoptosis inducers, cytotoxic agents, agents that affect cellular bioenergetics (i.e., those that affect cellular ATP levels and the molecules / activities that regulate these levels), biological agents (e.g., monoclonal antibodies, kinase inhibitors, and inhibitors of growth factors and their receptors), gene therapy agents, cell therapies (e.g., stem cells), or any combination thereof.

[0179] Based on these aspects, the chemotherapeutic agents are selected from the group consisting of cyclophosphamide, chlorambucil, melphalan, dichloromethyldiethylamine, ifosfamide, busulfan, lomustine, streptozotocin, temozolomide, dacarbazine, cisplatin, carboplatin, oxaliplatin, procarbazine, uramustine, methotrexate, pemetrexed, fludarabine, cytarabine, fluorouracil, fluorouridine, gemcitabine, capecitabine, vincristine, vinorelbine, etoposide, paclitaxel, docetaxel, doxorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, bleomycin, mitomycin, hydroxyurea, topotecan, irinotecan, acridine, teniposide, erlotinib hydrochloride, and combinations thereof. Each possibility represents an independent aspect of the invention.

[0180] Depending on some aspects, therapeutic agents may include biological drugs, particularly antibodies. Depending on some aspects, antibodies may be selected from cetuximab, anti-CD24 antibodies, panitumumab, and bevacizumab.

[0181] Growth factors that can be used as therapeutic agents include, but are not limited to, transforming growth factor-α (“TGF-α”), transforming growth factor (“TGF-β”), platelet-derived growth factor (“PDGF”), fibroblast growth factor (“FGF”) (including FGF acidic isomers 1 and 2), FGF basic form 2 and FGF 4, 8, 9 and 10, and nerve growth factor (“NGF”) (including NGF... 2.5s, NGF 7.0s and βNGF and neurotrophic factors), brain-derived neurotrophic factor, chondroitin-derived factor, bone growth factor (BGF), basic fibroblast growth factor, insulin-like growth factor (IGF), vascular endothelial growth factor (VEGF), granulocyte colony-stimulating factor (G-CSF), insulin-like growth factor (IGF) I and II, hepatocyte growth factor, glial neurotrophic growth factor (GDNF), stem cell factor (SCF), keratinocyte growth factor (KGF), transforming growth factor (TGF) (including TGFα, β, β1, β2, β3), bone growth factor, bone matrix-derived growth factor and bone-derived growth factor, and mixtures thereof.

[0182] Vascular endothelial growth factor (VEGF) inhibitors that can be used as therapeutic agents include, but are not limited to, sunitinib, parzopanib, sorafenib, tivozanib, cabozantinib, bevacizumab, aflibercept, ranibizumab, dasatinib, and nilotinib.

[0183] Cytokines that can be used as therapeutic agents include, but are not limited to, cardiotrophins, stromal cell-derived factors, macrophage-derived chemokines (MDCs), melanoma growth stimulating agents (MGSA), macrophage inflammatory proteins 1α (MIP-1α), 2, 3α, 3β, 4 and 5, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, TNF-α, and TNF-β. Immunoglobulins that can be used in this disclosure include, but are not limited to, IgG, IgA, IgM, IgD, IgE, and mixtures thereof. Some preferred growth factors include VEGF (vascular endothelial growth factor), NGF (nerve growth factor), PDGF-AA, PDGF-BB, PDGF-AB, FGFb, FGFa, and BGF.

[0184] Other molecules that can be used as therapeutic agents include, but are not limited to, growth hormone, leptin, leukemia inhibitory factor (LIF), tumor necrosis factor α and β, endostatin, thromboretin, osteoblast-1, bone morphogenetic protein 2 and 7, osteonectin, somatostatin-like peptide, osteocalcin, interferon α, interferon αA, interferon β, interferon γ, interferon 1α, and interleukins 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18.

[0185] Diagnostic agents include gases; metals; commercially available imaging agents for positron emission tomography (PET), computed tomography (CAT), single-photon emission computed tomography, X-ray, fluoroscopy, and magnetic resonance imaging (MRI); and contrast agents. Examples of suitable materials for use as contrast agents in MRI include gadolinium chelates, as well as iron, magnesium, manganese, copper, and chromium. Examples of materials that can be used for CAT and X-ray imaging include iodine-based materials.

[0186] Treatment and preventative medicines include, but are not limited to, antibiotics, nutritional supplements, and vaccines. Vaccines may include isolated proteins or peptides, inactivated organisms and viruses, dead organisms and viruses, genetically modified organisms or viruses, cell extracts, and RNA encoding at least one antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to the antigenic polypeptide). Treatment and preventative medicines may be used in combination with interleukins, interferons, cytokines, and adjuvants (such as cholera toxin, alum, Freund's adjuvant, etc.). Prophylactic agents may include antigens of bacterial organisms such as Streptococcus pneumoniae, Haemophilus influenzae, Staphylococcus aureus, Streptococcus pyogenes, Corynebacterium diphtheriae, Listeria monocytogenes, Bacillus anthracis, Clostridium tetani, Clostridium perfringens, Neisseria meningitidis, Neisseria gonorrhoeae, Streptococcus mutans, Pseudomonas aeruginosa, Salmonella typhi, Haemophilus parainfluenzae, Bordetella pertussis, Tulafrancella, Yersinia pestis, Vibrio cholerae, and others. Legionella pneumoniae, Mycobacterium tuberculosis, Mycobacterium leprae, Treponema pallidum, Leptospira question mark, Borrelia burgdorferi, Campylobacter jejuni, etc.; viral antigens, such as human metapneumovirus (hMPV), human parainfluenza virus (hPIV) types 1, 2, and 3 (hPIV1, hPIV2, and hPIV3, respectively), respiratory syncytial virus (RSV), measles virus (MeV), coronaviruses (e.g., MERS-CoV, SARS-CoV, SARS-CoV2, etc.). HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, HCoV-HKU1), poxviruses (e.g., smallpox, monkeypox), African swine fever virus, influenza A and B, HIV, varicella-zoster virus, herpes simplex virus 1 and 2, cytomegalovirus, Epstein-Barr virus, rotavirus, rhinovirus, adenovirus, human papillomavirus, poliovirus, mumps, rabies, rubella. Coxsackievirus, equine encephalitis, Japanese encephalitis, yellow fever, Rift Valley fever, hepatitis A, B, C, D, and E viruses, etc.; antigens of fungi, protozoa, and parasites, such as Cryptococcus neoformans, Histoplasma capsulatum, Candida albicans, Candida tropicalis, Nocardia asteroides, Rickettsia rickettsiae, Rickettsia typhus, Mycoplasma pneumoniae, Chlamydia psittaci, Chlamydia trachomatis, Plasmodium falciparum, Trypanosoma brucei, Entamoeba histolytica, Toxoplasma gondii, Trichomonas vaginalis, Schistosoma mansoni, etc. These antigens can be in the form of whole, killed organisms, peptides, proteins, glycoproteins, carbohydrates, or combinations thereof.

[0187] This article also describes methods for inducing cytotoxicity in cancer cells, including contacting the cells with the pharmaceutical compositions described herein.

[0188] This document also describes a method for producing lipid nanoparticle clusters encapsulating an active agent, the method comprising: (a) mixing one or more ethanol solutions containing a lipid mixture with an aqueous solution and acidifying to induce the formation of empty lipid nanoparticle clusters; (b) contacting the empty lipid nanoparticle clusters with an aqueous solution containing an active agent to encapsulate the active agent within the empty lipid nanoparticle clusters to produce the lipid nanoparticle clusters encapsulated with the active agent; and (c) subjecting the lipid nanoparticle clusters encapsulated with the active agent to tangential flow filtration to replace the buffer and remove residual ethanol. In some embodiments, the lipid mixture comprises 2.5 mol% to 15 mol% of one or more cationic lipids; 30 mol% to 50 mol% of one or more ionizable lipids; 30 mol% to 65 mol% of one or more neutral lipids; and 2.5 mol% to 15 mol% of one or more PEGylated lipids. In some embodiments, the active agent comprises RX-0201, 5′gctgcatgatctccttggcg 3′, SEQ.ID.NO.1. In some embodiments, RX-0201 is an antisense oligonucleotide. In some embodiments, RX-0201 has at least one modified internucleotide bond, namely a phosphate-thiophosphate bond. In some embodiments, the lipid nanoparticles comprise DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG. In some embodiments, the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG in the lipid nanoparticles are present in a molar ratio of 5:40:25:20:10 (DOTAP:DODMA:DOPC:cholesterol:DMG-PEG), 5:40:27.5:20:7.5 (DOTAP:DODMA:DOPC:cholesterol:DMG-PEG), or 5:40:30:20:5 (DOTAP:DODMA:DOPC:cholesterol:DMG-PEG). In some embodiments, the lipid nanoparticles and the active agent are present in a weight ratio of lipid nanoparticles to active agent of 5:1 to 20:1, 7.5:1 to 15:1, 7.5:1 to 10:1, 7.5:1 to 12:1, 10:1 to 12:1, 10.1 to 15:1, or 12:1 to 15:1. In some embodiments, the lipid nanoparticle group has an average particle size of 50 nm to 80 nm, 55 nm to 75 nm, or 55 nm to 60 nm as determined by dynamic light scattering. In some embodiments, the lipid nanoparticle group has an average zeta potential of -0.6 mV to 2.5 mV.In some embodiments, the lipid nanoparticle group has a polydispersity index (PDI) of 0.15 to 0.5, 0.15 to 0.4, 0.15 to 0.3, 0.15 to 0.2, 0.2 to 0.3, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 0.4, 0.3 to 0.5, or 0.4 to 0.5. Example

[0189] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention in any way.

[0190] Example 1: Antitumor and antiangiogenic effects of lipid nanoparticle suspension of AKT-1 antisense oligonucleotide

[0191] AKT-1 plays a crucial role in cancer progression by promoting cell proliferation and inhibiting apoptosis (see Revathidevi S, et al., Semin Cancer Biol. 2019; 59:80-91; and Uko NE, et al., Curr TopMed Chem. 2020; 20(10):883-900). Inhibition of AKT has been shown to suppress tumor growth and angiogenesis (see Nitulescu GM, et al., Int J Oncol. 2016; 48(3):869-85). Archexin is a fully thiolated 20-meric antisense oligonucleotide that specifically binds to AKT-1 mRNA, leading to RNase H-based downregulation of AKT-1. WGI-0301 is a proprietary lipid nanoparticle (LNP) formulation of Archexin designed to enhance delivery. Recently, a Phase I clinical trial of WGI-0301 in solid tumors has been initiated.

[0192] The in vivo antitumor efficacy of WGI-0301 was investigated in a Hepa1-6 syngeneic mouse model of hepatocellular carcinoma (HCC). Mice were intravenously injected with either the vector control or WGI-0301 at a dose of 8 mg / kg once weekly for a total of 4 doses (n=8). Tumor size and body weight changes were monitored daily. In addition, the anti-angiogenic activity of WGI-0301 was investigated in vitro using human umbilical vein endothelial cells (HUVECs) (see DeCicco-Skinner KL, et al., J Vis Exp. 2014 Sep 1; (91):e51312; and Arnaoutova I, et al., Nat Protoc. 2010; 5(4):628-35). In this study, the combined use of WGI-0301 with lenvatinib or sorafenib was investigated to determine potential synergistic effects. Three experimental groups were established, including WGI-0301 (0, 0.2, 2, and 20 μM), WGI-0301 + 2 μM sorafenib, and WGI-0301 + 5 μM lenvatinib. Cells were grown at a density of 1.5 × 10⁶ cells per well. 4 Cells were seeded at a specific density. They were treated with 50% Matrigel, then cultured three times in 24-well plates, followed by incubation for 6 hours each time.

[0193] In vivo studies demonstrated the antitumor efficacy of WGI-0301 in the Hepa1-6 model. The tumor growth inhibition rate (TGI) of WGI-0301 was 46.16%, and the median survival (MST) in the treatment group was 55 days, significantly different from the control group (37 days). No serious adverse events were observed during the study. In in vitro anti-angiogenic studies, WGI-0301, alone or in combination with 2 μM sorafenib and 5 μM lenvatinib, exhibited dose-dependent inhibition of angiogenesis. Compared with the control group, 20 μM WGI-0301, alone or in combination with 2 μM sorafenib and 5 μM lenvatinib, significantly inhibited angiogenesis. The combination of 2 μM WGI-0301 and 5 μM lenvatinib also showed significant inhibition of angiogenesis. Results are as follows... Figures 1A-3C As shown.

[0194] Whether used as monotherapy or in combination with other drugs, particularly with 5 μM lenvatinib, WGI-0301 exhibited dose-dependent inhibition of angiogenesis, suggesting that angiogenesis inhibition may be a key mechanism of its antitumor activity. Furthermore, the combination therapy of WGI-0301 and lenvatinib demonstrated high efficacy.

[0195] The results showed that WGI-0301 exhibited significant antitumor and anti-angiogenic effects in a Hepa1-6 syngeneic mouse model of HCC. Furthermore, compared to WGI-0301 monotherapy, combination therapy with sorafenib or lenvatinib produced greater anti-angiogenic activity. These findings suggest that WGI-0301 is a selective AKT-1 inhibitor.

[0196] Example 2: WGI-0301 lipid nanoparticles

[0197] The active pharmaceutical ingredient (API) is the antisense oligonucleotide Archexin (RX-0201), developed by Rexahn Pharmaceuticals (Rockville, MD). The drug, WGI-0301, is manufactured as a lyophilized powder. Following preclinical and clinical trials, RX-0201 demonstrated good antitumor activity and tolerability. RX-0201 also achieved early success in Phase II trials for renal cell carcinoma and pancreatic cancer. However, RX-0201 is limited by the inherent challenges of antisense oligonucleotides due to its poor membrane permeability and in vivo stability, as well as the further requirement for a 14-day continuous infusion dosing regimen.

[0198] To further improve the in vivo delivery and therapeutic performance of RX-0201, Zhejiang HCBio Biotechnology Co., Ltd. developed RX-0201 as a lipid nanoparticle (LNP) suspension formulation (WGI-0301). As an LNP formulation, WGI-0301 utilizes a combination of quaternary and tertiary fatty amines, delivered pH-sensitively along with other neutral and stable lipids. WGI-0301 is considered a promising candidate for the treatment of hepatocellular carcinoma. A detailed ingredient list for the clinical batch is provided in the table below.

[0199] Table 1. Components of WGI-0301 Note: 1. DOTAP is a cationic lipid, and its full chemical name is 1,2-dioleoyl-3-trimethylammonium propane. 2. DODMA is an ionizable lipid, with the full chemical name 1,2-dienoxy-3-dimethylaminopropane. 3. DOPC is a neutral lipid, and its full chemical name is 1,2-dioleoyl-sn-glycerol-3-phosphocholine. 4. DMG-PEG2000 is a PEGylated lipid, with the full chemical name 1,2-dimyristoyl-rac-glycerol-3-methylpolyoxyethylene 2000. 5. During process preparation, sucrose, ammonium chloride, acetic acid, sodium hydroxide, and ethanol will be removed. LNP is suspended in a 0.9% sodium chloride solution.

[0200] Because the aqueous form of RX-0201 is not stable for storage at 2-8°C, the recommended long-term storage temperature for WGI-0301 is -20°C, and it should be thawed before use. WGI-0301 is provided in the form of 6.573 mg Archexin free acid per 7 mL (equivalent to 7.0 mg Archexin / RX-0201) to meet clinical needs. Based on HCBio's established experience, different formulations have been developed and studied. These formulations have been studied according to CQA and efficacy to screen for suitable formulations and formulation processes.

[0201] Table 2. WGI-0301 Critical Quality Attributes (CQA)

[0202] Archexin (RX-0201) 5'-GCTGC ATGAT CTCCT TGGCG-3' SEQ ID NO.1, Pharmacological category: phosphoric acid oligonucleotide, length 20 nucleotides, molecular formula: C 194 H 247 N 70 O 103 P 19 S 19 Na 19 Physicochemical properties: RX-0201 is a white lyophilized powder. It has no special odor; it is hygroscopic and readily soluble in water. It is unstable at high temperatures and sensitive to light and oxidation. Aqueous solutions will degrade upon prolonged storage at 4°C. The stability of aqueous solutions is highly pH-dependent; RX-0201 degrades more rapidly at lower pH conditions.

[0203] Chemical structure:

[0204] Based on experimental data on drug-influencing factors, different excipients were studied, and the compatibility between APIs and excipients was investigated and evaluated.

[0205] Auxiliary material selection

[0206] (1) Cationic lipids and ionizable lipids

[0207] Permanently ionized lipids (e.g., lipids with quaternary ammonium moieties) and conditionally ionized lipids (e.g., lipids with tertiary amine moieties) have been widely used in LNP formulations for the delivery of nucleic acid drugs.

[0208] Tetravalent cationic lipids, such as DOTAP-Cl, carry a permanent positive charge, and their cationic properties remain unchanged under different pH conditions. Quaternary ammonium cationic lipids are widely used in the formulation of LNP gene delivery systems. Their high charge density helps to aggregate large nucleic acid drugs into stable nanoscale complexes. However, their positive charge can also interact with blood components, leading to potential toxicity.

[0209] On the other hand, ionizable lipids, such as DODMA, are mostly uncharged at neutral pH and only become positively charged under acidic conditions. When DODMA is incorporated into LNP formulations, it becomes charged after LNP endocytosis, which subsequently promotes the escape of encapsulated gene material loaded in LNPs under the low pH conditions of late endonosomes or lysosomes.

[0210] This design leverages the high charge density offered by quaternary fatty amines (DOTAP-Cl) and the pH-responsiveness of conditionally ionizable tertiary fatty amines (DODMA) to achieve an optimal balance between charge and endosome escape in oligonucleotide delivery. DOTAP-Cl also contributes to the structural stability of LNPs under physiological pH conditions: the permanently positively charged DOTAP-Cl interacts better with the negatively charged oligonucleotides, resulting in a relatively smaller nanoparticle size compared to nanoparticles containing only tertiary fatty amines. Under acidic conditions, such as late endosomes or lysosomes, the ionization of DODMA promotes electrostatic interactions between cationic lipids and the endosome anion membrane, leading to exocytosis and facilitating the escape of oligonucleotides into the cytoplasm. In this study, commercially available DOTAP-Cl and DODMA were selected as the cationic lipids for the WGI-0301 product formulation.

[0211] (2) PEGylated lipids and neutral lipids

[0212] PEGylated lipids are widely used in nanoparticle delivery systems. Cationic lipids interact nonspecifically with charged components in serum via electrostatic interactions, allowing them to be readily recognized and eliminated by mononuclear phagocytic systems. PEGylated lipids can impart LNP stealth properties, reduce nonspecific interactions with negatively charged serum components, inhibit drug uptake by the reticuloendothelial system (RES), and thus prolong the drug's half-life in plasma. Furthermore, PEGylated lipids can enhance formulation stability by reducing interactions with nucleases and improving overall colloidal stability.

[0213] However, the presence of the PEG layer spatially hinders the interaction between LNPs and cell membranes, leading to reduced cellular uptake and inhibiting the interaction of LNPs with endosomes and lysosomal membranes. Therefore, while PEGylated lipids are necessary for improving formulation stability and blood circulation time, they need to be rapidly released from LNPs after nanoparticles reach the target organ to increase cellular internalization and promote endosome escape. Thus, timely release of PEGylated lipids from LNPs is crucial. Numerous studies have shown that the duration of PEGylated lipid attachment to LNPs depends on the length of the PEGylated lipid fatty acid chain. Due to stronger intermolecular forces, long-chain PEGylated lipids (such as PEG-C20) cannot be easily released from LNPs, resulting in greater LNP stability and circulation time. Short-chain PEGylated lipids (such as PEG-C8) can be easily removed from nanoparticles. The length of the PEGylated lipid chain is not related to the ability of LNPs to accumulate at tumor sites. PEGylated lipids have been reported to have a strong immune response. Compared to LNPs with shorter fatty acid chains (e.g., PEG-s-DMG or PEG-CerC14), LNPs with longer fatty acid chains (e.g., PEG-DSPE, PEG-s-DSG) have a faster clearance rate.

[0214] Based on the principle of LNP delivery, three different LNP formulations were prepared. Formulation 1: DOTAP-Cl, DODMA, DOPC, cholesterol, and DMG-PEG 2000; Formulation 2: DOTAP-Cl, DODMA, DSPC, cholesterol, and DMG-PEG 2000; Formulation 3: DOTAP-Cl, DODMA, DOPC, cholesterol, and DSPE-PEG 2000. The particle size of the API-loaded LNPs was used as the screening criterion for formulations. The designs of the different formulations are shown in the table below.

[0215] Table 3. Design of LNP formulations Note: This formulation also includes lipid acidification using ammonium chloride and glacial acetic acid, sucrose as an osmotic pressure regulator, NaOH as a pH regulator, anhydrous ethanol as a lipid solubilizer, and water for injection as a solvent. The above components are present in the same amounts in all three formulations, therefore they will not be discussed in this report.

[0216] Table 4. Formulation screening of LNP formulations

[0217] As shown in the table above, formulation 1 has the smallest particle size at 47.53 nm, formulation 3 has a particle size of 67.19 nm, and formulation 2 has the largest particle size at 123.1 nm and the largest PDI value at 0.807.

[0218] Smaller particle sizes (<100 nm) of API-loaded LNPs are more likely to enter target tissues, such as tumors, than larger particles. DMG-PEG2000 with PEG-C14 tends to loosen the PEG layer that shields the positive charge more quickly than PEG layers with longer fatty acid chains. They accumulate in the largest quantities in organs of the reticuloendothelial system, especially the liver. WGI-0301 aims to develop a potential therapeutic approach for hepatocellular carcinoma, therefore DMG-PEG 2000 was chosen as the PEGylated lipid.

[0219] Neutral lipids such as DOPC and DOPE are used as bilayer-forming lipids for LNPs due to their low cytotoxicity and immunogenicity. The biophysical properties of neutral lipids (such as DOPC and DOPE) are pH-independent, but this limits the ability of LNPs to load and deliver negatively charged oligonucleotide drugs. Based on the formulation screening results above, DOPC was selected as the neutral lipid for our LNP formulation.

[0220] Cholesterol is a neutral lipid that acts as a regulator of membrane fluidity and plays an important role in lipid self-assembly and the stability of LNPs.

[0221] Excipients should be selected based on the route of administration.

[0222] 1,2-Dioleoyl-3-trimethylammonium chloride propane (DOTAP-Cl), 1,2-dioleoyloxy-3-dimethylaminopropane (DODMA), 1,2-diol acyl-sn-glycerol-3-phosphocholine (DOPC), cholesterol (CHOL), 1,2-dimyristoyl rac-glycerol-3-methylpolyoxyethylene 2000 (DMG-PEG 2000), sucrose, ammonium chloride, glacial acetic acid, sodium hydroxide, and sodium chloride were used to manufacture clinical batches of WGI-0301.

[0223] DOTAP-Cl and DODMA provide positive charge balance and interact with anionic oligonucleotides. DOPC is used as a lipid to form the bilayer. Cholesterol is a lipid regulator of membrane fluidity, increasing membrane stiffness and providing stability. DMG-PEG 2000 was chosen as the lipid to reduce off-target uptake and immunogenicity and promote circulation time. Sucrose and sodium chloride are osmolarity regulators. Ammonium chloride and glacial acetic acid are lipid acidifiers used for protonation of DODMA. NaOH is used to adjust the pH.

[0224] preparation

[0225] This design leverages the high charge density provided by cationic quaternary fatty amines (DOTAP-Cl) and the pH responsiveness of conditionally ionizable tertiary fatty amines (DODMA) to achieve an optimal balance between charge and endosome escape in oligonucleotide delivery. DOTAP-Cl also contributes to the structural stability of LNPs under physiological pH conditions: the permanently positively charged DOTAP-Cl interacts better with the negatively charged oligonucleotides, resulting in relatively smaller nanoparticle sizes compared to nanoparticles containing only tertiary fatty amines. DOPC is used as a lipid to form the bilayer. Cholesterol is a lipid regulator of membrane fluidity, increasing membrane stiffness and providing stability. DMG-PEG 2000 was chosen as the lipid to reduce off-target uptake and immunogenicity and promote circulation time. Sucrose acts as an osmolar regulator. Ammonium chloride and glacial acetic acid are used as lipid acidifiers to protonate DODMA to interact with APIs under low pH conditions. After the formation of the electrostatic complex, the pH is raised to physiological pH using NaOH as a pH regulator. The buffer system is then replaced with a 0.9% NaCl solution via tangential flow filtration.

[0226] Determination of lipid molar ratio

[0227] Several different formulations were screened to determine the optimal ratio of lipid components. The molar ratios of the formulations are as follows:

[0228] Formulation 1: DOTAP / DODMA / DOPC / cholesterol / DMG-PEG = 5 / 40 / 27.5 / 20 / 7.5;

[0229] Formulation 2: DOTAP / DODMA / DOPC / cholesterol / DMG-PEG = 5 / 40 / 25 / 20 / 10;

[0230] Formulation 3: DOTAP / DODMA / DOPC / cholesterol / DMG-PEG = 5 / 40 / 30 / 20 / 5.

[0231] The particle size and zeta potential of LNP were determined. The molar ratio of lipids was confirmed by HPLC-ELSD. The formulation design is shown in the table below:

[0232] Table 5 LNP Formulation Design Note: This formulation also includes the use of ammonium chloride and glacial acetic acid as lipid acidifying agents, sucrose as an osmotic pressure regulator, NaOH as a pH regulator, and anhydrous ethanol and water for injection as solvents. The content of each component is the same in all three formulations, and this will not be discussed in this section of the report.

[0233] Table 6 Physicochemical properties of different LNP formulations

[0234] The results showed that the DOTAP / DODMA / DOPC / cholesterol / DMG-PEG formulation with a molar ratio of 5 / 40 / 27.5 / 20 / 7.5 had the smallest particle size and PDI, with a particle size of 47.53 nm and a PDI of 0.234. Smaller LNP particles are more likely to penetrate porous target tissues, such as tumors. Therefore, the optimal lipid molar ratio was set at 5 / 40 / 27.5 / 20 / 7.5.

[0235] Confirmation of lipid ratio

[0236] Based on the lipid and molar ratios selected in previous studies, four formulations with different lipid:drug ratios were designed. The formulations were selected based on their CQA (Critical Quality Assurance) and efficacy in pharmacological animal studies. The composition and analytical results of the formulations are shown in the table below:

[0237] Table 7. Formulation design for different LNP:API ratios Note: This formulation also includes anhydrous ethanol, water for injection as a solvent, and pH 7.4 PBS as an alternative buffer. The amounts of these components are the same in all formulations, so they will not be discussed in detail here.

[0238] Table 8. Physicochemical properties of formulations with different LNP:API ratios

[0239] The results showed that the smallest particle size was achieved when the lipid:drug (w / w) ratio was 7.5:1. Smaller LNP particles are more likely to enter porous target tissues, such as tumors. Therefore, the optimal lipid:drug (w / w) ratio was set at 7.5:1.

[0240] Pharmacodynamic studies: WGI-0301 (formerly RX-0301) consists of different lipid:drug (w / w) ratios and was administered at a dose level of 8 mg / kg (8 mg / kg represents Archexin, equivalent to 7.5 mg / kg of Archexin free acid) to evaluate its antitumor effects in a C57BL / 6 mouse syngeneic Hepa1-6 model.

[0241] Statistical analysis of tumor growth inhibition

[0242] Table 9. Antitumor effects of the Hepa1-6 syngeneic mouse model.

[0243] Table 10 Comparison of tumor volume differences on day 34

[0244] After 34 days of administration (QW x 4 weeks), the mean tumor volume (MTV) of the negative control was 2045.44 mm. 3 The MTV of the WGI-0301 control group (15:1; excluding RX-0201) (8 mg / kg) was 1417.07 mm. 3 The TGI (%) was 31%, which was not statistically significant compared with the negative control group (p = 0.300). The MTV of the RX-0201 (8 mg / kg) control group was 1676.36 mm. 3 The TGI (%) was 18%, which was not statistically significant compared with the negative control group (p = 0.419). The MTV in the WGI-0301 (15:1) (8 mg / kg) treatment group was 1500.58 mm. 3 The TGI (%) was 27%, which was not statistically significant compared with the negative control group (p = 0.300). The MTV in the WGI-0301 (12:1) (8 mg / kg) treatment group was 1027.11 mm. 3 The TGI (%) was 50%, which was statistically significant compared with the negative control group (p = 0.041). The MTV in the WGI-0301 (10:1) (8 mg / kg) treatment group was 1260.48 mm. 3 The TGI (%) was 38%, which was not statistically significant compared with the negative control group (p = 0.156). The MTV in the WGI-0301 (7.5:1) (8 mg / kg) treatment group was 545.46 mm. 3 The TGI (%) was 73%, which was statistically significant compared with the negative control group (p = 0.007). The results indicate that WGI-0301 (12:1) and WGI-0301 (7.5:1) have significant antitumor effects on the syngeneic Hepa1-6 model in C57BL / 6 mice.

[0245] Survival Analysis

[0246] Table 11. Survival analysis for each group.

[0247] Table 12. Comparative analysis of survival time between each pair of groups (p-value).

[0248] Survival analysis showed no significant difference in MST between WGI-0301 (15:1), WGI-0301 (12:1), and WGI-0301 (10:1) and the RX-0201 control. Compared to the RX-0201 control, WGI-0301 (15:1), and WGI-0301 (12:1), WGI-0301 (7.5:1) exhibited significantly longer survival. Overall, a lipid:drug ratio of 7.5:1 was selected in this study.

[0249] Manufacturing process

[0250] This product is an injectable suspension. The preparation process includes API solution preparation, empty LNP preparation, drug loading, pH titration, tangential flow filtration, aseptic filtration, filling, capping and sealing, packaging, and freezing. The ethanol dilution method is used to prepare the LNP. An ethanol lipid solution containing cationic lipids (DOTAP-Cl, DODMA), bilayer-forming lipids (DOPC), PEGylated lipids (DMG-PEG 2000), and cholesterol is mixed and acidified to approximately pH 4.0. Then, empty LNPs and oligonucleotide aqueous solutions are rapidly mixed at a 1:1 (v / v) lipid:drug ratio to prepare the LNP, which also brings the pH to the physiological range. Tangential flow filtration is used instead of buffer solution to remove ethanol and stabilize the LNP. High-throughput controlled microfluidics technology is used to obtain high-quality, nanoscale, and stable LNPs.

[0251] The advantage of microfluidic technology in the preparation of liquid nitrogen compounds (LNPs) lies in the higher encapsulation efficiency and smaller particle size, enabling rapid scaling up of LNP production from laboratory scale to GMP production scale. Microfluidic technology is a continuous, online process for LNP preparation. One advantage of this technology is that the formulation composition and proportions, equipment, or process parameters remain unchanged from laboratory scale to laboratory-scale, pilot-scale, and GMP production scale. Furthermore, the key quality parameters of the drug do not show significant changes, indicating the stability of the process.

[0252] The manufacturing process for empty LNPs used in non-clinical studies is similar to that of WGI-0301, except that a 20% sucrose solution is used instead of an API solution. Figure 4 A schematic diagram of the manufacturing process is shown.

[0253] Solution preparation

[0254] Preparation of 50mM ammonium chloride / 50mM glacial acetic acid solution: Weigh 18.72g of glacial acetic acid, dissolve it in an appropriate amount of water for injection, mix the solutions, and then ultrafilter them using an ultrafiltration membrane to remove bacterial endotoxins.

[0255] Preparation of 20% (w / v) sucrose solution: Weigh 1600g of sucrose, dissolve it in an appropriate amount of water for injection, mix well, and remove bacterial endotoxins by ultrafiltration using an ultrafiltration membrane.

[0256] Preparation of API solution (RX-0201 in 0.9% sucrose): Weigh 10.50 g RX-0201 and 5698 g of 20% sucrose solution from step #1.2, mix and obtain 1.88 mg / mL Archexin free acid (API solution).

[0257] Preparation of 0.9% (w / w) sodium chloride solution: Weigh 450g of solid chloride, dissolve it in an appropriate amount of water for injection, mix well, and remove bacterial endotoxins by ultrafiltration using an ultrafiltration membrane.

[0258] Preparation of 1M sodium hydroxide (NaOH) solution: Weigh 20.0g of sodium hydroxide and dissolve it in an appropriate amount of water for injection.

[0259] Preparation of lipid solution: Weigh 3.84g DOTAP-Cl, 27.21g DODMA, 23.72g DOPC, 8.50g cholesterol and 20.74g DMG-PEG 2000 (molar ratio = 5:40:27.5:20:7.5), dissolve the lipids in 798.50g anhydrous ethanol, mix with a magnetic stirrer in a 40℃ water bath, and filter the lipid solution through a 0.45μm PVDF syringe filter.

[0260] Preparation of empty lipid nanoparticles

[0261] Connect the tubing to the SY03 syringe pump system and flush the tubing to the SY03 syringe pump system with 0.1M sodium hydroxide solution. Connect the inlet ends of pumps #1 and #2 to water for injection. Flush the SY03 syringe pump system with water for injection until the pH is neutral. Drain the water for injection; turn off the SY03 syringe pump system. Set the water bath temperature of the heated magnetic stirrer (DF-101T; #1) to 40°C. Preheat 4200 g (4.2 L) of ammonium chloride / glacial acetic acid solution in a 5 L screw-cap reagent bottle to 40°C (acceptable temperature range: 38-42°C) with magnetic stirring. Set the water bath temperature of the heated magnetic stirrer (DF-101T; #2) to 40°C. Preheat 846.21 g (1.05 L) of filtered lipid solution in a 1 L screw-cap reagent bottle to 40°C (acceptable temperature range: 38-42°C) with magnetic stirring. Set the water bath temperature of the heated magnetic stirrer (DF-101T; #3) to 40°C. Preheat a 5L screw-cap reagent bottle in the water bath with magnetic stirring. Connect the inlet of pump #1 to the preheated 40°C ammonium chloride / glacial acetic acid solution; connect the inlet of pump #2 to the preheated 40°C lipid solution. Place a stainless steel needle (16G; 1.19mm; 300mm) into the preheated 5L screw-cap reagent bottle in the 40°C water bath. Turn on the SY03 syringe pump system to prepare empty lipid nanoparticles. Receive the empty lipid nanoparticle solution using the preheated 5L screw-cap reagent bottle. After preparing the empty lipid nanoparticles, continue stirring the empty lipid nanoparticle solution at 40°C for 15 minutes.

[0262] Preparation of WGI-0301 lipid nanoparticles

[0263] Set the water bath temperature of the heated magnetic stirrer (DF-101T; #2) to 40°C. Preheat 5.25 LRX-0201 solution (in a 5 L screw-cap reagent bottle) to 40°C (acceptable temperature range: 38-42°C) with magnetic stirring. Transfer the 5 L screw-cap reagent bottle containing the blank lipid nanoparticle solution from stirrer #3 (DF-101T; #3) to stirrer #2 (DF-100T; #2) with magnetic stirring. Set the water bath temperature of the heated magnetic stirrer (DF-101T; #3) to 40°C. Preheat a 10 L empty screw-cap reagent bottle in a 40°C water bath with magnetic stirring. Connect the SY03 fuel injection pump system piping. Connect the inlet of pump #1 to the preheated (40°C) RX-0201 solution; connect the inlet of pump #2 to the preheated (40°C) empty lipid nanoparticle solution. Connect the two ends of the bifurcated extension to the outlets of two 25 mL syringes, respectively; connect the bifurcated extension head to the stainless steel syringe. Place the stainless steel syringe head (16G; 1.19 mm; 510 mm) into a preheated 10 L screw-cap reagent bottle. Turn on the SY03 syringe pump system to prepare WGI-0301 lipid nanoparticles. Receive the WGI-0301 lipid nanoparticle solution using the preheated 10 L screw-cap reagent bottle. After preparation, stir the WGI-0301 lipid nanoparticle solution at 40 °C for 15 minutes.

[0264] Place the crude WGI-0301 solution in a cold water bath and cool the solution to room temperature (15-25℃). Using a magnetic stirrer, add 1M sodium hydroxide (NaOH) solution to the WGI-0301 solution for pH titration until the pH value reaches 7.0-7.4.

[0265] Set up a tangential flow filtration (TFF) system. Pretreat the new hollow fiber column filter: first rinse with water, then rinse repeatedly with 0.2M NaOH solution for 60 minutes. Afterward, rinse with sterile water for injection until the pH of the rinse water becomes neutral. Use the pretreated hollow fiber column filter as the tangential flow filtration device, and use 0.9% NaCl solution as the tangential flow replacement solution to replace the suspension medium of WGI-0301 with 0.9% NaCl solution. Perform tangential flow filtration until 25000g of 0.9% NaCl solution is consumed. Then, pump the replenished 0.9% NaCl solution into the hollow fiber column filter, flushing the remaining WGI-0301 solution in the column into a 10L screw-cap reagent bottle. Sample and test the concentration of WGI-0301 solution.

[0266] The crude WGI-0301 solution was diluted with 0.9% sodium chloride solution to obtain a final WGI-0301 solution with the desired API concentration. The WGI-0301 solution was filtered into Merck Millipore aseptic bags through two 0.22 μm PVDF sterile filters. The bags were heat-sterilized at 121 °C for 30 minutes. The vials were machine-washed and sterilized in a tunnel drying oven (330 ± 15 °C, ≤55 vials / min). Under laminar flow conditions, WGI-0301 was filled into 10 mL medium borosilicate glass vials in RABS, the filled vials were purged with nitrogen, and then plugged.

[0267] Lipid concentration screening

[0268] In the process optimization of empty LNP formulation, total lipid concentrations of 150 mg / mL, 75 mg / mL, and 37.5 mg / mL were tested. A SY03 infusion pump system was used to prepare empty LNPs and API-loaded LNPs, with a lipid:drug ratio (w / w) of 7.5:1. The pH was then titrated to physiological pH using 1M NaOH solution. Suitable lipid concentrations were screened based on particle size distribution as acceptance criteria. The experimental design and results are shown in the table below.

[0269] Table 13. Process optimization for the preparation of empty LNPs.

[0270] The effects of lipid concentration on particle size distribution and PDI were screened using different lipid concentrations (150 mg / mL, 75 mg / mL, and 37.5 mg / mL) in the empty LNP, drug loading, and pH titration steps. The results showed that the particle size of the empty LNP decreased with decreasing lipid concentration. At a lipid concentration of 150 mg / mL, the particle size decreased during the drug loading and titration steps due to greater electrostatic interactions. However, at lipid concentrations of 75 mg / mL and 37.5 mg / mL, the particle size increased after the drug loading and titration steps, particularly for the 37.5 mg / mL lipid concentration group, where the particle size increased from 35.87 nm to 65.28 nm, demonstrating its instability. In conclusion, the final particle size was smallest and most stable at a lipid concentration of 75 mg / mL. Therefore, a lipid concentration of 75 mg / mL was selected.

[0271] Concentration screening of ammonium chloride / glacial acetic acid for lipid acidification

[0272] In optimizing the preparation of empty LNPs, 25mM / 25mM, 50mM / 50mM, and 100mM / 100mM ammonium chloride / glacial acetic acid solutions were investigated. A SY03 infusion pump system was used to prepare both empty LNPs and API-loaded LNPs, with a lipid:drug ratio (w / w) of 7.5:1. The pH was then titrated to physiological pH using 1M NaOH solution. Suitable lipid concentrations were screened based on particle size distribution as acceptance criteria. The experimental design and results are shown in the table below.

[0273] Table 14. Screening of buffer concentrations used for lipid acidification.

[0274] The pKa of the cationic lipid DODMA is 6 to 7. The lipid is completely ionized at acidic pH. Empty LNPs were formed after acidifying the lipid solution with 25 mM / 25 mM, 50 mM / 50 mM, and 100 mM / 100 mM ammonium chloride / glacial acetic acid solutions at pH values ​​of 4.556, 4.197, and 3.814, respectively. It is known from the literature that DODMA binds best to oligonucleotides when the oligonucleotides are completely ionized. At pH 4.556, DODMA was not sufficiently ionized, while it was completely ionized at pH 4.197 and pH 3.814. Particle size distribution results showed that when the ammonium chloride / glacial acetic acid solution was 50 mM / 50 mM, the particle size was much smaller than that of 25 mM / 25 mM and 100 mM / 100 mM solutions. Small LNPs are more likely to enter target tissues such as tumors, therefore 50mM / 50mM ammonium chloride / glacial acetic acid was chosen as the concentration of the ammonium chloride / cold acetic acid solution.

[0275] Screening of organic water

[0276] In the optimization process of empty LNP preparation, the following ratios of lipid solution (organic phase) and ammonium chloride / glacial acetic acid solution (aqueous phase) were selected: 1:8, 1:4, and 1:2. Empty LNPs were prepared using a SY03 syringe pump system. Particle size distribution was used as a criterion for screening suitable organic-aqueous phase ratios (v / v). The experimental design and results are shown in the table below:

[0277] Table 14 Screening of LNP formulations with organic-to-water ratio

[0278] Experimental results show that when the organic-to-water ratio is 1:8 (particle size: 45.11 nm) or 1:4 (particle size: 44.80 nm), the particle size is much smaller than that when the organic-to-water ratio is 1:2 (particle size: 58.49 nm). However, when the organic-to-water ratio is 1:8 and its PDI is 0.392, it is much larger than the 0.251 when the organic-to-water ratio is approximately 1:4, indicating that the particle size distribution is more uniform when the organic-to-water ratio is 1:4. Therefore, 1:4 was chosen as the organic-to-water ratio (v / v) for empty LNPs.

[0279] Needle inner diameter screening

[0280] In the process optimization of empty LNPs, a SY03 syringe pump system was used to prepare empty LNPs. When the lipid solution and acidified solution were passed through a microfluidic channel of a specific size via a T-connector at flow rates of 40 and 160 mL / min, respectively, they could be rapidly and completely dispersed under laminar flow. The needle sizes tested included 14G (inner diameter 1.60 mm; length 300 mm), 16G (inner diameter 1.19 mm; length 300 mm), and 18G (inner diameter 0.84 mm; length 300 mm). Particle size distribution was used as the selection criterion. The experimental design and results are shown in the table below.

[0281] Table 15. Screening of needle inner diameter.

[0282] The results showed that the empty LNPs had the smallest particle size when the needle specification was 16G. When the needle was 18G, it generated high shear fluid pressure due to its narrow inner diameter. Therefore, a 16G needle (inner diameter 1.19 mm; length 300 mm) was selected for the preparation of empty LNPs.

[0283] Screening of lipid solution and ammonium chloride / glacial acetic acid solution injection pump systems

[0284] In the optimization of the empty LNP preparation process, an SY03 syringe pump system was used to prepare empty LNPs. When different lipid solutions and acidic solutions passed through a T-connector, they were rapidly and completely dispersed under laminar flow conditions at a certain flow rate through a microfluidic channel of a specific size. A stainless steel syringe needle (16G; inner diameter 1.19 mm; length 300 mm) was used as the mixing and dispersing microfluidic channel. The syringe pump speed combinations for the lipid solution and acidic solution were set to 40 and 160 mL / min, 20 and 80 mL / min, and 10 and 40 mL / min, respectively. Appropriate syringe pump speed combinations for the lipid solution and acidic solution were selected based on particle size distribution. The experimental design and results are shown in the table below.

[0285] Table 16. Screening of injection pump systems.

[0286] The maximum flow rate of the SY03 syringe pump system is 170 mL / min. Using a lipid solution / acidification solution ratio (v / v) of 1:4 (i.e., flow rate ratio), the syringe pump speed combinations for lipid solution and acidification solution were set to 40 & 160 mL / min, 20 & 80 mL / min, and 10: 40 mL / min. The results showed that when the syringe pump speed combination was 40 & 160 mL / min, the resulting empty LNPs had the smallest particle size (34.24 nm) and the shortest preparation time. Therefore, 40 & 160 mL / min was selected as the syringe pump speed combination for lipid solution and acidification solution preparation.

[0287] Needle specification screening

[0288] In the drug loading optimization process, empty LNPs were prepared using a SY03 syringe pump system. Empty LNPs and API solutions were passed under laminar flow through microfluidic channels of a specific size at a combination of flow rates (40 and 160 mL / min) via a T-connector assembly, allowing for rapid and complete mixing. The needle sizes tested included 14G (inner diameter 1.60 mm; length 300 mm), 16G (inner diameter 1.19 mm; length 300 mm), and 18G (inner diameter 0.84 mm; length 300 mm). Particle size distribution was used as the selection criterion. The experimental design and results are shown in the table below.

[0289] Table 17. Needle specification screening.

[0290] The results showed no significant difference in drug-loaded particle size distribution when using needles of different diameters. The smallest LNP particle size (42.10 nm) was observed when the needle diameter was 16G. When the needle diameter was 18G, the smaller inner diameter resulted in higher internal pressure, which could potentially lead to leakage of the injection pump's solenoid valve. Therefore, a needle diameter of 16G was chosen for drug loading via microfluidics.

[0291] Screening of empty LNP and API solution injection pump systems

[0292] In the drug loading optimization process, an API-loaded LNP was prepared using a SY03 infusion pump system. Empty LNPs and API solutions were passed through microfluidic channels of a specific size under laminar flow conditions at specific flow rate combinations (40 & 160 mL / min) via a T-connector assembly, allowing for rapid and complete mixing. A 16G needle was used to determine the effect of different infusion pump rate combinations of empty LNPs and API solutions: 160 & 160 mL / min, 80 & 80 mL / min, and 40 & 40 mL / min. Particle size was used as a standard to determine appropriate infusion pump rate combinations. The experimental design and results are shown in the table below.

[0293] Table 18. Screening of empty LNP and API solution syringe pump systems.

[0294] The maximum flow rate of the SY03 syringe pump system was 170 mL / min. Results showed no significant difference in particle size distribution between WGI-0301 prepared using different combinations of injection rates for empty LNP and API solutions. The shortest processing time was achieved when the syringe pump rate combination was 160 & 160 mL / min; a shorter processing time is preferred for WGI-0301 prepared via microfluidic technology. Therefore, 160 & 160 mL / min was selected as the syringe pump rate combination for empty LNP and API solutions.

[0295] Screening of incubation temperature and incubation time

[0296] Microfluidic continuous mixing technology was used to prepare empty LNPs and to load API into empty LNPs. For both preparations, the solutions were maintained at the same temperature. The effects of API solutions (RX-0201 in sucrose solution), empty LNPs, and API-loaded LNPs on different incubation temperatures (25°C, 40°C, and 55°C) and incubation times were investigated.

[0297] RX-0201 readily dissolves in sucrose solution at room temperature with stirring. API solutions can be exposed to high temperatures for extended periods under continuous microfluidic processing. At high temperatures, RX-0201 is unstable, and impurities may increase. A small amount of API was dissolved, and the measured values ​​and impurities were evaluated under different temperature conditions. The experimental design and test results are as follows.

[0298] Table 19. Stability of API at different temperatures.

[0299] RX-0201 was dissolved in a 20% sucrose solution to obtain Archexin free acid at a final concentration of 1.88 mg / mL. This was the API solution (RX-0201 is soluble in 20% sucrose solution, and the dissolution time is very short, so no investigation is needed). The API solution was then incubated at 25°C, 40°C, and 55°C for 12 hours to study stability. The results showed that impurities increased with time at different temperatures, and impurities increased with increasing temperature. However, it is important to note that the measured values ​​did not change significantly.

[0300] Using a SY03 syringe pump system, previously selected process parameters were used to prepare empty LNPs and API-loaded LNPs. The preparation / incubation temperatures for empty LNPs were set to 25℃, 40℃, and 55℃, and the effects of different incubation times (15 min, 30 min, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h) on the particle size distribution, encapsulation efficiency, LPC, and impurities of empty LNPs were investigated. The experimental design and results are as follows.

[0301] Table 20. Experimental design to screen incubation temperature and incubation time.

[0302] Table 21 Comparison of different incubation times for empty LNPs at 25℃, 40℃ and 55℃

[0303] The results showed that when the incubation temperature was 25℃, the particle size of empty LNPs decreased slowly with the increase of incubation time (from 48.47 nm to 39.35 nm), the PDI decreased slowly with the extension of incubation time (from 0.483 to 0.265), and the LPC content increased with the extension of incubation time (from 0.013 mg / mL to 0.023 mg / mL).

[0304] When the incubation temperature was 4℃, the particle size of empty LNPs increased slowly with the extension of incubation time (from 37.23 nm to 46.46 nm), PDI decreased slowly with the extension of incubation time (from 0.340 to 0.233), and LPC content remained unchanged at 12 hours but increased at 24 hours.

[0305] When the incubation temperature is 55℃, the particle size of the empty LNP increases slowly over 12 hours (from 41.54 nm to 49.75 nm), but suddenly drops to 41.54 nm after 24 hours, indicating that the empty LNP may be damaged or broken after 24 hours.

[0306] Table 22. Comparison of different incubation times for drug-loaded LNPs at 25℃, 40℃ and 55℃.

[0307] The results showed that at an incubation temperature of 25℃, the particle size after drug loading increased from 48.47 nm to 59.66 nm, while the particle size of the drug-loaded LNP decreased slightly with incubation time. At an incubation temperature of 40℃, the particle size increased from 37.23 nm to 48.24 nm, with no further significant change in particle size with increasing incubation time. At an incubation temperature of 55℃, the particle size after API loading increased from 41.54 nm to 58.12 nm, with no significant change in particle size with increasing incubation time. When the preparation / incubation temperature was 40℃, both particle size and PDI changes were minimal.

[0308] The encapsulation efficiency and LPC content of LNPs incubated for 24 hours did not change significantly at different temperatures. At different temperatures, the maximum single and total impurities increased with increasing incubation time, and impurities increased rapidly at higher temperatures.

[0309] RX-0201 sucrose solution (API solution), empty LNPs, and API-loaded LNPs were incubated at different temperatures (25°C, 40°C, and 55°C), and particle size distribution, measured values, impurities, LPC content, and encapsulation efficiency were evaluated. Empty LNPs were determined to be prepared at 40°C for 15 minutes.

[0310] Tangential flow filtration alternative solution

[0311] A Spectrum hollow fiber membrane column (mPES; 100Ka 115cm²) was used as the TFF device, with 0.9% NaCl solution and pH 7.4 PBS solution used as TFF alternative solutions. The effects of these two TFF alternative solutions on the drug product were investigated. The experimental results are shown in the table below.

[0312] Table 23. Screening of TFF alternative solutions.

[0313] TFF (Thin-Flush Filter) was used to exchange drug-loaded LNPs at physiological pH with different buffer systems (0.9% NaCl solution or pH 7.4 PBS solution). Results showed no significant differences in particle size distribution, measured values, encapsulation efficiency, lipids, LPC content, impurities, or residual solvent (ethanol) across the different buffer systems. Freeze-thaw experiments showed no significant change in particle size distribution. However, animal data (batch number 19111301 / 02 / 03 / 04, TFF using pH 7.4 PBS buffer) indicated some toxicity when using pH 7.4 PBS solution as the final buffer system. Furthermore, literature also indicates some toxicity with intravenous injection of pH 7.4 PBS solution. Therefore, 0.9% NaCl solution was chosen as the buffer solution.

[0314] Confirmation of TFF loop

[0315] Hollow fiber membrane columns (mPES; 100 Ka, 115 cm²) were used as the TFF module, and 0.9% NaCl solution was used as the replacement buffer. TFF was performed for up to eight cycles. Particle size distribution and residual solvent (ethanol) were used as selection criteria. The experimental results are shown in the table below.

[0316] Table 24. Confirmation of TFF cycle.

[0317] The results showed that particle size and PDI did not change significantly with increasing TFF cycle count. However, the residual ethanol content decreased with increasing TFF cycle count. The residual ethanol content in the draft quality standard is set at <0.25%. At least four TFF buffer replacement cycles are required to meet the ethanol removal quality standard. The number of TFF buffer replacement cycles is set to six.

[0318] Selection of membrane filtration materials

[0319] The LNPs loading the API are respectively used with Millipore 0.22μm PVDF syringe filter and Millipore A 0.22μm PES syringe filter was sterilized to examine the effect of different filter materials on aseptic filtration.

[0320] Table 25. Selection of membrane filtration materials.

[0321] The results showed that aseptic filtration with PVDF or PES membranes did not significantly change the particle size distribution, measured values, encapsulation efficiency, LPC content, or impurities. The lipid content of LNPs filtered by PVDF or PES membranes was almost identical, and there were no significant differences in lipid retention and adsorption between the different membrane materials. Therefore, PVDF or PES membranes are suitable choices for aseptic filtration processes because they do not significantly affect the chemical or physical properties of LNPs.

[0322] The test drug was stored at -20°C and warmed to room temperature before administration. In-use stability studies were conducted on the test batches to assess the compatibility between the packaging components and the drug. WGI-0301 was thawed at 5°C ± 3°C and kept at room temperature for 2 hours. The drug was diluted to concentrations of 0.019 mg / mL, 0.19 mg / mL, 0.47 mg / mL, and 0.70 mg / mL using 0.9% sodium chloride injection, and the diluted solutions were injected into sterile PVC bags. Sampling and testing were performed at 0, 1.5, and 6 hours, and the results are summarized in the table below.

[0323] In-use stability and compatibility data showed a significant change in the Di(90) value of the sample solution at 0.019 mg / mL. The particle sizes of the 0.019 mg / mL and 0.19 mg / mL sample solutions from batch QT-SY2020022 increased to 55 nm and 53 nm, respectively. No significant differences were observed in other specifications, indicating that the packaging components are compatible with the drug.

[0324] Furthermore, the results of accelerated and long-term stability studies also indicate that the packaging components are compatible with the drug when stored at -20°C.

[0325] Example 3: In vivo efficacy of WGI-0301 in a mouse model of cancer

[0326] The AKT pathway is an important therapeutic target for cancer drug discovery because it serves as a major site for transducing extracellular and intracellular oncogenic signals. Furthermore, alterations to the AKT pathway have been found in various cancers (Cheng, JQ, et al., Oncogene, 24(50), 7482-7492(2005)). Archexin (also named RX-0201) is a fully phosphorylated 20-mer oligonucleotide complementary to Akt1 mRNA. Archexin specifically targets the Akt-1 mRNA sequence, causing inhibition of Akt-1 mRNA translation and downstream pathway activity (Bellacosa, A., et al., Adv Cancer Res, 94, 29-86 (2005), Liang, J., et al., JM, Cell Cycle, 2(4), 339-345 (2003), Staal, SP Proc Natl Acad Sci USA, 84(14), 5034-5037 (1987), Staal, SP, et al. Proc Natl Acad Sci USA, 74(7), 3065-3067 (1977), Testa, JR, et al. Proc Natl Acad Sci USA, 98(20), 10983-10985 (2001) and Yoon, H., et al., J Cell). Biochem, 108(4), 832-838 (2009). Archexin (RX-0201) was developed for the treatment of cancers under IND 69763. In vitro pharmacological studies have shown that Archexin's inhibition of Akt-1 mRNA is sequence-specific. Treatment with Archexin significantly reduced Akt-1 mRNA levels and Akt-1 protein expression in human tumor cells of the brain, breast, cervix, liver, lung, ovary, prostate, and stomach, as well as in melanoma. Furthermore, these studies showed that Archexin inhibited cell proliferation in these human cancer cells. The growth inhibition of Archexin appears to be dose-dependent, and the concentration range for inducing 50% inhibition of cell growth (IC50) in these human cancer cells is 2 nM to 50 nM.

[0327] Three clinical trials of Archexin were conducted according to IND 69763: one Phase I monotherapy trial and two Phase II combination therapy trials. In the Phase I monotherapy dose-escalation study, 17 subjects with advanced solid tumors received doses ranging from 6 to 315 mg / m². 2 The dose should be administered daily for at least 14 days. The maximum tolerated dose of a single-dose formulation of Archexin is 250 mg / m².2 / day, equivalent to 6.76mg / kg / day.

[0328] WGI-0301 is a lipid nanoparticle formulation of Archexin. Non-clinical studies supporting the development of WGI-0301 included preliminary pharmacological studies demonstrating its tumor-suppressive effects in an in vivo mouse model of cancer, and investigating its survival-prolonging effects. Safety pharmacological studies were conducted to investigate any adverse pharmacological effects of WGI-0301 on the central and peripheral nervous systems, cardiovascular system, and respiratory system. In vivo pharmacokinetic and tissue distribution studies, as well as in vitro stability studies in plasma, were investigated to characterize the distribution and metabolic stability of WGI-0301 in test species, and toxicological assessments, including toxicokinetic analysis of WGI-0301, were performed.

[0329] To assess the non-clinical safety of WGI-0301, acute toxicity studies were conducted in Sprague-Dawley rats and Beagle dogs to determine the maximum tolerated dose in both animal groups. Repeat-dose toxicity was investigated in rats and dogs following weekly 1-hour intravenous administration for 29 days (4 weeks and 5 doses total), followed by a 28-day recovery period. Further studies have been conducted to evaluate the potential immunotoxicity and in vitro hemolytic potential of WGI-0301 in dogs.

[0330] WGI-0301 is a reformulated lipid nanoparticle suspension of Archexin. Due to the tissue distribution characteristics of lipid nanoparticles, the liver is the primary target of WGI-0301. In pharmacodynamic studies, a mouse cancer model was used to investigate the efficacy of WGI-0301. In an in vivo Hepa1-6 liver cancer mouse model study (study number: E4275-T1906), after intravenous treatment with either WGI-0301 or Archexin once weekly at 8 mg / kg for four doses, WGI-0301 showed better tumor suppression and significantly longer survival than Archexin. Compared with the excipient control group, WGI-0301 showed a tumor growth inhibition rate of 46.16%, while Archexin under the same dosing regimen showed a tumor growth control rate of 3.32%. The median survival times of the vector control group, Archexin treatment group, and WGI-0301 treatment group were 37, 41, and 55 days, respectively; the difference between the vector control group and the WGI-0301 treatment group was statistically significant (p = 0.042).

[0331] Archexin's lipid nanoparticle formulation WGI-0301 shows promise for antitumor and / or survival-prolonging effects with lower dosing frequency and less Archexin dosage.

[0332] WGI-0301 demonstrated antitumor growth efficacy and prolonged survival in a mouse model of cancer at a low dose level of 8 mg / kg (0.65 mg / kg HED). Furthermore, no agent-related neurobehavioral changes were observed in rats, nor were any agent-related changes observed in qualitative and quantitative electrocardiographic assessments, blood pressure, heart rate and respiratory parameters, or neurological examination parameters. In vitro hERG assays showed almost no inhibition at concentrations up to 274.1 μM of Archexin free acid.

[0333] Pharmacokinetic studies

[0334] The non-clinical pharmacokinetics of WGI-0301 were generally similar in the primary species (Sprague-Dawley rats and Beagle dogs) used for pharmacokinetic and toxicological evaluation. In each species receiving a single dose of WGI-0301, the plasma half-life (T0) was [not specified]. 1 / 2 The systemic exposure (AUC) of Archexin free acid increases with increasing dose level. 0-last and C max The AUC increases proportionally with increasing dosage, but the AUC in female dogs... 0-last Except for [other factors]. During a 3-week once-weekly intravenous infusion regimen, the C [value] in male rats [was lower / lower / lower]. max A cumulative effect was observed in rats, but not in dogs. Tissue distribution studies in rats showed that WGI-0301 tended to rapidly enter the liver, kidneys, and spleen from the bloodstream after administration, and remained in the liver for up to 7 days.

[0335] Toxicity studies

[0336] In acute toxicity studies of WGI-0301, the lethal dose and MTD in rats were 12 mg / kg and 6 mg / kg, respectively, and the MTD in dogs was 9 mg / kg, which is the maximum feasible dose. In a 4-week canine toxicology study, no treatment-related adverse events were observed after treatment with WGI-0301 at weekly intravenous injections up to 5 mg / kg for 4 weeks (5 doses in total). The NOAEL and HNSTD of WGI-0301 in dogs were 5 mg / kg / dose, equivalent to 2.77 mg / kg HED. In a 4-week rat toxicology study, weekly intravenous injections of 2, 4, or 6 mg / kg of WGI-0301 for 4 weeks (5 doses in total) had no treatment-related adverse effects on morbidity / mortality, clinical signs, body weight, food consumption, ophthalmological examination, coagulation, and urinalysis.

[0337] Example 4: The first open-label dose-escalation study in humans to evaluate the safety, tolerability, and pharmacokinetics of WGI-0301 (a lipid nanoparticle suspension of Akt-1 antisense oligonucleotides) in patients with advanced solid tumors.

[0338] Cancer plays a leading role in mortality and is a significant obstacle to extending life expectancy worldwide. According to modeling results from the World Health Organization (WHO) in 2019, cancer is the first or second leading cause of death before age 70 in 112 of 183 countries, and the third or fourth in another 23 countries. In 2020, an estimated 19.3 million new cancer cases (18.1 million excluding non-melanoma) and nearly 10 million cancer deaths globally (9.9 million including non-melanoma) were recorded. [1] Currently available treatments for cancer include surgery, chemotherapy, hormone therapy, immunotherapy, and radiation therapy. Each therapy has its limitations, such as intolerable toxicity, insufficient efficacy, or lack of public accessibility. Therefore, the demand for safe and effective treatments continues to increase.

[0339] The Akt (also known as protein kinase B or PKB) gene family consists of three widely expressed, closely related proto-oncogenes, designated Akt-1, Akt-2, and Akt-3. Once activated, Akt protein products can phosphorylate a range of proteins, thereby controlling several cellular processes (Staal, 1987). [2] In cancer cells, constitutively activated overexpression of the Akt-1 gene promotes cell transformation through two distinct mechanisms. Strong evidence suggests that Akt-1 plays a crucial role in cancer progression by stimulating cell proliferation and inhibiting apoptosis. Akt-1 appears to promote proliferation under conditions of normal cell growth arrest. Akt-1 also prevents apoptosis by inhibiting almost all cell death-inducing molecules. These mechanisms enable Akt-1 to promote tumor cell survival under conditions where tumor cells should die.

[0340] Furthermore, strong evidence suggests that overexpression of p-Akt may contribute to the development and progression of malignant tumors (e.g., prostate cancer (Van de Sande, T et al., 2005)). [3] Breast cancer (Stal et al., 2003) [4] Ovarian cancer (Kurose et al., 2001) [5] Endometrial cancer (Uegaki et al., 2005) [6] Squamous cell carcinoma (Massarelli et al., 2005) [7] And kidney cancer (Rathmell et al., 2005)[8] This can negatively impact prognosis. High-specificity Akt immunostaining against phosphorescence is significantly associated with low cancer-specific survival and metastasis in renal cell carcinoma (Horiguchi et al., 2003). [9] Increased levels of p-Akt in the cytoplasm and nucleus are an independent prognostic factor for reduced survival in cancer patients (Hager et al., 2009).

[10] Successfully modulating Akt-1 activity would be an effective way to control cancer cell survival. Therefore, Akt-1 may be an attractive drug target for cancer treatment.

[0341] The potential of antisense oligonucleotides in gene silencing was discovered approximately 40 years ago, leading to growing interest in their chemistry, mechanisms of action, and metabolic pathways. Currently, one approach to regulating Akt-1 is to use antisense oligonucleotides to modify and regulate the mRNA that controls Akt-1 expression and production.

[0342] Archexin is a 20-meric oligonucleotide, the API of WGI-0301, and is complementary to Akt-1 mRNA. Archexin has been tested in several in vitro and in vivo models, demonstrating its selective and specific antitumor activity. In vitro studies have shown that Archexin specifically inhibits the proliferation of human cancer cells in the brain, breast, cervix, colon, kidney, liver, lung, ovary, pancreas, prostate, skin, and stomach by inhibiting Akt mRNA and protein expression. In vivo studies have also shown that in nude mouse cancer models, Archexin significantly inhibits the growth of tumor clusters in human prostate and nude mouse brain cancer cells and increases the survival rate of human kidney or pancreatic cancer cells.

[0343] Archexin has demonstrated tolerability and safety in three previous clinical studies in cancer patients. The most common adverse event (AE) was fatigue (70.6%). Of these, mild fatigue accounted for 29.4%, moderate fatigue for 23.5%, and severe fatigue for 17.6%. Mild or moderate nausea, anorexia, and arthralgia were the second most reported AEs. In two Phase II studies of Archexin, gemcitabine or everolimus in combination was tested in metastatic pancreatic cancer and renal cell carcinoma, respectively. However, the primary objectives were not achieved due to lack of efficacy or early termination of the studies. Despite early termination, the short duration of exposure to Archexin is believed to be the main cause of ineffectiveness.

[0344] To further investigate this, WGI-0301 aims to improve the in vivo delivery and therapeutic performance of the drug Archexin. WGI-0301 is formulated as a lipid nanoparticle suspension of Archexin, using a combination of quaternary and tertiary fatty amines, along with other neutral and stable lipids for pH-sensitive delivery. Permanently ionized and conditionally ionized lipids have been widely used in LNP formulations for delivering nucleic acid drugs. The WGI-0301 product utilizes the quaternary ammonium cationic lipid DOTAP-Cl, which carries a permanent positive charge regardless of pH conditions, facilitating the concentration of large nucleic acid drugs into stable nanoscale complexes. The LNP formulation also includes DODMA as an ionizable lipid, which is mostly uncharged at neutral pH and only cationizes under acidic conditions. When DODMA is incorporated into the LNP formulation, it becomes charged after LNP internalization, subsequently promoting the escape of LNP-encapsulated nucleic acid genetic material, such as late endonucleosomes or lysosomes, under low pH conditions. Archexin's LNP formulations can also utilize well-documented enhanced penetration and retention (EPR) effects and a cleavable PEG coating to reduce uptake by the mononuclear phagocyte system (MPS), thereby allowing Archexin to preferentially accumulate at tumor sites and limit off-target exposure.

[0345] Furthermore, in vivo animal studies of WGI-0301 have shown that it enhances therapeutic efficacy and alters tissue distribution in the liver, making liver cancer a very promising target. Further investigations are planned following the initial human studies.

[0346] WGI-0301 will be evaluated in patients with advanced solid tumors.

[0347] Preclinical research

[0348] Drug WGI-0301

[0349] WGI-0301 is a lipid nanoparticle suspension of Archexin. The reformulation of Archexin improved its efficacy in mouse models of cancer. In an in vivo mouse model of liver cancer, WGI-0301, at 8 mg / mL, IV, QW* for 4 weeks, showed a tumor growth inhibition rate of 46.16%, significantly higher than the same dose of Archexin, which showed 3.32%.

[0350] Single dose and once-weekly dose for 3 weeks

[0351] In rats and dogs, animals received a single intravenous injection of WGI-0301 1 hour later, once weekly for 3 weeks. In rats, the single dose levels were 2, 4, and 6 mg / kg, with a weekly dose level of 4 mg / kg. In dogs, the single dose levels were 0.75, 1.5, and 3 mg / kg, with a weekly dose level of 3 mg / kg.

[0352] Clinical research

[0353] Determine the safety and tolerability of WGI-0301 in patients with advanced solid tumors by identifying dose-limiting toxicities (DLT), maximum tolerated dose (MTD), and / or recommended phase 2 dose (RP2D). Determine the pharmacokinetic (PK) characteristics of WGI-0301 and free Archexin (if measurable) in patients with advanced solid tumors. Evaluate the initial tumor response in patients with advanced solid tumors treated with WGI-0301. Investigate potential biomarkers and their relationship to clinical response (Akt-1 mRNA, pAkt-1, pGSK-3β, pPRAS40, PTEN) through biochemical and / or genetic analysis of blood and / or tumor samples. Determine immunogenicity (anti-WGI-0301, anti-PEG) and its impact on PK, PD, and clinical response (if applicable).

[0354] Product, dosage and route of administration

[0355] WGI-0301 is WGI-0301 is a lipid nanoparticle formulation for the treatment of advanced solid tumors. It will be administered weekly via intravenous injection over one hour, starting at a dose of 0.1 mg / kg for four consecutive weeks (one cycle). Treatment cycles will continue unless disease progression, unacceptable toxicity, or clinical observation meeting any discontinuation criteria is observed. Subjects with dose-limiting toxicities (DLTs) will be removed, and other subjects in the same cohort will receive their previous cohort dose.

[0356] Please refer to the Pharmacy Handbook for more details on handling and administering investigational products.

[0357] method

[0358] A “3+3” design will be used to determine dose-limiting toxicities (DLTs), maximum tolerated dose (MTD), and recommended phase 2 dose (RP2D). Each treatment cohort will have 3 to 6 patients assigned to receive WGI-0301 via weekly 1-hour intravenous infusion for 4 weeks (one cycle), starting at a dose of 0.1 mg / kg. All relevant safety data will be reviewed and adjudicated 28 days after the cycle start date. All toxicities that cannot be clearly explained by underlying disease, comorbidities, or concomitant medications will be considered WGI-0301-related; the treatment cycle will continue unless disease progression, unacceptable toxicity, or clinical observation meeting any discontinuation criteria is observed. The 3+3 design will proceed as follows: Initially, three patients will be enrolled in the cohort; if one patient experiences a DLT, three additional patients will be enrolled. Dose escalation will be stopped when ≤6 patients in the dosing cohort experience more than one DLT, and that dose level will be designated as the intolerable dose. In this case, the MTD can be defined as the previous lower dose, or as the dose between the non-tolerated dose and the previous lower dose. This may require more precise exploration to define the appropriate MTD.

[0359] Dosage escalation plan

[0360] The dose escalation in this study will follow a modified Fibonacci timeline.

[0361] Before escalating to the next higher dose level, the safety monitoring board will review the safety data of all patients at the previous dose level.

[0362] Table 26. Incremental timetable. Dose Level 1 0.1 mg / kg / week Dose Level 2 0.3 mg / kg / week Dose Level 3 0.6 mg / kg / week Dose Level 4 1.0 mg / kg / week Dose Level 5 1.3 mg / kg / week Dose Level 6 1.75 mg / kg / week

[0363] Table 27. Incremental Method. Observed Safety Results Procedure 1 DLT in 3 patients Expand cohort to 6 patients 1 DLT in 6 patients Escalate to next dose level >1 DLT in <6 patients Stop dose escalation

[0364] Dosage selection, dosing intervals, and escalation schedule

[0365] The starting dose is 0.1 mg / kg intravenously, administered once weekly for 4 weeks as one cycle. Treatment cycles will continue unless disease progression, unacceptable toxicity, or clinical observations meet any criteria for discontinuation. This dosage selection is supported by toxicological and pharmacokinetic studies in rats and dogs.

[0366] The proposed weekly dosing interval in the clinical study is the same as that investigated in the repeated-dose toxicology studies in rats and dogs. Dose escalation in this study follows a modified Fibonacci timeline. The exposure at dose level 5 of WGI-0301, i.e., 1.3 mg / kg / week, is within the safety margin obtained from repeated-dose toxicology in rats. If practicable, the dose will be cautiously increased to 1.75 mg / kg to determine the maximum tolerated dose (MTD). The exposure at the proposed maximum dose is within the safety margin obtained from repeated-dose studies in dogs. Intensive clinical surveillance will be implemented based on adverse events collected. Note that both the 1.3 and 1.75 mg / kg / week doses of WGI-0301 meet the USP. <85> The recommended endotoxin requirement is 5 EU / kg within 1 hour; the endotoxin level of the clinical trial drug was retested, and the result was <2.5 mg / kg.

[0367] The total study duration is approximately 16 months. The number of treatment cycles in this study is not fixed. Subjects who continue to derive clinical benefit from study treatment may continue study treatment unless they withdraw their consent, experience PD, or experience unacceptable toxicity. Patients may withdraw their consent at any time. For the best interests of the subjects, the principal investigator may discontinue treatment at any time. Specific criteria for discontinuing patient participation are outlined.

[0368] According to the National Cancer Institute Common Terminology Standard for Adverse Events (NCI-CTCAE) version 5.0, DLT is defined as any treatment-associated adverse event (TEAE) that occurs during the DLT assessment period (day 1 to day 28) and is not attributable to the disease or a disease-related process.

[0369] The study involved approximately 24 participants, depending on the number of cohorts explored.

[0370] To participate in this study, participants must meet all of the following criteria: Subjects have a measurable disease based on RECIST 1.1. Advanced, histologically or cytologically confirmed solid tumor that has progressed from current treatment or relapsed after previous treatment and is not suitable for potentially curative treatment. Pathologically confirmed solid tumor. Patients with advanced solid tumors (unresectable or metastatic) who have failed standard treatment (disease progression or intolerance). Ability to understand written informed consent, provide signed, dated, and witnessed written informed consent, and agree to comply with the study protocol. Age 18 years or older at initial screening / examination. Eastern Cooperative Oncology Group (ECOG) performance status of 0 to 2, measured within 72 hours after the first treatment. Normal blood function [absolute neutrophil count (ANC) ≥ 1.5 × 10⁻⁶]. 9 / L], [platelet count ≥100×10 9[L], [hemoglobin ≥9 g / dL] and [serum albumin ≥2.8 g / dL]. Glomerular filtration rate (eGFR) calculated using the CKD-EPI creatinine equation (2021) ≥50 mL / min. Normal liver function [total bilirubin ≤1.5 x UNL; AST (aspartate aminotransferase) or ALT (alanine aminotransferase) ≤3 x UNL, or ≤5 x UNL due to liver involvement]. Negative pregnancy test in women of childbearing age (WOCBP), and consent to use highly effective contraception if men have not undergone surgical sterilization before study initiation, during treatment, and within 3 months after the last dose. Please refer to Appendix 1 for acceptable effective contraception methods. Life expectancy of subjects is at least 12 weeks.

[0371] Subjects meeting one or more of the following criteria will be excluded: breastfeeding, pregnancy, or planning to become pregnant; receiving anticancer therapy or other investigational drugs within 4 weeks prior to the first dose of the investigational drug; or, according to the FDA's Drug Development and Drug Interactions, Substrate, Inhibitor, and Inducer Tables, using a sensitive substrate of the major cytochrome P450 enzyme and transporter, or a strong inducer of the transporter P-gp, including apalutamide, carbamazepine, enzalutamide, mitotane, phenytoin sodium, rifampin, and St. John's wort. According to the FDA's Drug Development and Drug Interactions, Substrate, Inhibitor, and Inducer Tables, patients using strong transporter inhibitors must not have had any acute toxic effects of any prior antitumor therapy unresolved as Grade 1 (excluding alopecia [G1 or 2 allowed], neurotoxicity [≤2 allowed], or selected laboratory parameters [<2 allowed, except for exceptions noted below]) prior to the start of study treatment. Evidence of non-remission of other malignancies or a history of such malignancies within the past 3 years is also required (excluding treated basal or squamous cell carcinoma of the skin, or cervical carcinoma in situ). Concomitant malignancies, excluding carcinoma in situ, basal cell carcinoma, or squamous cell carcinoma of the skin; low-grade cancer treated with prostatectomy more than 5 years ago; early-stage melanoma treated with complete surgical resection more than 5 years ago; cervical carcinoma in situ treated with cone biopsy more than 8 years ago. Primary brain cancer or symptomatic central nervous system (CNS) metastases are also acceptable, unless the metastases have stabilized within three months. Patients with unstable bleeding disorders or currently receiving undetermined anticoagulation therapy (using heparinized saline to maintain normal blood flow) are also acceptable. (Except for patent ductus arteriosus). History of symptomatic CHF (NYHA Class II-IV) or serious arrhythmias requiring treatment. History of myocardial infarction or unstable angina within 6 months prior to enrollment. QTcF prolongation >470 ms based on triplicate 12-lead ECG, or other abnormalities deemed by the investigator to increase the risk of participation in the study. Hypertension of grade 3 or higher (≥160 / 100 mmHg) or ≤80 / 50 mmHg; heart rate (HR) ≥100 beats per minute (bp). (m), or ≤45 bpm, confirmed by repeated assessment. Evidence of electrolyte imbalance, such as hypokalemia, hypocalcemia, and hypomagnesemia (symptomatic, requiring intervention) with NCI-CTCAE grade ≥2. Major surgery other than tumor resection within 4 weeks prior to screening. Uncontrolled diabetes, neurological or psychiatric disease, persistent systemic (including opportunistic) major clinical infection, or any other serious or unstable comorbidity that may increase the risk to investigator-identified study participants. Known history of human immunodeficiency virus disease.

[0372] References [1]Sung,H.,Ferlay,J.,Siegel,R.L.,Laversanne,M.,Soerjomataram,I.,Jemal,A.,&Bray,F.(2021).Global Cancer Statistics 2020:GLOBOCAN Estimates ofIncidence and Mortality Worldwide for 36Cancers in 185Countries.CA:A CancerJournal for Clinicians,71(3),209–249. [2]taal,S.P.(1987).Molecular cloning of the akt oncogene and itshuman homologues AKT1 and AKT2:amplification of AKT1 in a primary humangastric adenocarcinoma.Proc Natl Acad Sci U S A,84(14),5034-5037. [3]van de Sande,T.,Roskams,T.,Lerut,E.,Joniau,S.,van Poppel,H.,Verhoeven,G.,&Swinnen,J.V.(2005).High-level expression of fatty acid synthasein human prostate cancer tissues is linked to activation and nuclearlocalization of Akt / PKB.The Journal of Pathology,206(2),214–219. [4] O.,Pérez-Tenorio,G., L.,Olsson,B., B.,Skoog,L.,&Rutqvist,L.E.(2003).Akt kinases in breast cancer and the results ofadjuvant therapy.Breast Cancer Research,5(2). [5]Kurose, K., Zhou, XP, Araki, T., Cannistra, SA, Maher, ER, & Eng, C. (2001). Pathology,158(6),2097–2106. [6]Uegaki, K., Kanamori, Y., Kigawa, J., Kawaguchi, W., Kaneko, R., Naniwa, J., Takahashi, M., Shimada, M., Oishi, T., Itamochi, H., & Terakawa, N. (2005). forpatients with advanced endometrial carcinoma.Oncology Reports.Published. [7]Massarelli,E.,Liu,DD,Lee,JJ,El-Naggar,AK,lo Muzio,L,Staibano,S,de Placido,S,Myers,JN,&Papadimitrakopoulou,VA(2005). cancer.Cancer,104(11),2430–2436. [8] Rathmell, WK, Wright, TM, & Rini, BI (2005). Molecularly targeted therapy in renal cell carcinoma. Expert Review of Anticancer Therapy, 5(6), 1031–1040. https: / / doi.org / 10.1586 / 14737140.5.6.1031 [9]HORIGUCHI, A., OYA, M., UCHIDA, A., MARUMO, K., & MURAI, M. (2003). ElevatedAkt Activation and Its Impact on Clinicopathological Features of Renal CellCarcinoma. The Journal of Urology, 710–713.

[10] Hager, GL, McNally, JG, & Misteli, T. (2009). TranscriptionDynamics. Molecular Cell, 35(6), 741–753.

[11] Kilanowska, A., & Studzińska, S. (2020). In vivo and in vitro studies of antisense oligonucleotides–a review. RSC Advances, 10(57), 34501–34516.

[0373] Example 5: In vivo efficacy study of the test product in treating a subcutaneous Hepa1-6 mouse cancer model in female C57BL / 6 mice.

[0374] The aim of this study was to evaluate the in vivo therapeutic effect of the test product on a subcutaneous cancer model of Hepa1-6 mice in female C57BL / 6 mice.

[0375] Materials: Female C57BL / 6 mice, 7-8 weeks old. Mice were housed at a density of up to 5 mice per cage under conditions of 20-26℃, 40-70% humidity, 12 hours of light and 12 hours of darkness, using a standard rodent diet, irradiated, randomly selected, 0.2μm filtered, reverse osmosis (RO) water, and autoclaved. Mice were observed daily in their cages and clinically weekly. Hepa 1-6 tumor cells were maintained in vitro in DMEM medium at 37℃ with 10% fetal bovine serum under a 5% CO2 atmosphere using 10% fetal bovine serum. Tumor cells in the exponential growth phase were harvested and counted for tumor inoculation. Each mouse was subcutaneously inoculated with 0.1 mL of Hepa 1-6 tumor cells (5 x 10⁶) in PBS in the right anterior ventral region to promote tumor development.

[0376] experiment

[0377] The processing of the Hepa 1-6 model studies is shown in Table 28 below.

[0378] Table 28. Processing of Hepa 1-6 model studies. Note: In this report, "empty LNP control" refers to "RX-0301(1:15) control" in all experimental records. The change has been approved by the sponsor.

[0379] When the average tumor size reaches approximately 81 mm 3 Randomization began at that time. A total of 48 mice were recruited and divided into 6 groups of 8 mice each, as shown in Table 4. Randomization was performed using the matched distribution method (Study Director™ software, version 3.1.399.19). The randomization date is recorded as day 0.

[0380] Following tumor inoculation, morbidity and mortality were assessed daily in the animals. During routine monitoring, the effects of tumor growth and treatment on activity levels, food and water consumption, weight gain / loss (measured twice weekly after randomization), eye / hair pads, and any other behavioral abnormalities were examined. Mortality rates and observed clinical signs were documented in detail for each animal.

[0381] After randomization, tumor volume was measured twice weekly using calipers in two dimensions, expressed in mm³, using the formula: V = (L x W x W) / 2, where V is the tumor volume, L is the tumor length (the longest tumor dimension), and W is the tumor width (the longest tumor dimension perpendicular to L). Drug administration and tumor and body weight measurements were performed in a laminar flow hood.

[0382] Using Study DirectorTM The software (version 3.1.399.19) measures body weight and tumor volume.

[0383] pharmaceutical preparations

[0384] Adjust the dosage volume according to body weight (dosage volume = 10 μL / g).

[0385] Dosing of test sample

[0386] According to the study design, treatment began on the day of randomization (Table 4). Dosing in the Hepa 1–6 model studies began on day 0 through day 21. All mice were fed Dietgel Recovery if a mean BWL > 10% was observed in the treatment group. To prevent cannibalism, any animals with ulcerated or necrotic tumors were immediately isolated and monitored daily before euthanasia or until complete tumor regression. Mice with ulceration of approximately 25% or more on the tumor surface were euthanized.

[0387] To compare tumor volume across different groups on a pre-specified day, the Bartlett test was first used to test the hypothesis of homogeneity of variance across all groups. When the p-value of the Bartlett test was 0.05, a one-way ANOVA was performed to test for overall equality of means across all groups. If the p-value of the one-way ANOVA was <0.05, further post-hoc tests were performed by Tukey's HSD (honest significance) test on all paired comparisons and by Dunnett's test for each treatment group versus the vector group. When the p-value of the Bartlett test was <0.05, the Kruskal-Wallis test was performed to test for overall equality of medians across groups. If the p-value of the Kruskal-Wallis test was <0.05, further specific tests were performed by Conover's nonparametric test on all paired comparisons or by adjusting the p-values ​​of each treatment group versus the vector group, both with single-step p-adjustment. All statistical analyses were performed using Ra language and environment for statistical computation and graphics (version 3.3.1). Unless otherwise stated, all tests are two-sided, and a p-value < 0.05 is considered statistically significant.

[0388] For survival analysis, the Kaplan-Meier method was used to analyze survival time. Survival time was defined as the time from randomization to animal death or ethical endpoint. Median survival time (MST) and life extension (ILS) were calculated for each group. Kaplan-Meier curves were also constructed for each group, and time series tests were used to compare survival curves between groups.

[0389] result

[0390] The results of weight and weight change at different time points are as follows: Figure 5 and Figure 6 As shown.

[0391] In this study, although most mice experienced slight or moderate weight loss after treatment, they were able to gradually recover within the dosing intervals. G4-118 mice were sacrificed, and GS-197 mice were found dead on day 9. The maximum mean weight loss in the negative control, empty LNP, RX-0201 (8 mg / kg), RX-0301 (15:1) (8 mg / kg), RX-0301 (12:1) (8 mg / kg), RX-0301 (10:1) (8 mg / kg), and RX-0301 group (7.5:1) (8 mg / kg) (starting from day 0) treatment groups were none, -13.91% (day 2), none, -13.39% (day 2), -16.13% (day 3), -13.37% (day 2), and -10.71% (day 2), respectively. Mean tumor growth curves at different time points are shown below. Figure 7 As shown in Table 29 below, the tumor growth inhibition of the test product in treating the Hepa 1-6 human hepatocellular carcinoma subcutaneous model in female C57BL / 6 mice is summarized.

[0392] Table 29. Antitumor activity of test samples in Hepa 1-6 model. Note: a. Mean ± SEM; b. Compared with the tumor volume of Group 1 on day 30.

[0393] The detailed statistical analysis of multiple comparisons on day 30 is as follows.

[0394] In this study, on day 30 after randomization, the mean tumor size in the negative control mice reached 1470.17 mm. 3 .

[0395] Empty LNPs administered at 0 mg / kg QW showed a slight antitumor effect in the Hepa 1-6 model, with a TGI value of 26.56% on day 30, but no statistically significant difference was observed compared with the control group (P>0.05).

[0396] RX-0201 administered at 8 mg / kg QW produced a mild antitumor effect in the Hepa 1-6 model, with a TGI value of 3.32% on day 30, but no statistically significant difference was observed compared with the control group (P>0.05).

[0397] RX-0301 (15:1) administered at 8 mg / kg QW produced a slight antitumor effect in the Hepa 1-6 model, with a TGI value of 27.93% on day 30, but there was no statistically significant difference compared with the control group (P>0.05).

[0398] RX-0301 (12:1) administered at 8 mg / kg QW produced a slight antitumor effect in the Hepa 1-6 model, with a TGI value of 41.87% on day 30, but there was no statistically significant difference compared with the control group (P>0.05).

[0399] RX-0301 (10:1) administered at 8 mg / kg QW produced a slight antitumor effect in the Hepa 1-6 model, with a TGI value of 38.09% on day 30, but no statistically significant difference was observed compared with the control group (P>0.05).

[0400] RX-0301 (7.5:1) administered at 8 mg / kg QW produced a slight antitumor effect in the Hepa 1-6 model, with a TGI value of 46.16% on day 30, but there was no statistically significant difference compared with the control group (P>0.05).

[0401] Survival analysis

[0402] Survival time was assessed by the time it took for the tumor volume to reach 3000 mm³, and the data were analyzed using Kaplan-Meier survival curves, as shown in Table 30 and... Figure 8 As shown.

[0403] Table 30. Hepa 1-6 model test specimen survival analysis. Note: a. The Log-Rank test was used to compare with the vector control group.

[0404] The detailed statistical survival analysis of multiple comparisons is as follows:

[0405] In this study, median survival (MST) was also investigated for each group. Tumor volume exceeding 3000 mm was also considered. 3 The mice were euthanized. RX-0301 (7.5:1) showed significant efficacy in prolonging the survival time of Hepa 1-6 tumor-bearing mice, while other test products did not.

[0406] This study investigated the tolerability and efficacy of the test product in a female C57BL / 6 mouse Hepa1-6 subcutaneous liver cancer model.

[0407] In summary, Hepa 1-6 tumor-bearing mice tolerated the designed dosing regimen well during the 4-week administration period. Tumor volume statistics were performed based on data from day 30, at which time all animals were either surviving or did not exceed 3000 mm. 3 Exclusion criteria for tumor volume. On day 30, compared with the vector control group, the TGI of empty LNP, RX-0201 (8 mg / kg), RX-0301 (15:1) (8 mg / kg), RX-0301 (12:1) (8 mg / kg), RX-0301 (10:1) (8 mg / kg), and RX-0301 (7.5:1) (8 mg / kg) was significantly lower. 3 The percentages of the positive rates for the control groups were 26.56%, 3.32%, 27.93%, 41.87%, 38.09%, and 46.16%, respectively. There were no significant differences between the treatment group and the vector control group. The experiment was terminated on day 56 to investigate the survival-prolonging effect of the test substance. Compared with the vector control group and the RX-0201 treatment group, the RX-0301 (7.5:1) (8 mg / kg) group showed significant efficacy in prolonging the survival time of Hepa 1-6 tumor-bearing mice.

[0408] Example 6: Archexin Free Acids: Effects of Manual Patch-Clamp Technique on Currents of Clonal Herg Potassium Channels Stably Expressed in Human Embryonic Kidney (Hek293) Cells

[0409] This study aimed to evaluate the in vitro concentration-response relationship of the effect of Archexin free acid on the current of hERG (human ether a-go-go-related gene) potassium channels (an IKr substitute that rapidly activates and delays rectifier cardiac potassium currents) stably expressed in the HEK293 cell line using a manual patch-clamp technique. Archexin free acid is the active pharmaceutical ingredient; the concentrations of the test sample in this report represent the concentrations of Archexin free acid.

[0410] Archexin free acid is soluble in extracellular solution (ECS) at concentrations up to 300 μM, with no visible precipitation. The ECS containing the highest concentration of Archexin free acid has a pH of 6.9, within the target range of 6.5 to 7.8. pH adjustment is not required in the treatment medium.

[0411] First, a dose range determination was performed to support the dose selection for the final determination. The final hERG determination was used to determine the IC50 of Archexin free acid.

[0412] Based on the solubility of Archexin free acid, ECS was selected as the solvent.

[0413] In dose-range assays, working solutions of Archexin free acid at 3, 30, and 300 μM were prepared. No precipitation was observed visually at any concentration. The effect of Archexin free acid on hERG currents was evaluated using three concentrations (3, 30, and 300 μM) with two cells per concentration. Archexin free acid inhibited hERG currents by 5.99%, 6.63%, and 11.69% at 3, 30, and 300 μM, respectively. Therefore, the concentrations used for the final hERG assays were 10, 30, 100, and 300 μM, with measured concentrations in the perfused solution of 9.591, 26.85, 105.6, and 274.1 μM, respectively.

[0414] In the final hERG assay, the working solutions were analyzed. The measured concentrations of the samples used for concentration validation were in the range of 82% to 104% of the nominal values, and the measured concentrations of the samples used for homogeneity were in the range of 98% to 102% of the nominal values. RSD (relative standard deviation) values ​​were within the acceptance criteria range. Archexin free acid was not detected in the carrier / negative control working solutions.

[0415] In the current study, the hERG current remained stable for at least 15 minutes in the negative control. Terfenadine at 100 nM inhibited the hERG current by 78.84%, within the range of historical positive control data. Sealing criteria, current amplitude, and leakage criteria met predefined ranges. All these data demonstrate the validity of the assay.

[0416] In the final hERG assay, three replicate cells were used for each concentration of Archexin free acid; no precipitation was observed at any concentration. Under the conditions of this study, the IC50 value for the inhibitory effect of Archexin free acid on hERG potassium current was not determined, and no inhibitory effect of Archexin free acid on human embryonic growth hormone potassium current was observed at postperfusion concentrations up to 274.1 μM.

[0417] The aim of this study was to evaluate the in vitro concentration-response relationship of the effect of Archexin free acid on the current of hERG (human ether-a-go-go-related gene) potassium channels (an IKr substitute, a rapidly activated, delayed rectified cardiac potassium current) stably expressed in the HEK293 cell line using manual patch-clamp technique.

[0418] Materials and Methods

[0419] Basic principles of ion channel and expression system selection

[0420] Cardiac hERG potassium channels are responsible for the rapid delayed rectified current (IKr) in human ventricles. Inhibition of IKr is the most common mechanism by which non-cardiac drugs increase the duration of ventricular action potentials. Increased action potential duration leads to QT interval prolongation on electrocardiograms, which is associated with the dangerous ventricular arrhythmia torsades de pointes. Therefore, the International Council for Harmonisation of Conventions (ICH) recommends testing the interaction of compounds with hERG potassium channels in heterologous expression systems as one of the non-clinical testing methods for evaluating the QT interval prolongation potential of test compounds. In this study, hERG channels were stably expressed in human embryonic kidney (HEK293) cells.

[0421] This experiment used the human embryonic kidney cell line HEK293-hERG. HEK293-hERG cells were obtained from Sophion Biosciences BPS Biosciences (San Diego, CA), and were subcultured and frozen at WuXi AppTec (Suzhou) Co., Ltd. Cells were stored in liquid nitrogen. Each batch of cell stock was tested to ensure it was free of mycoplasma contamination. Cells were not used after passage 20.

[0422] Culture medium and cell culture conditions

[0423] The complete culture medium was MEM medium supplemented with 10% fetal bovine serum, 1% non-essential amino acids, 1 mM sodium pyruvate, 400 μg / mL Geneticin@selective antibiotic (G418), and 1% penicillin / streptomycin. The recovered culture medium was MEM medium containing 10% fetal bovine serum, 1% non-essential amino acids, and 1 mM sodium pyruvate.

[0424] HEK293 hERG cells were cultured in air at 37°C (±2°C) in a humidified incubator with 5% CO2 (4% to 8%).

[0425] Cells were recovered using recycled medium and passaged in complete medium. In the final passage before patch-clamp experiments, the medium was replaced with recycled medium.

[0426] Solubility and pH test

[0427] The solubility of the test sample in ECS is up to 300 μM. In pH testing, the pH value containing the highest soluble concentration of ECS is 6.9, ranging from 6.5 to 7.8.

[0428] Dosage range determination

[0429] In the dose range assay, working solutions of the test sample were prepared at three concentrations: 3, 30, and 300 μM. The precipitate was visually inspected prior to testing. The three concentrations (3, 30, and 300 μM) were tested to assess the effect on hERG current, and two replicates were tested at each concentration.

[0430] Preparation of target cells

[0431] Exponentially growing HEK293-hERG cells were collected and suspended in ECS for use.

[0432] Manual Patch Clamp Setup

[0433] hERG currents were recorded at physiological temperatures (33°C–37°C) using whole-cell patch-clamp technology. The output signal of the patch-clamp amplifier was digitized and low-pass filtered at 2.9 kHz. Recording was controlled by Patchmaster Pro software.

[0434] The cell-inoculated recording chamber was mounted on the stage of an inverted microscope. One cell from the recording chamber was randomly selected for testing. Cells were continuously perfused from the perfusion system.

[0435] In the manual patch-clamp study, micropipettes filled with ICS were used as recording electrodes. The micropipettes were prepared on the day of the patch-clamp experiment using glass capillary tubing (BF150-117-10, SUTTER INSTRUMENT USA). After ICS filling, the pipette resistance (Rp) was in the range of 2 to 5 MO.

[0436] The cell voltage was clamped at a holding potential of -80 mV. The hERG current was activated by depolarizing at +60 mV for 850 ms, then the current was restored to -50 mV and held for 1275 ms to eliminate inactivation and observe the inactivation tail current; the peak tail current was measured and collected for data analysis. Finally, the voltage was reduced to the holding potential (-80 mV). This command voltage protocol was repeated continuously every 15 seconds during test sample administration. See Figure 9 .

[0437] During the initial recording of the carrier control working solution, the peak tail current amplitude was monitored until it stabilized for at least 10 scans. The average peak tail current amplitude of the last 5 scans during the monitoring period was used as the current amplitude (initial current) of the carrier control working solution.

[0438] Then, begin perfusion of the test sample at a low concentration and continue until the peak tail current amplitude stabilizes again for at least 10 scans, lasting at least 5 minutes. Then, apply a higher concentration of the test sample working solution. The average peak tail current amplitude of the last 5 scans for each concentration is used as the concentration-based peak tail current amplitude for data analysis.

[0439] Final hERG measurement

[0440] In the final hERG assay, working solutions of the test sample at four concentrations (10, 30, 100, and 300 μM) were tested based on the dose range assay results. Precipitation was visually inspected prior to testing. Three replicates of cells were tested for each concentration. Target cell preparation was performed as described in the dose range assay. Manual patch-clamp setup was performed as described in the dose range assay. Positive and negative controls were evaluated in the final assay.

[0441] negative control group

[0442] A negative control was performed in a separate set of cells (three cells) to assess current stability (decline or rise) over a recording period of at least 15 minutes. The average peak tail current amplitude of the last five scans every 5 minutes was used to assess current decline or rise. All values ​​were normalized to the values ​​of the previous 5 minutes and expressed as a percentage. A current decrease of less than 15% during the decline or rise measurement was considered acceptable.

[0443] Positive control

[0444] Terfenadine was used as a positive control to evaluate the effectiveness of the assay system. A final working solution of 100 nM positive control was prepared. The positive control was tested using three cell lines.

[0445] The inhibition rate of the positive control should be comparable to the range of historical positive control data to ensure consistent responsiveness of the testing system.

[0446] Quality control of manual patch clamp data acceptance

[0447] Sealing standard:

[0448] When acquiring a whole-cell configuration, a holding potential (e.g., -80 mV) is applied while membrane parameters (Cm, Rm, and Rs) are collected. A “good” full-cell record is typically defined as: series resistance (Rs) less than 10 MΩ; membrane resistance (Rm) greater than 500 MΩ; and membrane capacitance (Cm) less than 100 pF.

[0449] Current amplitude standard:

[0450] Before administering the test sample / positive control, the peak current amplitude must be between 400 pA and 5000 pA; otherwise, the cells are discarded.

[0451] Leakage Standard:

[0452] At a holding potential of -80mV, the absolute leakage current must be less than 200pA. The current amplitude is adjusted using the leakage current at -80mV. Scans with an absolute leakage current greater than 200pA were not used in the data analysis.

[0453] data

[0454] In each cell, the percentage inhibition value for each test sample / positive control concentration was calculated using the following formula:

[0455] (1 - Peak current amplitude of test sample / positive control working solution perfusion / Peak current amplitude of carrier control working solution perfusion (initial current)) x 100%.

[0456] The inhibition percentage values ​​of all recorded cells were averaged. The final IC50 value of the test sample was determined by fitting the concentration-response curve using Hill in Origin software.

[0457] y = the average of the suppression percentage values ​​of all recording units;

[0458] Where V max =100%; x = working solution concentration after perfusion of the test sample; n = Hill coefficient; k = concentration of the test sample at 50% inhibition. Data are expressed as mean ± SEM.

[0459] Data are expressed as mean ± SEM.

[0460] Where SD is

[0461] x = mean (number 1, number 2, ...); n = number of samples.

[0462] Acceptance Standards

[0463] During the monitoring period, the CV of the peak tail current amplitude in the last 10 consecutive scans of the carrier control was less than 10% to exclude an initial decrease or increase.

[0464] The steady current amplitude is defined as the CV of the peak current amplitude in 10 consecutive scans. If the average current amplitude of the 10 scans is less than 200 pA, then the CV is less than 10% or less than 30%.

[0465] If the average percentage inhibition value is less than 70%, the standard deviation (SD) of the percentage inhibition value across different record cells must be less than 15%. If the average percentage inhibition value is greater than 70%, the SD of the percentage inhibition value across different record cells must be less than 10%.

[0466] result

[0467] Solubility and pH test

[0468] The test sample is soluble in ECS at concentrations up to 300 μM, and no precipitation was observed visually at any concentration. In pH testing, the pH of ECS containing 300 μM of the test sample was 6.9, within the acceptable range of 6.5 to 7.8. Therefore, pH adjustment in the treatment medium is not required.

[0469] Working and post-infusion solution analysis

[0470] In the final hERG assay, the concentration of Archexin free acid in the carrier / negative control working solution was below the limit of the Quantificationx dilution factor, indicating the absence of Archexin free acid in the carrier / negative control working solution. Concentration analysis validated the concentrations of Archexin free acid in the 10, 30, 100, and 300 μM working solutions (all within 82% to 104% of the nominal concentration), confirming the accurate preparation of the test working solutions. Homogeneity analysis validated the homogeneity of Archexin free acid in the 10 and 300 μM working solutions (all within 98% to 102% of the nominal concentration, with RSDs of the top, middle, and bottom samples for both formulations within 1% to 2%), indicating that the test working solutions were homogeneous. The actual concentrations of the post-perfusion solutions corresponding to the working solutions at concentrations of 10, 30, 100, and 300 μM were 9.591, 26.85, 105.6, and 274.1, respectively.

[0471] Dosage range discovery assay

[0472] In the dose-range discovery assay, three concentrations (3, 30, and 300 μM) were tested to evaluate the effect of Archexin free acid on hERG current, and two replicating cells were tested for each concentration. The results of hERG current inhibition are shown in Table 31. At 3, 30, and 300 μM, the mean current inhibition rates were observed to be 5.99%, 6.63%, and 11.69%, respectively.

[0473] Table 31. Archexin free acid: hERG current suppression during dose range assays. NA: Not applicable; SD: Standard deviation; SEM: Standard mean error

[0474] Final measurement

[0475] Based on the results of the dose range assay, the concentrations of the working solution selected for the final hERG assay were 10, 30, 100, and 300 μM.

[0476] The hERG current inhibition data for the negative control are shown in Table 32; the hERG current inhibition data for the positive control are shown in Table 33. The Archexin free acid concentration response curve is shown in... Figure 10 As shown in the figure; Table 34 presents the hERG current suppression data for Archexin free acid.

[0477] Table 32. hERG current stability of the negative control in the final hERG assay. NA: Not applicable; SD: Standard deviation; SEM: Standard mean error

[0478] Table 33. Terfenadine: hERG current suppression in final hERG measurement. NA: Not applicable; SD: Standard deviation; SEM: Standard mean error

[0479] Table 34. Archexin free acid: hERG current suppression in the final hERG measurement. NA: Not applicable; SD: Standard deviation; SEM: Standard mean error

[0480] negative control

[0481] A negative control was tested in a separate set of three cells to assess current stability (decline or rise) during a recording period of at least 15 minutes. Results showed that no significant current decrease or increase was observed during recording.

[0482] Positive control (terfenadine)

[0483] Three replicating cells were tested with 100 nM terfenadine as a positive control. No precipitation was observed at any concentration. The inhibition rate of hERG current by 100 nM terfenadine was 78.84%, which is within the range of historical positive control data, demonstrating the effectiveness of the assay.

[0484] Archexin free acid

[0485] Three replicates of Archexin free acid were tested at each concentration. No precipitation was observed at any concentration. Based on the actual concentration of the solution after perfusion, the IC50 value of Archexin free acid for hERG current was greater than 274.1 μM.

[0486] in conclusion

[0487] In the current study, the hERG current remained stable for at least 15 minutes in the negative control. 100 nM terfenadine inhibited the hERG current by 78.84%, within the range of historical positive control data. Sealing criteria, current amplitude, and leakage criteria met predefined ranges, demonstrating the validity of the analysis. Under the conditions of this study, based on the actual concentration of the solution after perfusion, the IC50 value for the inhibition of hERG current by Archexin free acid was greater than 274.1 μM.

[0488] Example 7: WGI-0301 Gasorafenib

[0489] Advanced HCC indication

[0490] Hepatocellular carcinoma (HCC) is the most common type of cancer among adults in the United States. It is a primary malignant tumor of the liver that occurs in about 90% of patients with cirrhosis and the 5-year survival rate remains low (22% overall; 3.5% in patients with metastatic disease). Major risk factors for HCC include chronic hepatitis B or C virus infection, alcoholic liver disease, and non-alcoholic fatty liver disease or non-alcoholic lipoprotein hepatitis [1]. As of January 1, 2020, there were 102,997 people (<0.1% of the population) with liver and intrahepatic bile duct cancer in the United States. Between 2016 and 2020, there were 6.6 deaths per 100,000 people from liver and intrahepatic bile duct cancer. In 2023, the estimated number of new cases is 41,210 and the estimated number of deaths is 29,380 [2].

[0491] Several factors limit the effectiveness of treatment, including decreased liver function, chemotherapy-resistant tumors, and high expression of drug-resistant genes[3]. Meanwhile, HCC is a highly vascularized tumor in which angiogenesis plays an important role in tumor growth and metastasis[4].

[0492] The proposed clinical use of WGI-0301 is for the treatment of advanced hepatocellular carcinoma (HCC) as a second-line treatment for patients who have failed first-line immunotherapy (IO) in combination with a tyrosine kinase inhibitor (TKI) sorafenib. In recent years, immunotherapies or combinations of immunotherapies with better efficacy data have increasingly become the leading first-line treatment for advanced HCC. However, these patients receiving IO or IO combination therapy may eventually fail or become intolerant to first-line treatment, limiting sequential and extra-therapeutic options based on strong clinical evidence. As of the date of this application, this investigation received Orphan Drug Designation from the U.S. Food and Drug Administration on September 20, 2023.

[0493] Combined use of WGI-0301 and sorafenib

[0494] This study aimed to determine the median treatment dose (MTD) of WGI-0301 in combination with sorafenib for advanced HCC and to evaluate the safety and efficacy of WGI-0301 in combination with sorafenib for the treatment of adult patients with advanced unresectable HCC who have previously received PD-1 / PD-L1 immune checkpoint inhibitors.

[0495] The rationale for evaluating the combination of WGI-0301 and sorafenib in patients with advanced HCC, compared to sorafenib alone, is as follows:

[0496] Treatment of advanced HCC that has previously received PD-1 / PD-L1 immune checkpoint inhibitors remains an unmet medical need.

[0497] Systemic therapy plays a crucial role in the treatment of advanced hepatocellular carcinoma (HCC). Previously, the standard first-line systemic treatment for advanced HCC consisted only of sorafenib and lenvatinib. However, the rapid development of immunotherapy and molecularly targeted therapies has altered the systemic treatment strategy for advanced HCC. Second-line systemic therapies include regorafenib, cabozantinib, and ramucirumab. All current options are approved for patients who have previously received sorafenib. The treatment prospects for advanced HCC following disease progression or toxicity after first-line treatment differ from the past. The combination therapy of atezolizumab and bevacizumab (Atezo-Bev) is currently the preferred first-line treatment due to its superior survival benefit compared to sorafenib. [5] Limited data exist to guide the selection of second-line therapy for patients whose progression occurs with first-line immunotherapy. For patients who have previously received PD-1 / PD-L1 immune checkpoint inhibitors and whose liver function is adequately protected, the optimal method for prioritizing available systemic therapies has not yet been established. Therefore, a significant unmet medical need remains for patients with advanced HCC who have progressed on immunotherapy or are intolerant to immunotherapy.

[0498] Sorafenib as a single-drug therapy for advanced HCC represents a significant advancement in treatment.

[0499] Sorafenib has a well-studied safety profile and good patient accessibility, with years of clinical experience. It was the first systemic therapy in HCC to demonstrate superior overall survival (OS) compared to placebo in a randomized controlled trial[6]. It has been used globally for over a decade to treat advanced HCC. However, combinations of Atezo-Bev or durvalumab-trimelimumab have shown superior OS outcomes compared to sorafenib[5,7]. Sorafenib has been used as an alternative to first-line treatment for patients with contraindications or limited access to atezo-Bev or durvalumab-trimelimumab, or as an empirical second-line treatment following IO therapy. As some small-sample retrospective studies have shown, sorafenib may provide a modest survival benefit compared to placebo in patients with advanced HCC who have progressed after Atezo-Bev treatment[8]. In addition to empirical use, the role of sorafenib combination regimens as a second-line treatment in patients who have progressed after first-line IO therapy remains undetermined.

[0500] The combination of WGI-0301 and sorafenib has shown potential synergistic antitumor activity in HCC.

[0501] WGI-0301 has the potential to enhance the antitumor effects of sorafenib through multiple mechanisms of action (MoA). A synergistic effect of co-administration of WGI-0301 and sorafenib was observed in preclinical models, leading to enhanced angiogenesis inhibition and tumor growth inhibition. This combination therapy has attracted attention due to the absence of significant cytochrome P450 enzyme interactions with WGI-0301, suggesting a reduced likelihood of pharmacokinetic drug interactions compared to concomitant sorafenib treatment. Preliminary assessments suggest that the safety and efficacy of the WGI-0301 and sorafenib combination make it a promising candidate for the treatment of advanced HCC, particularly in patients resistant to PD-1 / PD-L1 inhibitors. Ongoing studies of this combination therapy may offer a new prospect for HCC management, marking an important step forward in the search for more effective cancer treatments.

[0502] The combination of WGI-0301 and sorafenib may provide a mechanism to overcome sorafenib resistance.

[0503] Sorafenib remains the cornerstone treatment for HCC, supported by strong evidence and clinical experience. Unfortunately, the development of sorafenib resistance is becoming increasingly common due to compensatory activation of the PI3K / AKT pathway.

[0504] Drug resistance is a complex phenomenon involving multiple mechanisms, including activation of signaling pathways such as phosphatidylinositol 3-kinase (PI3K) / AKT / rapamycin mammalian target of TOR (mTOR). Sorafenib can activate the PI3K / AKT pathway, and the potential compensatory mechanism provided by the PI3K / AKT pathway can lead to drug resistance to sorafenib in HCC patients [9]. Current preclinical and clinical evidence suggests that inhibitors of the PI3K / AKT / mTOR pathway may be used in combination with other anticancer therapies to circumvent drug resistance in cancer cells.

[10] Dual blockade with AKT-1 inhibitors may prevent or delay the development of resistance. Therefore, there is an opportunity to explore whether different treatment combinations can overcome sorafenib resistance and improve response in HCC patients. The combination therapy strategy of WGI-0301 with sorafenib warrants further investigation.

[0505] Indications

[0506] The combination of WGI-0301 and sorafenib will be studied in patients with advanced HCC who have previously received PD-1 / PD-L1 immune checkpoint inhibitor therapy.

[0507] General methods

[0508] This study will investigate whether the combination of WGI-0301 and sorafenib can improve clinical outcomes in second-line patients with advanced HCC. It follows a two-phase design, including a dose-escalation phase (Phase 1: advanced HCC patients) and a dose-expansion phase (Phase 2: advanced HCC patients who have received a series of immunotherapies).

[0509] The first phase will employ a traditional 3+3 study design to explore the MTD / RP2D of WGI-0301 in combination with sorafenib, and to evaluate the pharmacokinetic (PK), PD, safety, tolerability, and preliminary efficacy of the combination therapy for advanced HCC. The starting dose of WGI-0301 will be 0.6 mg / kg / week, followed by 400 mg of sorafenib orally twice daily. In the first phase, three dose levels of WGI-0301 (0.6, 1.0, and 1.3 mg / kg / week) will be used in combination with sorafenib. Once the Safety Monitoring Committee (SMC) determines the MTD / RP2D of WGI-0301 from the first phase, the second phase will begin immediately.

[0510] In the second phase, patients will receive combination therapy with different WGI-0301 dose levels and standard dose sorafenib, or standard dose sorafenib alone, in a ratio of 2:2:1, to evaluate the safety and efficacy in patients with advanced HCC who have previously received at most one line of PD-1 / PD-L1 immune checkpoint inhibitors or combination therapy in a first-line setting.

[0511] Phases one and two will be conducted in the United States and China. Phase one will begin at the U.S. site once FDA approval is received, regardless of the status of the Chinese site. When more than one site is activated, the study will proceed with a competitive registration process.

[0512] Type of clinical trial conducted in the first year after submission

[0513] An open-label Phase 2 study of WGI-0301 in combination with sorafenib as second-line treatment for patients with advanced HCC will be conducted in the United States and China. Phase 1 will begin at the U.S. site once FDA approval is received, regardless of the status of the Chinese site. The study will proceed with competitive registration when more than one site is activated. Phase 2 will begin immediately once SMC determines the MTD / RP2D for WGI-0301 in combination with sorafenib from Phase 1.

[0514] Expected number of patients

[0515] The first phase will recruit approximately 9 to 18 participants, and the second phase will recruit approximately 50 participants.

[0516] risk

[0517] As of October 30, 2023, 11 patients with advanced solid tumors were enrolled in the ongoing Phase 1 clinical trial of WGI-0301 monotherapy (WGI0301P1U, NCT05267899). Dose escalation is underway, and no treatment-related latency (DLT) was observed at dose levels up to 0.6 mg / kg / week. In the WGI-0301 monotherapy clinical trial (WGI0301P1U), the most common adverse events (≥20% of patients) were dehydration, anemia, infusion-related reactions, and hyperglycemia, regardless of causality. To date, no grade 3 or higher treatment-related adverse events (TRAEs) or treatment-related serious adverse events have been observed. Further clinical trial data will continue to be collected and the patient will be closely monitored to determine the safety of WGI-0301.

[0518] Infusion reaction

[0519] For infusion reactions, it is crucial for clinicians to identify and differentiate anaphylactic reactions. While the two reactions may have overlapping characteristics, anaphylactic reactions involve respiratory impairments (such as wheezing, dyspnea, or cyanosis), decreased blood pressure, or end-organ dysfunction, which are typically uncommon in standard infusion reactions. As of October 30, 2023, in the safety analysis dataset, 3 out of 11 subjects (27.3%) experienced mild to moderate infusion reactions without any pretreatment. For events associated with WGI-0301, the category of adverse events tended to be those that occurred during or shortly after treatment with LNP-containing infusion products, based on symptom severity, absence of respiratory failure, and response to treatment (steroids and antihistamines). The exact cause of infusion reactions to LNP products is not always clear, but they are thought to be due to either an immune response to the body to the LNP itself or the payload delivered by the LNP. Components of LNP formulations, such as lipid mixtures, may also play a role in these reactions. To minimize the chances of such events, a prophylactic regimen containing corticosteroids and antihistamines is recommended, with or without nonsteroidal anti-inflammatory drugs (NSAIDs). This regimen has been used in a Phase I study recommended by the SMC committee. Serum trypsin testing will also be performed to help rule out anaphylactic reactions. However, vigilance should be maintained on-site, utilizing available emergency medications and equipment to differentiate between anaphylactic reactions and infusion reactions.

[0520] Hepatotoxicity

[0521] Regarding hepatotoxicity, as of October 30, 2023, no clinically significant increases in liver function tests (LFT) were observed in the Phase I study. Furthermore, in the global sorafenib monotherapy database, 2 out of 3357 patients (0.06%) experienced severe drug-induced liver injury, defined as an increase in transaminase levels exceeding 20 times the upper limit of normal or elevated transaminase levels accompanied by severe clinical sequelae (e.g., elevated INR, ascites, death, or transplantation). However, when using WGI-0301 and sorafenib to treat patients with advanced HCC, even for Child-Pugh class A patients, a careful balance must be struck between therapeutic efficacy and hepatotoxicity potential. Therefore, this study will perform frequent LFTs to detect any early signs and conduct clinical assessments. Once an increase in LFT is detected, researchers should address any significant increase in liver enzymes or bilirubin levels by interrupting treatment or immediately reducing the dose, as specified in Section 6.2 of the study protocol.

[0522] Immunogenicity

[0523] No antibody formation or immune response to oligonucleotide administration has been known to date. No immunogenic activity was detected in patients during the Phase 1 and Phase 2 clinical trials of Archexin. However, WGI-0301 is an LNP-encapsulated version of Archexin, and the immunogenicity of the encapsulated API and the lipid nanoparticles themselves is planned to be tested during the study. Assay methods for measuring binding and neutralizing antibodies are under development. Once validated, collected samples will be tested for immunogenicity in the proposed study.

[0524] Immune-related adverse events

[0525] Immune-related adverse events (irAEs) received particular attention in the FIH study of WGI-0301, including discontinuation rules and management plans. However, to date, no reports of immune-related adverse events or cytokine release syndromes have been received. Due to the complexity of dose relationships and the fact that the immune system's response to treatment is not always predictable, careful monitoring of all patients receiving immunotherapy, regardless of dose, is crucial. Dose adjustments, treatment pauses or discontinuations, and the use of corticosteroids or other immunosuppressants are common strategies for managing irAEs when they occur.

[0526] High blood sugar

[0527] For hyperglycemia, reports of other cancer treatments targeting the PI3K / AKT pathway have been noted. This pathway plays a crucial role in controlling insulin sensitivity and glucose metabolism.

[11] Therefore, hyperglycemia is one of the most common adverse reactions to PI3K / AKT inhibitors. Management of this side effect is crucial, and hyperglycemia induced by this treatment should be treated according to current experience and consensus, following ADA guidelines or other local guidelines.

[0528] Other risks or risks related to sorafenib

[0529] For other potential risks associated with combination therapy, such as gastrointestinal reactions, abdominal pain, fatigue, or other nonspecific adverse events, every effort should be made to collect, report, and manage them. Regarding the risks listed on the sorafenib label, the most common side effects observed in at least 20% of patients are considered to be related to sorafenib, including fatigue, weight loss, rash / peeling, hand-foot skin reaction, hair loss, diarrhea, anorexia, nausea, and abdominal pain. For other risks for patients taking sorafenib, please refer to the sorafenib prescribing information.

[0530] References 1.Asafo-Agyei,Kwabena O.“Hepatocellular Carcinoma.”StatPearls-NCBIBookshelf,12 Feb.2023. 2.SEER*Explorer Application.seer.cancer.gov / statistics-network / explorer / application.html?site=35&data_type=5&graph_type=12&compareBy=sex&chk_sex_1=1&chk_sex_3=3&chk_sex_2=2&series=9&race=1&age_range=1&prev_duration=1&advopt_precision=1&hdn_view=1&advopt_show_apc=on&advopt_display=2. 3.Marin,Jose J.G.,et al.“Molecular Bases of Drug Resistance inHepatocellular Carcinoma.”Cancers,vol.12,no.6,MDPI,June 2020,p.1663. 4.Yang,Zhen,and Ronnie T.P.Poon.“Vascular Changes in HepatocellularCarcinoma.”Anatomical Record-advances in Integrative Anatomy and EvolutionaryBiology,vol.291,no.6,Wiley,June 2008,pp.721–34. 5.Finn RS,Qin S,Ikeda M,et al.Atezolizumab plus Bevacizumab inUnresectable Hepatocellular Carcinoma.N Engl J Med.2020 May 14.382(20):1894-1905. 6.Llovet JM,Ricci S,Mazzaferro V,et al.SHARP Investigators StudyGroup.Sorafenib in advanced hepatocellular carcinoma.N Engl J Med.2008 Jul24.359(4):378-90. 7.Abou-Alfa GK,Chan SL,Kudo M et al.Phase 3 randomized,open-label,multicenter study of Tremelimumab(T)and Durvalumab(D)as first-line therapy inpatients(pts)with unresectable hepatocellular carcinoma(uHCC):HIMALAYA.J ClinOncol 2022.40(4Suppl.):379. 8.Yoo C,Kim JH,Ryu MH et al.Clinical Outcomes with MultikinaseInhibitors after Progression on First-Line Atezolizumab plus Bevacizumab inPatients with Advanced Hepatocellular Carcinoma:A Multinational MulticenterRetrospective Study.Liver Cancer.2021 Apr;10(2):107-114.[6]Neeraj Agarwal,Sumanta K.Pal,Richard C,et al.Results of a phase II study to evaluate thesafety and efficacy of RX-0201 in combination with everolimus in subjectswith metastatic renal cell carcinoma(mRCC).J Clinical Oncol 37:646–646. 9.Manning BD,Toker A.AKT / PKB Signaling:Navigating theNetwork.Cell.2017 Apr 20;169(3):381-405. 10.Fruman DA,Chiu H,Hopkins BD,et al.The PI3K Pathway in HumanDisease.Cell.2017 Aug 10;170(4):605-635. 11.Huang X,Liu G,Guo J,et al.The PI3K / AKT pathway in obesity and type2 diabetes.Int J Biol Sci.2018 Aug 6;14(11):1483-1496.doi:10.7150 / ijbs.27173. 12.Qin,Shukui,et al.“Pembrolizumab Versus Placebo as Second-LineTherapy in Patients From Asia With Advanced Hepatocellular Carcinoma:ARandomized,Double-Blind,Phase III Trial.”Journal of Clinical Oncology,vol.41,no.7,American Society of Clinical Oncology,Mar.2023,pp.1434–43. 13.“American Cancer Society|Cancer Facts and Statistics.”https: / / cancerstatisticscenter.cancer.org / data-analysis / 91Q4dqjU 14.“American Cancer Society|Cancer Facts and Statistics.”https: / / cancerstatisticscenter.cancer.org / data-analysis / dw1qthUo

[0531] Example 8: In vivo efficacy evaluation of WGI-0301 in combination with a tyrosine kinase inhibitor (TKI) (lenvatinib, sorafenib, or cabozantinib) in female Balb / c nude mice for the treatment of a human hepatocellular carcinoma Hep3B-luc in situ model.

[0532] Archexin is a fully thiolated 20-meric antisense oligonucleotide complementary to AKT-1 mRNA, inhibiting AKT-1 messenger RNA translation and downstream pathway activity. WGl-0301 is a proprietary lipid nanoparticle formulation of Archexin (QTsome). TM The aim is to enhance delivery. Currently, a Phase I clinical trial is underway in the United States using WGl-0301 as a monotherapy for patients with advanced solid tumors. Given the limited efficacy of TKIs compared to immunotherapy and the increasing resistance, the combination of WGl-0301 and TKl may enhance the treatment response to TKl by enhancing angiogenesis blockade, inhibiting AKT-1, and overcoming resistance.

[0533] Efficacy study of WGI-0301 in combination with lenvatinib, sorafenib, or cabozantinib in the treatment of female Balb / c nude mice with a Hep3B-luciferase in situ hepatocellular carcinoma model. Sixty-four female Balb / c nude mice were randomly divided into two groups (n=8 per group), including a vector control group. Mice were treated with WGI-0301 or lenvatinib, sorafenib, or cabozantinib, or WGI-0301 in combination with lenvatinib / sorafenib / caozantinib for 28 days. WGI-0301 was administered intravenously at 8 mg / kg once weekly for four weeks, and lenvatinib / sorafenib / caozantinib was administered orally at doses of 10 mg / kg, 20 mg / kg, and 20 mg / kg, respectively, for 28 days. Body weight was monitored twice weekly. Whole-body fluorescence imaging was performed twice weekly, and tumor burden was measured using bioluminescence. After treatment discontinuation, treatment was paused from day 29 to day 70 to observe survival.

[0534] Table 35. Group and Processing Information. aN: Animal ID. b. Lenvatinib and cabozantinib were prepared in DMSO:0.5% CMC-Na = 1:49 (v / v), and sorafenib was prepared in cremophor. In an EL:(95%) ethanol ratio of 1:1 (v / v), WGI-0301 was prepared in physiological saline. The carrier for Group 1 was physiological saline. c. Dosage volume: Adjust the dosage volume to 10 μL / g according to body weight. d. PG-D0 patients were grouped, and treatment began with PG-D1. Lenvatinib, sorafenib, and cabozantinib were administered via QD, while the carrier and WGI-0301 were administered via QW. e. From PG-D29 onwards, treatment was paused until PG-D70 for survival observation, with body weight measured twice a week and bioluminescence measured once a week.

[0535] Experimental methods

[0536] Cell culture

[0537] Hep3B-luc tumor cells (from Wuxi) were maintained in vitro in EMEM medium at 37°C under a 5% CO2 atmosphere in air, in a medium supplemented with 10% fetal bovine serum and 1% antibiotic antifungal agent. Tumor cells were routinely passaged twice weekly. Cells in the exponential growth phase were harvested and counted for tumor inoculation.

[0538] Tumor inoculation

[0539] Each mouse was inoculated with 0.02 mL of tumor cells (3 x 10⁻¹) of a mixture of DPBS and Matrigel (volume ratio = 1:1) in the left lobe of the liver. 6 This was used to promote tumor development. On day 4 after cell inoculation, when the tumor reached 3.85 x 10⁻⁶ cm, [the tumor was detected]. 7 At the average bioluminescence value of photons / second, mice were randomly grouped and administered the drug on the second day after grouping, with 8 mice in each group. Animals were randomly grouped as PG-D0, and the first day of administration was PG-D1. Animals were grouped using Excel-based randomization software, stratified according to their bioluminescence values. Each group consisted of 8 tumor-bearing mice. The test drug was administered to the mice according to the predetermined protocol shown in the experimental design table (Table 35).

[0540] Preparation of carrier solvent and test formulation

[0541] Table 36. Formulations of the test sample. Note: a. Stock solutions of lenvatinib, sorafenib, and cabozantinib should be stored at -20°C. b. The diluents for lenvatinib and cabozantinib should be maintained at 4°C and used within 3 days of preparation. Sorafenib and WGI-0301 should be freshly prepared before use. c.PG-D1 begins processing.

[0542] observe

[0543] All animal care and use protocols and any amendments or procedures involved in this study were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of WuXi AppTec before implementation. During the study, animal care and use were conducted in accordance with the guidelines of the Association for Assessment and Certification of Laboratory Animal Care (AAALAC). Morbidity and mortality were assessed daily post-vaccination. During routine monitoring, animals were examined for tumor growth and the effects of treatment on normal behavior, such as activity level, food and water consumption, weight gain / loss, eye / hair pads, and any other abnormal effects. Mortality and observed clinical signs were recorded based on the number of animals in each subset.

[0544] Tumor measurements and endpoints

[0545] Mice that underwent surgical inoculation were weighed and intraperitoneally injected with fluorescein at a dose of 150 mg / kg. Ten minutes after the injection, the animals were pre-anesthetized with a mixture of oxygen and isoflurane. When the animals were fully anesthetized, they were moved into the imaging chamber for bioluminescence measurements using an IVIS (Lumina III) imaging system.

[0546] The primary endpoint is whether tumor bioluminescent growth can be delayed, reduced, or eliminated. Another primary endpoint is the survival of mice after treatment, such as the death of a mouse or mice meeting the criteria for euthanasia. It can prevent tumor bioluminescent metastasis or cure mice. Body weight should be measured twice weekly. During treatment, bioluminescence values ​​of the entire animal (including primary and metastatic tumors) should be measured and recorded twice weekly. Survival should be monitored after treatment, with bioluminescence values ​​measured weekly. A veterinary notification must be completed if the animal's health deteriorates, dies (significant weight loss, more than 20%), is unable to eat or drink normally, or experiences difficulty moving or paralysis. If necessary, the animal should be euthanized immediately with carbon dioxide after veterinary evaluation. The RTB of each mouse should be calculated using the following formula: RTB = B t / B0, B t B0 is the tumor bioluminescence value of the mouse on a given date, and B0 is the tumor bioluminescence value of the mouse on the day it was grouped.

[0547] The T / C value (expressed as a percentage) is an indicator of anti-tumor efficacy; the T / C (%) for each group is calculated using the following formula: T / C% = T RTB / C RTB x 100, T RTB C is the mean RTB of the treatment group on a given date. RTB It is the mean RTC of the carrier control group on the same day as the treatment group.

[0548] Calculate the TGI for each group using the following formula: TGI(%) = [1 - (Ti -T0) / (C i- C0)]×100;T i C represents the mean tumor bioluminescence value of the treatment group on a given day, where T0 is the mean tumor bioluminescence value of the treatment group on the first day of treatment. i C1 represents the average tumor bioluminescence value of the carrier control group on the day Ti was added, and C0 represents the average tumor bioluminescence value on the first day of treatment in the carrier group.

[0549] The average survival time (in days) of each group was calculated based on the survival time of the animals in each group, and the extended lifespan was analyzed based on the average survival time of the treatment group and the excipient group.

[0550] Statistical analysis

[0551] Summary statistics of bioluminescence for each group at each time point are provided, including the mean and standard error of the mean (SEM). Statistical analysis was performed on bioluminescence according to PG-D24 to assess differences between groups. The t-test was used for comparisons between two groups. Multiple comparison tests using Dunnett's one-way ANOVA were performed for comparisons between groups. Data were analyzed using SPSS and GraphPad Prism 9. p < 0.05 was considered statistically significant.

[0552] result

[0553] The results showed that the combination group (WGI-0301 with lenvatinib, sorafenib, or cabozantinib) had a better antitumor effect (TGI: 66.05%, 86.81%, 75.89%) than the lenvatinib / sorafenib / caozantinib group (TGI: 50.84%, 55.68%, 47.84%). The fluorescence signal intensity of the combination group was 56.74*10⁻⁶. 8 22.28*10 8 40.40*10 8 The photons / second ratio was slightly lower than that of the lenvatinib / sorafenib / cazozidinib group (81.97*10). 8 73.95*10 8 86.96*10 8 (Photons / second). The median survival (MST) in the combination therapy groups was 55.5, 58.0, and 53.5 days, slightly higher than that in the lenvatinib / sorafenib / cazozinib group (46.0, 55.5, and 51.5 days). Based on limited safety endpoints (mortality, clinical signs, and body weight), no significant increase in toxicity was observed in mice treated with WGI-0301 in combination with lenvatinib 8+10 mg / kg, WGI-0300 in combination with sorafenib 8+20 mg / kg, and WGI-030 in combination with cabozantinib 8+20 mg / kg compared to the lenvatinib / sorafenib / cazozinib monotherapy groups. No serious adverse events were observed in the combination therapy groups.

[0554] Compared to the currently used lenvatinib / sorafenib / cazozantinib in clinical practice, the combination of WGI-0301 with lenvatinib / sorafenib / cazozantinib has shown superior antitumor efficacy. Without a significant increase in toxicity, the combination of WGI-0301 with TKIs has demonstrated superior antitumor efficacy compared to TKI monotherapy.

[0555] The results are as follows Figures 11-18 As shown in Tables 35-42.

[0556] Mortality rate, clinical observation and weight gain / loss

[0557] Animal weight was monitored regularly as an indirect measure of toxicity. During treatment, mice #8-3 in group 4 (sorafenib, 20 mg / kg, orally, QD x 4W) lost more than 15% of their weight at PG-D24 and were provided with dietary gels from PG-D25 to PG-D27 to maintain their weight. According to veterinary necropsy, mice #1-1 in group 1 (carrier, intravenously, QW x 4W) died at PG-D27, possibly due to deterioration in health caused by the large tumor.

[0558] In the vector group, three mice developed abdominal enlargement and in situ liver protrusion 17 days after administration. In the WGI-0301, lenvatinib, and cabozantinib groups, abdominal distension and liver protrusion were observed in six, one, and one mouse, respectively, at days 21, 21, and 24 after administration. No significant abnormalities were observed in the other treatment groups during treatment. Details of the clinical observations are shown in Table 37.

[0559] The body weight (BW) and BW change curves in the Hep3B-luc model efficacy study are shown below. Figure 11 and Figure 12 As shown.

[0560] Table 37. Clinical Symptoms

[0561] Bioluminescence curve

[0562] The tumor bioluminescence curves after administration of the test product to female Balb / c nude mice with Hep3B-luc tumors are as follows: Figure 14 As shown.

[0563] Bioluminescence intensity

[0564] Tables 38 and 39 show the average bioluminescence values ​​over time in female Balb / c nude mice carrying human cancer cells Hep3B-luc.

[0565] Table 38. Bioluminescence values ​​(x10⁸ photons / second) over time during mouse treatment. a. Data are shown as mean ± SEM. b. Number of days after grouping. c. Due to animal mortality, the bioluminescence data after PG-D24 are incomplete.

[0566] Table 39. Bioluminescence values ​​(x10⁸ photons / second) over time during the survival observation period after mouse treatment. a. Data are shown as mean ± SEM. b. Bioluminescence data during the number of days after grouping and during the survival observation period.

[0567] Tumor growth inhibition analysis

[0568] Based on bioluminescence measured on PG-D24, the tumor growth inhibition of the test product for treating female Balb / c nude mice carrying human hepatocellular carcinoma Hep3B-luc was calculated. Data are shown in Tables 40 and 41.

[0569] Table 40. Tumor growth inhibition analysis (calculated based on bioluminescence data obtained on PG-D24). a. Data are presented as mean ± SEM. Data analysis is based on the bioluminescence of PG-D24, not PG-D28, because the bioluminescence data for PG-D28 were incomplete due to animal mortality. b. Tumor growth inhibition (TGI) is calculated using the following formula: TGI(%) = [1 - (T... 24 -T0) / (C 24 -C0)]×100, where T 24 = Mean bioluminescence value of PG-D24 in the treatment group, C 24 = Mean biofluorescence value of PG-D4 in the control group. Antitumor activity (T / C) was calculated using the following formula: T / C% = T RTB / C RTB x 100, where T RTB =Mean RTB of the treatment group PG-D24, C RTB = Mean RTB of the control group PG-D4. c. Perform one-way ANOVA using SPSS to compare the bioluminescence values ​​of the carrier group and the treatment group. ns: no statistical significance, * indicates p<0.05.

[0570] Table 41. Tumor growth inhibition analysis (calculated based on bioluminescence data obtained from PG-D24). a. Perform an independent samples t-test using SPSS to compare the bioluminescence values ​​of group 3 and group 6. ns: No significant difference. b. Perform an independent samples t-test using SPSS to compare the bioluminescence values ​​of group 4 and group 7. ns: No significant difference. c. Perform an independent samples t-test using SPSS to compare the bioluminescence values ​​of group 5 and group 8. ns: No significant difference.

[0571] Survival

[0572] According to the IACUC protocol, animals whose health deteriorated due to excessive tumor size or severe weight loss were euthanized. The survival time of the observed animals was 42 days. The mean survival time of animals in the vector group was 37.63 days. The mean survival times of animals in groups 2 (WGI-0301, 8 mg / kg), 3 (lenvatinib, 10 mg / kg), 4 (sorafenib, 20 mg / kg), 5 (cazozantinib, 20 mg / kg), 6 (WGI-0301 + lenvatinib, 8 + 10 mg / kg), 7 (WGI-0301 + sorafenib, 8 + 20 mg / kg), and 8 (WGI-1031 + cabozantinib, 8 + 20 mg / kg) were 35.88, 47.00, 53.25, 52.25, 53.00, 58.88, and 53.75 days, respectively. The mean survival rates for the treatment groups were 95.35%, 124.90%, 141.51%, 138.85%, 140.85%, 156.47%, and 142.84%, respectively. The median survival in the vector group was 35 days. The median survival times of animals in groups 2 (WGI-0301, 8 mg / kg), 3 (lenvatinib, 10 mg / kg), 4 (sorafenib, 20 mg / kg), 5 (cazozantinib, 20 mg / kg), 6 (WGI-0301 + lenvatinib, 8 + 10 mg / kg), 7 (WGI-0301 + sorafenib, 8 + 20 mg / kg), and 8 (WGI-1031 + cabozantinib, 8 + 20 mg / kg) were 35.5, 46.0, 55.5, 51.5, 55.5, and 53.5 days, respectively.

[0573] The Kaplan-Meier survival curves for each group of animals are as follows: Figure 15 ,16 As shown in Figure 17. The survival time analysis results are shown in Table 42.

[0574] Table 42. Survival time analysis. a. Mean survival time ± SEM. b. The mean survival rate (%) is calculated by dividing the mean survival time of the drug group by the mean survival time of the control group. c. Based on the survival analysis of the GraphPad Prism 9 versus the vector group, calculate the median and p-value according to the survival time. **: p < 0.01, *: p < 0.05, ns: no significance.

[0575] Results Summary and Discussion

[0576] In this study, the efficacy of WGI-0301 in combination with lenvatinib, sorafenib, or cabozantinib in treating a human hepatocellular carcinoma Hep3B-luc in situ model was investigated in female Balb / c nude mice.

[0577] Regularly monitor animal weight as an indirect measure of toxicity. Body weight and changes in body weight after administration of the test substance are as follows: Figure 11 and Figure 12 As shown. On day 27 of administration, mouse #1-1 in the vector group died. Veterinary necropsy evaluation suggested this may be related to performance decline caused by tumor overload. Mice treated with lenvatinib 10 mg / kg and sorafenib 20 mg / kg (monotherapy or combination therapy) experienced a slight decrease in body weight during treatment. Endpoint data based on mortality, clinical symptoms, and body weight showed no material increase in toxicity in mice treated with WGI-0301 + lenvatinib 8 + 10 mg / kg, WGI-0301 + sorafenib 8 + 20 mg / kg, and WGI-0301 + cabozantinib 8 + 20 mg / kg combination therapy compared to the lenvatinib / sorafenib / cazozantinib monotherapy group.

[0578] Both T / C and TGI are indicators of antitumor efficacy. Data for PG-D24 are shown in Tables 40 and 41. Compared with the vector group (bioluminescence = 166.36 x 10⁻⁶),... 8 Compared to (photons / second), WGI-0301+sorafenib 8+20mg / kg and WGI-0301+cazozidinib 8+20mg / kg exhibited significant antitumor activity, with an average bioluminescence of 22.28x10⁻¹⁰. 8 Photons / second (T / C = 12.75%, TGI = 86.81%, p = 0.014) and 40.40 x 10 8The mean bioluminescence activity was 161.59 x 10⁻⁶ photons / second (T / C = 23.52%, TGI = 75.89%, p = 0.030). Meanwhile, WGI-0301 8 mg / kg, lenvatinib 10 mg / kg, sorafenib 20 mg / kg, cabozantinib 20 mg / kg, and WGI-0301 + lenvatinib 8 + 10 mg / kg showed mild tumor-suppressive activity, with a mean bioluminescence activity of 161.59 x 10⁻⁶. 8 Photons / second (T / C = 98.53%, TGI = 2.87%, p = 1.000), 81.97 x 10⁻⁶ 8 Photons / second (T / C = 51.36%, TGI = 50.84%, p = 0.249), 73.95 x 10⁻⁶ 8 Photons / second (T / C = 33.80%, TGI = 55.68%, p = 0.327), 86.96 x 10⁻⁶ 8 Photons / second (T / C = 46.38%, TGI = 47.84%, p = 0.392) and 56.74 x 10 8 Photons / second (T / C = 33.59%, TGI = 66.05%, p = 0.064). Based on T / C and TGI data, the combination therapy groups WGI-0301 + lenvatinib 8 + 10 mg / kg (TGI = 66.05%), WGI-0301 + sorafenib 8 + 20 mg / kg (TGI = 86.81%), and WGI-0301 + cabozantinib 8 + 20 mg / kg (TGI = 75.89%) showed superior antitumor efficacy compared to the monotherapy groups lenvatinib 10 mg / kg (TGI = 50.84%), sorafenib 20 mg / kg (TGI = 55.68%), and cabozantinib 20 mg / kg (TGI = 47.84%).

[0579] Animal survival was observed for 42 days after the completion of 28 days of treatment. Animals died or were euthanized according to the IACUC protocol due to significant weight loss or deterioration of health. The mean and median survival times of the vector group animals were 37.63 days and 35 days, respectively. The mean and median survival times of animals treated with WGI-0301 8 mg / kg, lenvatinib 10 mg / kg, sorafenib 20 mg / kg, cabozantinib 20 mg / kg, WGI-0301+lenvatinib 8+10 mg / kg, WGI-031+sorafenib (8+20 mg / kg), and WGI-0301+cabozitinib (8+20 mg / kg) were 35.88 and 35.50 days, 47.00 and 46.00 days, 53.25 and 55.50 days, 52.25 and 51.50 days, 53.00 and 55.50 days, 58.88 and 58.00 days, and 53.75 and 53.50 days, respectively. Compared with the vector group, sorafenib 20 mg / kg, WGI-0301 + lenvatinib 8 + 10 mg / kg, WGI-0301 + sorafenib 8 + 20 mg / kg, and WGI-0301 + cabozantinib 8 + 20 mg / kg significantly prolonged the survival time of mice bearing Hep3B-luc orthotopic tumors. Compared with monotherapy, combination therapy showed slightly longer survival time in mice.

[0580] In summary, mice treated with WGI-0301 in combination with sorafenib (8+20 mg / kg) and WGI-0301 in combination with cabozantinib (8+20 mg / kg) showed significant antitumor effects against Hep3B-luc orthotopic tumor-bearing mice and prolonged their survival. Sorafenib 20 mg / kg and WGI-0301 + lenvatinib 8+10 mg / kg showed mild tumor-suppressive effects and also prolonged mouse survival. Without a significant increase in toxicity, compared with monotherapy, WGI-0301 in combination with lenvatinib / sorafenib / caozantinib showed better inhibition of tumor growth in Hep3B-luc orthotopic tumor-bearing mice and better prolonged their survival.

[0581] The scope of the compositions and methods in the appended claims is not limited to the specific compositions and methods described herein, which are intended to illustrate several aspects of the claims, and any functionally equivalent compositions and methods are intended to fall within the scope of the claims. Various modifications to the methods other than those shown and described herein are intended to fall within the scope of the appended claims. Furthermore, although only certain representative compositions and method steps disclosed herein are specifically described, other combinations of these compositions and method steps are also intended to fall within the scope of the appended claims, even if not specifically stated. Therefore, combinations of steps, elements, components, or ingredients may be explicitly or less explicitly referred to herein; however, other combinations of steps, elements, components, and ingredients are included, even if not explicitly stated. As used herein, the term “comprising” and variations thereof are used synonymously with the term “including” and variations thereof and are open-ended, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consistently consisting of” and “consisting of” may be used in place of “comprising” and “including” to provide more specific embodiments of the invention and are also disclosed. Except where indicated in the examples or elsewhere, all figures used in the specification and claims to represent quantities of ingredients, reaction conditions, etc., should be understood, rather than attempting to limit the application of the equivalence principle to the scope of the claims, and should be interpreted in accordance with the number of significant figures and common rounding methods.

Claims

1. A pharmaceutical composition comprising lipid nanoparticles encapsulating an active agent, said lipid nanoparticles comprising: 2.5 mol% to 15 mol% of one or more cationic lipids; 30 mol% to 50 mol% of one or more ionizable lipids; One or more neutral lipids, ranging from 30 mol% to 65 mol%. as well as 2.5 mol% to 15 mol% of one or more PEGylated lipids.

2. The composition according to claim 1, wherein the active agent comprises RX-0201, 5′gctgcatgatctccttggcg3′, SEQ.ID.NO.

1.

3. The composition according to claim 2, wherein RX-0201 is an antisense oligonucleotide.

4. The composition according to any one of claims 2-3, wherein the RX-0201 has at least one modified nucleoside internucleotide bond, which is a thiophosphate bond.

5. The composition according to any one of claims 1-4, wherein the one or more cationic lipids are present in the lipid nanoparticles in an amount of 2.5 mol% to 12.5 mol% or 2.5 mol% to 10 mol%.

6. The composition according to any one of claims 1-5, wherein the one or more cationic lipids comprise: DOTMA: [1-(2,3-silyloxy)propyl]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DODAP, DOSPA (2,3-dioleoyloxy-N-[2-(sperminecarbamoylamino)ethyl]-N,N-dimethyl-1-propanetrifluoroacetate), DORIE (N-[ ... [-dioleoyloxypropyl]-N,N-dimethyl-N-hydroxyethylammonium bromide), DODAB, DOIC, DMEPC, DOGS: dioctadecylamide glycidylamine, DIMRI: dimyristoxypropyl dimethylhydroxyethylammonium bromide, DOTAP: dioleoyloxy-3-(trimethylammonium)propane, DC-6-14: O,O-teicosanoyl-N-α-trimethylaminoacetyl)diethanolamine chloride, CLIP 1: Racemic-[(2,3-octacosyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: Racemic-[2(2,3-hexacosyloxypropoxymethoxy)ethyl]-trimethylammonium, CLIP9: Racemic-[2(2,3-hexacosyloxypropoxysuccinoxy)ethyl]-trimethylammonium, oligofectamine, lipids described in U.S. Patent No. 5,049,386, N-[1-( 2,3-Dioleoyloxypropyl)]-N,N-dimethyl-N-hydroxyethylammonium bromide (DORIE), 2,3-dioleoyloxy-N-[2-(sperminecarbamoylamino)ethyl]-N,N-dimethyl-1-propylamine trifluoroacetate (DOSPA), etc.; and (3R,4R)-3,4-bis((Z)-hexadecyl-9-enoxy)-1-methylpyrrolidine and N-methyl-N,N-bis(2-((Z)-octadecyl-6-enoxy)ethyl)amine, etc., or any combination thereof, as disclosed in International Publication No. WO2011 / 13636.

7. The composition according to any one of claims 1-6, wherein the one or more neutral lipids are present in the lipid nanoparticles in an amount of 40 mol% to 55 mol%.

8. The composition according to any one of claims 1-7, wherein the one or more neutral lipids comprise dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylethanolamine (DOPE), 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DOPC), palmitoyloleoylphosphatidylcholine (POPC), lecithinylcholine (EPC), distearatelphosphatidylcholine (DSPC), cholesterol, or any combination thereof.

9. The composition according to any one of claims 1-8, wherein the one or more neutral lipids include cholesterol.

10. The composition according to any one of claims 1-9, wherein the one or more PEGylated lipids are present in the lipid nanoparticles in an amount of 2.5 mol% to 10 mol% or 5 mol% to 10 mol%.

11. The composition according to any one of claims 1-10, wherein the one or more PEGylated lipids comprise PEG-bistetradecylacetamide, PEG-myristoyl diglyceride, PEG-diacylglycerol, PEG-dialkoxypropyl, PEG-phospholipid, PEG-ceramide, PEG-DMG, PEG-DSPE, or any combination thereof.

12. The composition according to any one of claims 1-11, wherein the one or more PEGylated lipids comprise 1,2-dimyristoyl-sn-glycerol (DMG-PEG).

13. The composition according to any one of claims 1-12, wherein the one or more ionizable lipids are present in the lipid nanoparticles in an amount of 35 mol% to 45 mol%.

14. The composition according to any one of claims 1-13, wherein the one or more ionizable lipids comprise N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA), [(4-hydroxybutyl)azadiyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), 8-{(2-hydroxyethyl)[6-oxo-6-(undecapoxy)hexyl]amino}octanoate 9-heptadecyl ester (SM-102), DLin-MC3-DMA, DLin-KC2-DMA, DLinDMA, etc. disclosed in International Publication No. WO2005 / 121348, DLin-K-DMA, etc. disclosed in International Publication No. WO2009 / 086558, 1-(2,3-bis(((9Z,12Z)-octadec-9,12-dien-1-yl)oxy)propyl)pyrrolidine (A066), or any combination thereof.

15. The composition according to any one of claims 1-14, wherein the one or more ionizable lipids comprise N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA).

16. The composition according to any one of claims 1-15, wherein the lipid nanoparticles comprise DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG.

17. The composition of claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present in a molar ratio of 5:40:25:20:10 (DOTAP:DODMA:DOPC:cholesterol:DMG-PEG).

18. The composition of claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present in a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:27.5:20:7.

5.

19. The composition of claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present in a molar ratio of 5:40:30:20:5 (DOTAP:DODMA:DOPC:cholesterol:DMG-PEG).

20. The composition according to any one of claims 1-19, wherein the lipid nanoparticles and the active agent are present in a weight ratio of lipid nanoparticles to active agent of 5:1 to 20:1, 7.5:1 to 15:1, 7.5:1 to 10:1, 7.5:1 to 12:1, 10:1 to 12:1, 10.1 to 15:1 or 12:1 to 15:

1.

21. The composition according to any one of claims 1-20, wherein the lipid nanoparticles and the active agent are present in a weight ratio of lipid nanoparticles to active agent of 15:1, 12:1, 10:1 or 7.5:

1.

22. The composition according to any one of claims 1-21, wherein the composition comprises a group of lipid nanoparticles, and wherein the group of lipid nanoparticles has an average particle size of 50 nm to 80 nm, 55 nm to 75 nm, or 55 nm to 60 nm as determined by dynamic light scattering.

23. The composition according to any one of claims 1-22, wherein the composition comprises a group of lipid nanoparticles, and wherein the group of lipid nanoparticles has an average particle size of about 55 nm as determined by dynamic light scattering.

24. The composition according to any one of claims 1-23, wherein the composition comprises a group of lipid nanoparticles, and wherein the group of lipid nanoparticles has an average zeta potential of -0.6 mV to 2.5 mV.

25. The composition according to any one of claims 1-24, wherein the composition comprises a group of lipid nanoparticles, and wherein the group of lipid nanoparticles has an average zeta potential of -5.5 mV.

26. The composition according to any one of claims 1-25, wherein the composition comprises a group of lipid nanoparticles, and wherein the group of lipid nanoparticles has a polydispersity index (PDI) of 0.15 to 0.5, 0.15 to 0.4, 0.15 to 0.3, 0.15 to 0.2, 0.2 to 0.3, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 0.4, 0.3 to 0.5, or 0.4 to 0.

5.

27. The composition according to any one of claims 1-26, wherein the lipid nanoparticles are dispersed in a pharmaceutically acceptable carrier.

28. A method for treating cancer, preventing cancer, preventing cancer metastasis, preventing cancer recurrence, or preventing angiogenesis, said method comprising administering to a subject in need the pharmaceutical composition of any one of claims 1-27.

29. The method of claim 28, wherein the subject is a human being.

30. The method according to any one of claims 28-29, wherein the cancer is hepatocellular carcinoma.

31. The method according to any one of claims 28-30, wherein administration includes oral, topical, transdermal, intra-articular, intra-arterial, intradermal, intravenous, intralesional, intranasal, rectal, vaginal, inhalation, via an implanted reservoir, subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrasheath, intraperitoneal, intrahepatic, intralesional, or intracranial injection or infusion techniques.

32. The method according to any one of claims 28-31, wherein the composition is administered in combination with another active agent or therapy.

33. The method of claim 32, wherein the additional active agent or therapy comprises radiotherapy, chemotherapeutic agents, immunomodulators, antigens, or any combination thereof.

34. The method according to any one of claims 28-33, wherein the composition is administered in combination with a tyrosine kinase inhibitor.

35. The method according to any one of claims 28-34, wherein the composition is administered in combination with a vascular endothelial growth factor (VEGF) inhibitor.

36. The method according to any one of claims 28-35, wherein the composition is co-administered to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug, or derivative thereof; lenvatinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof; cabozantinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof; or any combination thereof.

37. The method according to any one of claims 28-35, wherein the composition is co-administered to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug, or derivative thereof; and lenvatinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

38. The method according to any one of claims 28-35, wherein the composition is co-administered to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug, or derivative thereof; and cabozantinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

39. The method according to any one of claims 28-35, wherein the composition is co-administered to the subject with lenvatinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof; and cabozantinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

40. The method according to any one of claims 28-35, wherein the composition is co-administered to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

41. The method according to any one of claims 28-35, wherein the composition is co-administered to the subject with lenvatinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

42. The method according to any one of claims 28-35, wherein the composition is co-administered to the subject with cabozantinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

43. The method according to any one of claims 28-35, wherein the composition is co-administered to the subject with sorafenib or a pharmaceutically acceptable salt, prodrug, or derivative thereof; lenvatinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof; and cabozantinib or a pharmaceutically acceptable salt, prodrug, or derivative thereof.

44. A method for inducing cytotoxicity in cancer cells of a subject, comprising contacting the cells with a pharmaceutical composition according to any one of claims 1-27.

45. A method for producing a group of lipid nanoparticles encapsulating an active agent, the method comprising: (a) Mixing one or more ethanol solutions containing lipid mixtures with an aqueous solution and acidifying to induce the formation of empty lipid nanoparticle clusters; (b) Contact the empty lipid nanoparticle cluster with an aqueous solution containing an active agent to encapsulate the active agent in the empty lipid nanoparticle cluster to produce the lipid nanoparticle cluster encapsulated with the active agent. as well as (c) The lipid nanoparticle group encapsulating the active agent is subjected to tangential flow filtration to replace the buffer and remove residual ethanol; The lipid mixture comprises 2.5 mol% to 15 mol% of one or more cationic lipids; 30 mol% to 50 mol% of one or more ionizable lipids; and 30 mol% to 65 mol% of one or more neutral lipids. And 2.5 mol% to 15 mol% of one or more PEGylated lipids.

Images