Promoters for gene expression in retinal cells and vector systems comprising same

Abstract

The invention relates to a promoter for gene expression in retinal cells and a vector system containing the promoter. The promoter for gene expression in retinal cells and the vector system comprising the same according to the present invention have a minimum promoter activity unit, and maintain high-level expression of a target gene unlike a currently known promoter in retinal cells, and thus can be used for maximizing expression of a target protein in retinal cells.

Description

Technical Field

[0001] This disclosure relates to a promoter for gene expression in retinal cells and a vector system comprising the promoter. Background Technology

[0002] Retinal degeneration-related diseases are promising targets for therapeutic development using adeno-associated virus (AAV)-mediated gene therapy. AAV vectors can mediate long-term gene expression in the retina and induce minimal immune responses, thus holding great potential for gene therapy using these vectors. The retina, a light-sensitive tissue at the back of the eye, is composed of various cell types, including retinal cells, photoreceptor cells, retinal pigment epithelial cells, and retinal ganglion cells. The target cell type and delivery route of AAV gene therapy vectors can have a significant impact on disease indications. For example, a phase 1 clinical trial of age-related macular degeneration used intravitreal delivery of vectors to achieve transduction into retinal ganglion cells, and a recent clinical trial treating patients with Leber congenital amaurosis type 2 (a type of retinitis pigmentosa) used subretinal delivery of the RPE65 gene to transduce it into retinal pigment epithelial cells.

[0003] Given its practicality, there is a need to develop novel agents and methods to improve the delivery of AAV to the eye.

[0004] However, the development of related treatments has been very slow. In other words, even though gene therapy (especially AAV-based gene therapy) is one of the methods that can treat the disease, the treatment is largely limited by two factors.

[0005] First, in the case of AAV-based gene therapy applied directly to cells via the retina, the size of the gene that can be used is very limited. Specifically, the vector design for AAV is very limited because the packaging capacity of AAV is very limited, at 4.7 kb, which cannot accommodate endogenous promoters that are typically several kb in length.

[0006] Secondly, as mentioned above, the retina contains various types of cells, and among them, pathogenic cells can be limited to specific cell types. That is, the cell types that require gene correction or treatment are specified for disease treatment, and the therapeutic agents should act on these types of cells. However, conventional AAV-based technologies used to date have not shown sufficient efficacy in terms of tissue specificity.

[0007] Specifically, designing AAVs with a packaging capacity within a small 4.7kb size range, incorporating suitable promoters, enhancers, and other vectors, and achieving sufficient efficacy through specific overexpression of the target protein in target cells, is extremely challenging. Therefore, gene therapy methods developed to date that utilize universal promoters expressed in all cells and specifically express genes in target cells can be considered extremely limited. Expression in target cells is a crucial method for minimizing the side effects of gene therapy agents.

[0008] In this context, the inventors of this application have developed a novel retinal cell-specific and minimally sized promoter and a vector system containing the same, thereby completing this disclosure. Summary of the Invention

[0009] Technical issues

[0010] One object of this disclosure is to provide a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7, or being the sequence of SEQ ID NO:6 or SEQ ID NO:7.

[0011] Another object of this disclosure is to provide an expression cassette comprising: a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7, or being the sequence of SEQ ID NO:6 or SEQ ID NO:7.

[0012] Another object of this disclosure is to provide an expression cassette comprising: a. a promoter of 100 to 400 nucleotides in length, said promoter comprising a nucleotide sequence as a core nucleotide sequence, said nucleotide sequence having at least 90% identity with, or being the sequence of, SEQ ID NO:6 or SEQ ID NO:7; and

[0013] b. Select any enhancer from the group consisting of SEQ ID NO: 12 to 18 and 28 to 31.

[0014] Another object of this disclosure is to provide a carrier comprising a promoter and / or an expression box.

[0015] Another object of this disclosure is to provide an adeno-associated virus (AAV) vector comprising a promoter and / or an expression cassette.

[0016] Another object of this disclosure is to provide cells transformed with an expression cassette or a vector containing an expression cassette.

[0017] Another object of this disclosure is to provide a pharmaceutical composition comprising an expression cassette or a carrier containing an expression cassette; and a pharmaceutically acceptable excipient.

[0018] Another object of this disclosure is to provide a pharmaceutical composition for the prevention or treatment of eye diseases, comprising an expression cassette or a carrier containing an expression cassette.

[0019] Another object of this disclosure is to provide an expression box or a carrier containing the same for use in treating eye diseases.

[0020] Another object of this disclosure is to provide a method for treating eye diseases, including administering an expression cassette or a carrier containing it to a subject in need.

[0021] Another object of this disclosure is to provide a method for enhancing the expression of target genes in the retina, including administering an expression cassette or a vector containing it to a subject in need.

[0022] Technical solution

[0023] This disclosure provides a novel promoter having a short length for use in vector systems, such as viral vector systems, particularly AAV vector systems, and capable of inducing gene expression with high-level specificity in retinal cells, as well as an expression cassette containing the promoter.

[0024] The term "promoter" refers to a regulatory element that directs the transcription of operably linked nucleic acids. A promoter can simultaneously regulate both the transcription rate and efficiency of the operably linked nucleic acids. A promoter can also be operably linked to other regulatory elements that enhance ("enhancer") or inhibit ("inhibitor") promoter-dependent nucleic acid transcription. "Promoter activity" refers to the ability of a promoter to initiate the transcription of operably linked nucleic acids.

[0025] The phrase "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid molecule such that one action is influenced by another. For example, if a promoter can affect the expression of a coding sequence, that is, if the coding sequence is under the transcriptional control of the promoter, then the promoter is operably linked to the coding sequence.

[0026] Therefore, this disclosure provides a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence, the nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7, or being the sequence of SEQ ID NO:6 or SEQ ID NO:7.

[0027] More specifically, this disclosure provides a retinal cell-specific promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7, or being the sequence of SEQ ID NO:6 or SEQ ID NO:7.

[0028] Therefore, this disclosure provides a sequence having the following nucleotide sequence, which has at least 90% identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7.

[0029] In this disclosure, retinal cells are collectively referred to as cells constituting the retina. Retinal cells include photoreceptor cells, retinal ganglion cells, Muller cells, bipolar cells, amacrine cells, horizontal cells, and / or retinal pigment epithelial cells, and the retina forms around these cells.

[0030] The promoter disclosed herein is a promoter that specifically acts on retinal cells and can exhibit high expression levels in retinal cells. More specifically, the promoter can specifically exhibit high expression in photoreceptor cells.

[0031] The promoter disclosed herein is a retinal-specific promoter that exhibits relevant activity and, when introduced into retinal cells, can initiate transcription of nucleic acids operatively linked to it at high expression levels. "Retinal-specific" should be understood as meaning a promoter that is primarily active in retinal cells. It should be understood that lower expression, typically found in other tissues or cells, cannot be completely ruled out.

[0032] The promoters according to SEQ ID NO:6 or SEQ ID NO:7 of this disclosure are promoter sequences that maintain tissue specificity and high expression while having a size reduction to a certain level or higher compared to existing RS1 promoter sequences known for photoreceptor specificity. Having shorter promoter sequences is advantageous because it allows for a reduction in the overall size (or length) of the vector (particularly in the rAAV genome). This enables the production of rAAV vectors with more efficient genome packaging.

[0033] More specifically, the sequence SEQ ID NO:6 according to this disclosure is a partial region of the GRK1 promoter sequence. More specifically, when compared with known GRK1 promoter regions, the sequence can exhibit high tissue specificity and high expression levels while having a total of 215 short sequences.

[0034] The sequence SEQ ID NO:7 according to this disclosure is a partial region of the PDE6B promoter sequence. More specifically, this sequence can exhibit high tissue specificity and high expression levels while having a total of 114 short sequences compared to known PDE6B promoter regions.

[0035] As used in this article, at least 90% identity means having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0036] Specifically, the promoter of this disclosure can be a functional variant having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7. The phrase "sequence identity" refers to the number (%) of matching (homogeneous nucleic acid residues) at alignment positions from two nucleotide sequences. Sequence identity is measured by comparing sequences at alignment time to maximize overlap and homology while minimizing sequence gaps. In particular, depending on the length of the two sequences, sequence identity can be measured using any of a variety of mathematical global or local alignment algorithms.

[0037] Functional variants are nucleotide sequences that retain their essential characteristics. Typically, variants are very similar overall and are identical to the original nucleotides in many regions. The sequence of a variant may differ due to nucleotide substitutions, deletions, or insertions of one or more nucleotides in the sequence, without impairing promoter activity. Variant sequences can have the same length as the original sequence, or they can be shorter or longer.

[0038] As used herein, the term "core" region (which may also be referred to herein as "core sequence," "core nucleotide sequence," "common region," or "common nucleotide sequence") refers to a central sequence capable of inducing gene expression at a high level of specificity within retinal cells. "Promoter containing a core nucleotide sequence" should be interpreted as meaning a promoter having at least one core nucleotide sequence, but may include additional components, such as additional nucleotide sequences.

[0039] If it is slightly extended by including additional nucleotides (e.g., by producing a region that is defined herein as an "extended core"), it may be referred to as an "extended core region" or an "extended core sequence" or an "extended core nucleotide sequence", etc.

[0040] Therefore, a promoter of 100 to 400 nucleotides in length is provided, the promoter comprising the sequence of SEQ ID NO:6 or SEQ ID NO:7 as a core nucleotide sequence. Here, the core nucleotide sequence is understood to comprise the sequence of SEQ ID NO:6 or 7 above, or to comprise some additional extended sequences in a single sequence, but comprising all nucleotides of that sequence.

[0041] There is no limit to the number of these sequences, but additional sequences may be included at the 3' and 5' ends, provided the number of nucleotides is 400 or less, to provide a minimum length vector for use with vectors such as AAV vectors. The number of any additional possible nucleotides mentioned above includes all integers that can be set within the total length of 400 or less mentioned above.

[0042] In other words, based on each GRK1 promoter or PDE6B promoter sequence, it may also contain at least 10, at least 15, or at least 20 consecutive nucleotides at the 3' end of each of the above sequences. Furthermore, based on each GRK1 promoter or PDE6B promoter sequence, it may also contain at least 10, at least 15, or at least 20 consecutive nucleotides at the 5' end of each of the above sequences.

[0043] The promoters described above, with a length of 100 to 400 nucleotides, preferably comprise 100 to 350, more preferably 110 to 300 nucleotides. Even more preferably, the length can be greater than or equal to the minimum number of each sequence in SEQ ID NO: 6 or SEQ ID NO: 7, and less than 400 nucleotides. Furthermore, the length can be greater than or equal to the minimum number of sequences in SEQ ID NO: 6 or SEQ ID NO: 7, and less than 350 nucleotides. Additionally, the length can be greater than or equal to the minimum number of sequences in SEQ ID NO: 6 or SEQ ID NO: 7, and less than 300 nucleotides.

[0044] More preferably, the promoter region of SEQ ID NO: 6 or SEQ ID NO: 7 may also be included in a 5' UTR region at the 5' end. Specifically, the UTR sequence may be a sequence (5' UTR) located upstream of the GRK1 promoter or PDE6B promoter found in or in portions of the human genome sequence. More specifically, the UTR sequence may have a length of at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, or 10 Kb.

[0045] More preferably, the 5'UTR can be optimized for the desired protein expression level. The optimized sequence may have, for example, the nucleotide sequence of SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:24, but is not limited thereto.

[0046] SEQ ID NO: 8 is preferably the 5'UTR region of the GRK1 promoter.

[0047] SEQ ID NO: 9 is preferably the 5'UTR region of the PDE6B promoter.

[0048] Adding this 5'UTR imparts improved efficacy in terms of expression efficiency and improved efficacy in terms of tissue specificity.

[0049] This disclosure provides an expression cassette comprising: a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with, or being the sequence of, SEQ ID NO:6 or SEQ ID NO:7; and nucleotides encoding a polypeptide operatively linked to the promoter.

[0050] The term "expression cassette" refers to a nucleic acid construct containing a coding sequence and one or more sequences required to express the coding sequence. Specifically, one of these regulatory sequences is the promoter of this disclosure.

[0051] An expression cassette contains the coding sequence and regulatory sequences upstream (5' untranslated region) and downstream (3' untranslated region) of the coding sequence required to express the product of the selected gene. Therefore, an expression cassette typically contains a promoter sequence, a coding sequence, and a 3' untranslated region, which usually contains a polyadenylation site and / or a transcription terminator. Expression cassettes may also contain additional regulatory elements, such as enhancer sequences, multi-connector sequences that facilitate DNA fragment insertion into vectors, and / or splicing signal sequences. Expression cassettes are typically contained within vectors to facilitate cloning and transformation.

[0052] The promoters disclosed herein are operatively linked to heterologous nucleic acids. As used herein, the term "heterologous" refers to a nucleic acid other than one operatively linked to by a promoter within a naturally occurring genome.

[0053] In an embodiment, the nucleotides encoding the polypeptide operatively linked to the promoter of this disclosure encode the desired polypeptide. The desired polypeptide can be any polypeptide that needs to be expressed in retinal cells.

[0054] The required peptide can be a therapeutic peptide or a reporter protein.

[0055] The required gene can be any gene that is targeted for expression in the retina, preferably in photoreceptor cells.

[0056] In an embodiment, the nucleic acid operatively linked to the promoter of the present disclosure is a target gene encoding a therapeutic polypeptide, preferably a therapeutic gene.

[0057] A target gene, preferably a therapeutic gene, is a gene that encodes a therapeutic protein used to treat a pathological condition. When expressed, the therapeutic gene confers a beneficial effect in the cells or tissues in which it is present or in a patient in whom the gene is expressed. Examples of beneficial effects include alleviating the signals or symptoms of a disease or condition, preventing or inhibiting a disease or condition, or conferring desired properties. Therapeutic genes include genes that partially or completely correct genetic defects in a patient. Specifically, a therapeutic gene can be a nucleic acid sequence encoding a protein that can be used for gene therapy, which alleviates, but is not limited to, defects caused by the absence or deficiency of a protein in the patient's cells or tissues.

[0058] Examples of therapeutic genes include, but are not limited to, RS1, RP1, Rho, Rom1, SPATA7, PCARE, CRB1, IMPG1, GNAT1, RPGRIP1, OPN1SW, TULP1, ABCA4, GUCA1A, CNGB1, GUCA1B, PRCD, RGR, CDHR1, RP1L:, RBP3, PRPH2, IMPG2, PDE6B, RD3, GNB1, OPN1LW, OPN1MW, MYO7A, MAK, USH1C, PROM1, CRX, GUCY2D, NR2E3, OPN3, OPN4, IQCB1, and / or GNGT1.

[0059] Reporter proteins are detectable in living retinal cells. Expression of reporter proteins under the promoter control of this disclosure allows for the specific detection or recognition of retinal cells. Reporter proteins can be, for example, fluorescent proteins (e.g., GFP), calcium indicators (e.g., GCaMP), luciferases, alkaline phosphatases, β-galactosidases, β-lactamases, horseradish peroxidases, mCherry, or variants thereof.

[0060] The expression cassette according to this disclosure may contain one or more untranslated regions (UTRs) or sequences, and more preferably, may also contain a 5' UTR sequence. The UTR sequence may be a sequence (5' UTR) upstream of the GRK1 promoter or PDE6B promoter found in or in portions of the human genome sequence. More specifically, the UTR sequence may have a length of at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, or 10 kb.

[0061] More preferably, the 5'UTR can be optimized for the desired protein expression level. The optimized sequence may have, for example, the nucleotide sequence of SEQ ID NO:8 or SEQ ID NO:9, but is not limited thereto. More specifically, the 5'UTR that binds to the promoter of this disclosure is preferably the UTR of the inserted gene.

[0062] The expression cassette according to this disclosure may contain a polyA sequence. The polyA sequence may preferably be a polyA sequence derived from the PCK6 AS1 gene (SEQ ID NO:35), or a polyA sequence derived from the bovine growth hormone (BGH) gene (SEQ ID NO:36), and more preferably a polyA sequence derived from the BGH gene.

[0063] The expression cassette according to the invention preferably includes operatively connected enhancers. Specifically, it also includes any enhancer selected from the group consisting of SEQ ID NO:12 to 18 and SEQ ID NO:28 to 31. Sequences showing functional homology to the sequences shown in SEQ ID NO:12 to 18 above, and sequences showing at least 90% sequence identity, are also included within the scope of this disclosure.

[0064] More preferably, this disclosure provides an expression cassette comprising: a. a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7, or being the sequence of SEQ ID NO:6 or SEQ ID NO:7; b. any one of the enhancers selected from the group consisting of SEQ ID NO:12 to 18 and SEQ ID NO:28 to 31; and c. nucleotides encoding a polypeptide operatively linked thereto.

[0065] Enhancer sequence elements can be located anywhere, such as downstream or upstream of a gene. Preferably, enhancer sequence elements can be located upstream of a gene.

[0066] If desired, the expression cassette may also contain any number of spacer sequences ranging from 1 to 1000 nucleotides. Such spacers may be present between the enhancer and the promoter and may be any sequence that does not affect the function of the respective sequences. According to embodiments of this disclosure, the spacers may contain nucleotides of SEQ ID NO:25 or SEQ ID NO:34.

[0067] According to this disclosure, the enhancer originates from the sequence located at region 2291 to 2440 of intron 4 of GRK1, and may be a nucleotide of SEQ ID NO: 12.

[0068] Furthermore, the sequence can be further shortened to include any one or more of the group consisting of SEQ ID NO: 13 to 18. Additionally, any of its sequences can be repeated at least once, twice, or three times.

[0069] The expression cassette disclosed herein may include a promoter, an enhancer, and one or more nucleic acids operatively linked thereto. For example, the promoter and enhancer may be operatively linked to nucleic acids encoding one or more therapeutic genes.

[0070] More preferably, this disclosure provides an expression cassette comprising: a. a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7, or being the sequence of SEQ ID NO:6 or SEQ ID NO:7; b. any one of the enhancers selected from the group consisting of SEQ ID NO:12 to 18 and SEQ ID NO:28 to 31; c. the 5'UTR of SEQ ID NO:8 or SEQ ID NO:9; and d. nucleotides encoding a polypeptide operatively linked thereto.

[0071] If desired, the expression cassette according to this disclosure may also contain the RS1 promoter sequence or a sequence having at least 90% identity with it. More specifically, the expression cassette may also contain the promoter region of SEQ ID NO: 22 or a sequence having at least 90% identity with it. Based on the enhancer, such a sequence is expected to be located downstream of the enhancer.

[0072] Preferably, the expression cassette according to this disclosure may comprise: a. a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:7, or being the sequence of SEQ ID NO:7; b. an enhancer of SEQ ID NO:12; and c. nucleotides encoding a polypeptide operatively linked thereto.

[0073] Preferably, the expression cassette according to this disclosure may comprise the following: a. a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:7, or being the sequence of SEQ ID NO:7; b. an enhancer of SEQ ID NO:12; c. a 5'UTR of SEQ ID NO:9; and d. nucleotides encoding a polypeptide operatively linked thereto. More specifically, the 5'UTR binding to the promoter of this disclosure is preferably the UTR of the inserted gene.

[0074] Preferably, the expression cassette according to this disclosure may comprise: a. the RS1 promoter of SEQ ID NO:22 or a nucleotide sequence having at least 90% identity with it; b. the enhancer of SEQ ID NO:12; c. a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:7, or being the sequence of SEQ ID NO:7; d. the 5'UTR of SEQ ID NO:9; and e. nucleotides encoding a polypeptide operatively linked thereto. Here, the enhancer may be located between the RS1 promoter of SEQ ID NO:22 and the PDE6B promoter sequence of SEQ ID NO:7, and a spacer region may also be included between these sequences. More specifically, the 5'UTR binding to the promoter of this disclosure is preferably the UTR of the inserted gene.

[0075] Preferably, the expression cassette according to this disclosure may comprise the following: a. a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:7, or being the sequence of SEQ ID NO:7; b. an enhancer of SEQ ID NO:30 to 31; c. the 5'UTR of SEQ ID NO:24; and d. nucleotides encoding a polypeptide operatively linked thereto. More specifically, the 5'UTR binding to the promoter of this disclosure is preferably the UTR of the RS1 gene (SEQ ID NO:24).

[0076] The expression cassette can highly express nucleotides encoding polypeptides that are operatively and specifically linked to photoreceptors.

[0077] This disclosure also provides a carrier comprising the aforementioned promoter and / or expression box.

[0078] The term "vector" refers to a nucleic acid molecule used to deliver genetic material, particularly nucleic acids, into host cells, either in vitro or in vivo. Vectors include, but are not limited to, plasmids, bacteriophages, granules, transportable elements, viruses, and artificial chromosomes (e.g., YAC).

[0079] Preferably, the vector disclosed herein is a suitable vector for gene or cell therapy, particularly suitable for targeting retinal cells, more specifically photoreceptor cells.

[0080] The vector disclosed herein is preferably a viral genome vector, which contains any elements required for establishing expression of the desired polypeptide in the host cell, such as a promoter (e.g., the promoter disclosed herein), an ITR, a ribosome-binding element, an enhancer, a selection marker, an intron, a polyA signal, and / or an origin of replication.

[0081] In some embodiments, the vector is a viral vector derived from a virus, such as Moloney's murine leukemia virus vector (MoMLV), murine stem cell virus (MSCV), spleen focal formation virus (SFFV), myeloproliferative sarcoma virus (MPSV) or SNV, lentiviral vectors (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), adenovirus (Ad) vectors, adeno-associated virus (AAV) vectors, ring virus vectors, simian virus 40 (SV-40) vectors, bovine papillomavirus vectors, Epstein-Barr virus vectors, herpesvirus vectors, vaccinia virus vectors, Harvey's murine sarcoma virus vectors, murine mammary tumor virus vectors, ring virus vectors, and Rous sarcoma virus vectors.

[0082] In a specific implementation, the vector is a retroviral vector, preferably a lentiviral vector or a non-pathogenic parvovirus.

[0083] As is commonly understood in the art, depending on the specific viral vector intended for use, a suitable sequence (e.g., an AAV ITR for an AAV vector or an LTR for a lentiviral vector) may be introduced into the vector of this disclosure to obtain a functional viral vector.

[0084] In some embodiments, the vector is a non-viral vector. Non-viral vectors are mainly classified into cationic polymers and cationic liposomes. Cationic polymers refer to polymers containing synthetically produced or naturally formed cations, and cationic lipid particles refer to artificially prepared phospholipid vesicles with a bilayer. Non-viral vectors include, but are not limited to, lipid nanoparticles (LNPs), polymer nanoparticles (PNPs), exosomes, and virus-like particles (VLPs). Non-viral vectors can be delivered into cells using any method known in the art, including calcium phosphate coprecipitation, liposome transfection, cell fusion, receptor-mediated gene transfer, naked DNA injection, electroporation, bioballistic flight, or molecular acceleration.

[0085] In a preferred embodiment, the carrier is an AAV carrier.

[0086] Human parvovirus adeno-associated virus (AAV) is a naturally occurring replication-defective dependent virus that can integrate into the genome of infected cells to establish potential infection. AAV vectors are known to be safe vectors because most (>99%) therapeutic genes delivered to the cell nucleus are not inserted into the cellular genome but are expressed for extended periods in a transient state. In the case of wild-type AAV (wtAAV), the Rep gene is triggered by helper viruses such as herpes simplex virus (HSV) and adenovirus (Ad), allowing replication both in vivo and in vitro. However, recombinant AAV engineered for therapeutic purposes (rAAV) lacks the Rep gene and is used as a replication-defective viral vector both in vivo and in vitro. Furthermore, the Rep gene of wtAAV is known to insert into a specific site (called AAVS1) in the human genome located on human chromosome 19 (19ql 3.3-qter) with a low probability (<0.01%), but in the case of rAAV, the Rep gene is removed from this site, thus ensuring safety. Therefore, AAV has attracted considerable interest as a potential vector for human gene therapy. This virus has several advantageous characteristics, including lack of association with any human disease, the ability to infect both dividing and non-dividing cells, and the ability to infect multiple cell lines from various tissues.

[0087] As used herein, the term "AAV vector" refers to a polynucleotide vector containing at least one AAV inverted terminal repeat (ITR) sequence, preferably two ITRs flanking one or more heterologous sequences (i.e., nucleic acid sequences not derived from AAV). When present in a host cell, such AAV vectors can replicate and be packaged into infectious viral vector particles expressing the AAV rep and cap gene products (i.e., AAVRep and Cap proteins), said viral vector particles being infected with a suitable helper virus (or expressing a suitable helper function).

[0088] The term "inverted terminal repeat" or "ITR" sequence is a well-known term in the art, referring to a relatively short sequence found at the ends of a viral genome, present in an opposite orientation. An "AAV inverted terminal repeat (ITR)" sequence is approximately 145 nucleotides long and is present at both ends of a natural single-stranded AAV genome. The outermost 125 nucleotides of the ITR are present in one of two alternating orientations, thus creating heterogeneity between different AAV genomes and between the ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter self-complementary regions, allowing intrastrand base pairing to occur within this site of the ITR. The AAV ITR used in the vectors disclosed herein may have a wild-type nucleotide sequence or may be altered by insertion, deletion, or substitution. The serotype of the inverted terminal repeat (ITR) of the AAV vector may be selected from any known human or non-human AAV serotype.

[0089] When an AAV vector is introduced into a larger polynucleotide (e.g., within a chromosome or other vector, such as a plasmid for cloning or transfection), the AAV vector may be referred to as a “pre-vector” that can be “rescued” by cloning and capping in the presence of AAV packaging function and suitable helper functions. The AAV vectors of this disclosure can be any of a variety of forms, including but not limited to plasmids, linear artificial chromosomes complexed with lipids, lipids encapsulated within liposomes, and viral particles encapsulated within viral particles, such as AAV particles.

[0090] The promoters or expression boxes disclosed herein can be introduced into a vector by any method known to those skilled in the art.

[0091] The vector disclosed herein can be packaged into a viral capsid that produces "viral particles". Therefore, this disclosure also relates to viral particles containing the vector of this disclosure.

[0092] In a specific implementation, the vector is an AAV vector and is packaged into an AAV-derived capsid to produce an "adeno-associated virus particle" or "AAV particle." Therefore, as used herein, the term "AAV particle" refers to a viral particle consisting of at least one AAV capsid protein and an AAV vector genome encapsulating the capsid.

[0093] The capsid serotype determines the directional range of AAV particles.

[0094] Numerous adeno-associated virus (AAV) serotypes have now been identified, including 12 human serotypes and 100 or more serotypes from non-human primates. Other currently used AAV serotypes include, but are not limited to, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj. Furthermore, examples of non-natural processed variants may include AAV2.7m8, AAVLK03, AAV-Spark9001, AAV-R100, AAV-C102, AAV-A101, AAVr3.45, AAV-PHP.eB, AAV-PHP.S, AAV-retro, and AAV-QuadYF, with AAV2.7m8, AAVLK03, AAV-Spark9001, AAV-R100, and AAV-C102 being preferred. Specifically, the capsid protein may be a variant containing one or more amino acid substitutions that enhance transduction efficiency.

[0095] Different AAV serotypes are used to optimize transduction of specific target cells or to target specific cell types within specific target tissues (e.g., retinal cells). AAV particles may contain viral proteins and viral nucleic acids of the same serotype, or any natural or artificial sequence variant of AAV. For example, AAV particles may contain the AAV2 capsid protein and at least one, preferably two, AAV2 ITRs. This document provides any combination of AAV serotypes for the production of AAV particles, each combination of which has been represented and described herein.

[0096] AAV viruses can be processed using conventional molecular biology techniques, enabling these particles to be optimized for cell-specific delivery of nucleic acid sequences, reduced immunogenicity, regulation of stability and particle lifespan, efficient degradation, and precise delivery to the cell nucleus.

[0097] As an alternative to using natural AAV serotypes, artificial AAV serotypes can be used in the context of this disclosure, including, but not limited to, AAVs having capsid proteins that are not naturally present. Such artificial capsids can be produced using any suitable technique that combines a selected AAV sequence (e.g., a VP1 capsid protein fragment) with a heterologous sequence obtainable from different selected AAV serotypes, which are discontinuous portions of the same AAV serotype derived from non-AAV viral sources or non-viral sources. Artificial AAV serotypes can be, but are not limited to, chimeric AAV capsids or mutant AAV capsids.

[0098] The chimeric capsid comprises a VP capsid protein derived from at least two different AAV serotypes, or a chimeric VP protein comprising at least one VP protein region or domain that binds to at least two VP protein regions or domains derived from at least two AAV serotypes.

[0099] Capsid proteins can also be mutated, particularly to improve transfection efficiency. Mutated AAV capsids can be obtained from capsid variants derived by error-prone PCR and / or peptide insertion, or by introducing one or more amino acid substitutions. Specifically, mutations can be made at any one or more tyrosine residues in natural or non-natural capsid proteins (e.g., VP1, VP2, or VP3). Preferably, the mutated residues are surface-exposed tyrosine residues. Exemplary mutations include, but are not limited to, tyrosine substitutions for phenylalanine, such as Y252F, Y272F, Y444F, Y500F, Y700F, Y704F, Y730F, Y275F, Y281F, Y508F, Y576F, Y612G, Y673F, and Y720F.

[0100] In a preferred embodiment, the AAV particles comprise an AAV2-derived capsid. In this embodiment, the capsid may comprise one or more tyrosine to phenylalanine substitutions, preferably Y444F substitutions.

[0101] Various methods are known in the art for producing viral particles, particularly AAV particles, including transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids, and baculovirus-AAV hybrids.

[0102] Essential components used in the production of AAV virus particles.

[0103] In the case of production based on animal cell lines, the following are included: 1) animal cell lines, such as HeLa, A549, CHO, or HEK293 cells; 2) helper plasmids or helper viruses (e.g., adenovirus (Ad) or herpesvirus (HSV)) encoding adenovirus genes E4, E2A, or VA; 3) AAV rep and cap genes and gene products; 4) at least one AAV ITR sequence, such as nucleic acid encoding a therapeutic gene or reporter protein base sequence between ITR sequences via a vector disclosed herein; and 5) culture media and culture media components suitable for AAV production, optimized for adherent cell culture or suspension cell culture.

[0104] In the case of insect cell line-based production, the necessary components for producing AAV virus particles include: 1) an insect cell line derived from SF9 or SF9; 2) a baculovirus or baculovirus-derived virus capable of introducing genetic traits into SF9; 3) information on the Rep, Cap genes, ITR-therapeutic gene / reporter protein encoding genes, E4, E2A, and VA genes of the helper plasmid contained in the baculovirus or baculovirus-derived virus, which can be transduced by splitting into two, three, or more vectors; and 4) a culture medium and culture medium components suitable for AAV production, optimized for suspension culture of SF9 or SF9-derived insect cells.

[0105] More preferably, this disclosure relates to an AAV particle comprising a carrier according to this disclosure and an AAV-derived capsid.

[0106] This disclosure also relates to isolated host cells transformed or transfected using expression cassettes, vectors, or viral particles disclosed herein.

[0107] The host cell can be any animal cell, plant cell, bacterial cell, or yeast cell. Preferably, the host cell is a mammalian cell or insect cell. More preferably, the host cell is a human cell.

[0108] In a preferred embodiment, the host cell is a human retinal cell.

[0109] The expression cassettes or vectors disclosed herein may include, but are not limited to, calcium phosphate-DNA precipitation, DEAE-dextran transfection, electroporation, microinjection, gene gun, liposome transfection, or viral infection, and may be maintained or integrated into the genome in a ectopic form in host cells.

[0110] In a preferred embodiment, the expression cassette or vector of the present disclosure is transfected into a host cell, preferably using the viral particles of the present disclosure, and more preferably using the AAV particles of the present disclosure.

[0111] This disclosure also provides a composition for enhancing the expression of target genes in the retina, comprising the expression cassette, vector, viral particles, or cells of this disclosure. Preferably, this disclosure provides a composition for enhancing the expression of target genes in photoreceptor cells, comprising the expression cassette, vector, viral particles, or cells of this disclosure.

[0112] This disclosure also relates to a pharmaceutical composition comprising an expression cassette, vector, viral particle, or cell of this disclosure.

[0113] Such compositions comprise a therapeutically effective amount of a therapeutic agent (an expression cassette, vector, viral particle, or cell of this disclosure) and a pharmaceutically acceptable excipient. As used herein, the term "pharmaceuticalally acceptable" means approved for use in animals and / or humans by a regulatory authority (e.g., the European Pharmacopoeia or a recognized pharmacopoeia). The term "excipient" refers to a diluent, adjuvant, carrier, or vehicle administered in conjunction with the therapeutic agent.

[0114] As is well known in the art, pharmaceutically acceptable excipients are relatively inert substances that facilitate the administration of a pharmacologically effective substance and can be provided as a liquid solution or suspension, as an emulsion, or in a solid form suitable for immediate dissolution or suspension in a liquid prior to use. For example, excipients can provide form or consistency, or can act as diluents. Suitable excipients include, but are not limited to, stabilizers, wetting agents and emulsifiers, salts that alter osmotic pressure, sealants, pH buffers, and buffers. Such excipients include any pharmaceutically acceptable agent suitable for direct delivery to the eyes, which can be administered without excessive toxicity. Pharmaceutically acceptable excipients include, but are not limited to, sorbitol, any of the various Tween compounds, and liquids (e.g., water, physiological saline, glycerol, and ethanol). Pharmaceutically acceptable salts can include, for example, inorganic acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, etc.; and salts of organic acids such as acetates, propionates, malonates, benzoates, etc. A full discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences (15th edition).

[0115] Preferably, the composition is formulated for administration, particularly by intraocular injection, such as subretinal and / or intravitreal administration. Therefore, the composition can be combined with pharmaceutically acceptable excipients, such as saline, Ringer's balanced salt solution (pH 7.4), etc.

[0116] The pharmaceutical compositions described herein may be packaged in a single unit dose or in multiple doses.

[0117] In embodiments, the pharmaceutical composition comprises a carrier or viral particle of the present disclosure, more preferably an AAV carrier or particle.

[0118] In another embodiment, the pharmaceutical composition comprises the host cells of the present disclosure, preferably human host cells of the present disclosure transformed or transfected with the expression cassette, vector or viral particles of the present disclosure, preferably AAV particles.

[0119] Optionally, the composition containing host cells can be cryopreserved at any temperature suitable for cell storage. For example, cells can be frozen at about -20°C to -80°C or any other suitable temperature. Frozen cells can be stored in appropriate containers and processed for storage, thereby reducing the risk of cell damage and maximizing the cells' tendency to withstand thawing. Furthermore, cells can be maintained at a refrigerated room temperature, such as about 4°C.

[0120] The amount of the pharmaceutical composition to be administered can be measured using standard procedures well known to those skilled in the art.

[0121] The appropriate dosage should be determined by taking into account the patient’s physiological data (such as age, physical condition, and weight) as well as the type and severity of the disease to be treated.

[0122] The pharmaceutical compositions disclosed herein can be administered in single or multiple doses.

[0123] In a specific embodiment, the pharmaceutical composition comprises the viral particles of this disclosure, and each unit dose contains 10 8 Up to 10 13 10 virus particles, preferably 10 9 Up to 10 12 A virus particle.

[0124] The pharmaceutical composition may also contain one or more additional active ingredients, such as corticosteroids, antibiotics, analgesics, immunosuppressants, nutritional factors, or any combination thereof.

[0125] This disclosure provides a pharmaceutical composition for the prevention or treatment of eye diseases, comprising an expression cassette or a carrier comprising an expression cassette according to this disclosure.

[0126] On the other hand, this disclosure also provides:

[0127] - A pharmaceutical composition of this disclosure for treating eye diseases.

[0128] - An expression cassette, vector, viral particle, or host cell of this disclosure for the treatment of eye diseases.

[0129] - The use of the expression cassette, vector, viral particle, or host cell disclosed herein for the manufacture of drugs for treating eye diseases, and

[0130] - A method of treating an eye disease, comprising administering a therapeutically effective amount of the pharmaceutical composition disclosed herein to a subject in need.

[0131] This disclosure relates to a method for treating an eye disease, including administering an expression cassette or a carrier containing the expression cassette to a subject in need.

[0132] A method for enhancing the expression of a target gene in the retina is also provided, comprising administering an expression cassette or a carrier containing an expression cassette to a subject in need. Preferably, this disclosure provides a method for enhancing the expression of a target gene in photoreceptor cells, comprising administering an expression cassette or a carrier containing an expression cassette to a subject in need.

[0133] A method for enhancing the expression of target genes in retinal cells is also provided, comprising treating retinal cells in vitro and / or in vitro with an expression cassette or a vector containing the expression cassette. Preferably, the retinal cells are photoreceptor cells.

[0134] In this implementation, the eye disease is a retinal disease.

[0135] Examples of retinal diseases include, but are not limited to: retinitis pigmentosa (RP), including X-linked, recessive, dominant, and incidental forms; rod-cone dystrophy; Usher syndrome; Stargardt's disease; cone-rod cell color vision deficiency; cone cell color vision deficiency; complete color blindness; blue cone monochromatic vision; enhanced S-cone syndrome; rod color vision deficiency; choroidal agenesis; Leber congenital amaurosis; juvenile X-linked retinoschisis (JXLR); white spot fundus; white spot retinal degeneration; Condoury punctate retina; bietti crystalline retinal degeneration; fenestrated sheenmacular dystrophy; adult-onset vitrectomyces; Batten's disease; congenital stationary night blindness; familial exudative vitreoretinopathy (FEVR); ocular albinism; oculocutaneous albinism; foveal dysplasia; abetalipoproteinemia; and Stickler syndrome. Syndrome, retinal dystrophy (Bothnia type), crystalline macular degeneration (related to medication or hyperoxaluria), cystinemia, Sjogren-Larsson syndrome, West African crystalline macular degeneration, solar retinopathy, talc retinopathy, diabetic retinopathy, sickle cell retinopathy, macular telangiectasia, retinal periphlebitis, peripheral retinoschisis, central / branch retinal artery occlusion (CRAO / BRAO), central / branch retinal vein occlusion (CRVO / BRVO), hemorrhagic occlusive retinal vasculitis (HORV), drug-induced macular degeneration, including drugs such as chloroquine, hydroxychloroquine, phenothiazines, quinine sulfate, thioridazine, clofazimine, chlorpromazine, deferoxamine, chloroquine derivatives, cisplatin, carmustine, clofazimine, and vigabatrin; lens-induced macular degeneration, including tamoxifen, talc, canthaxanthin, methoxyflurane, and nitrofurantoin; cystoid macular edema (CME), including adrenaline, latanoprost, and niacin; progressive extraretinal necrosis (PORN), acute retinal necrosis (ARN), CMV retinitis, sarcoidosis, and acute syphilitic posterior pole squamous chorioretinitis (acute syphilitic posterior pole squamous chorioretinitis). Syphilitic posterior placoidchorioretinitis, tuberculous chorioretinitis, toxoplasmic chorioretinitis, posterior uveitis and retinal vasculitis, intermediate uveitis, pars plana inflammation ± cystoid macular edema (CME), endophthalmitis (anterior and / or posterior), posterior scleritis, masquerade syndrome, multifocal chorioretinitis with panuveitis (MCP), punctate inner choroidal lesions (PIC), shotgun choroidal lesions, retinitis pigmentosa, white spot retinopathy, acute macular neuroretinopathy (AMN), and acute regional occult outer retinal lesions (AZOOR).

[0136] As used herein, the terms “treatment,” “treat,” or “treating” refer to any action aimed at alleviating a patient’s health condition, such as treating, preventing, deterring, or delaying the onset of a disease. In some embodiments, the term refers to alleviating or eradicating a disease or a symptom associated with a disease. In other embodiments, the term refers to minimizing the spread or worsening of a disease due to the administration of one or more therapeutic agents to a subject affected by the disease.

[0137] Specifically, the term "treatment of eye diseases" can refer to treatments intended to provide improved vision, prevent disease progression to complete blindness, prevent the spread of damage to undamaged eye cells, improve damage to damaged eye cells, prevent retinal damage, or salvage an eye suffering from mild or advanced disease. In some embodiments, the term refers to preventing, reducing, or stopping retinal cell degeneration by providing therapeutic proteins that correct a patient's genetic defects.

[0138] "Therapeutic effective amount" refers to the amount of the pharmaceutical composition of this disclosure administered to a subject that is sufficient to constitute treatment for an eye disease as defined above.

[0139] In the methods of this disclosure, the expression cassette, carrier, and / or pharmaceutical composition of this disclosure are preferably administered intraocularly, more preferably subretinally or intravitreally.

[0140] The method disclosed herein may also include administering at least one additional therapeutic agent to the subject. In particular, the therapeutic agent may be selected from corticosteroids, antibiotics, analgesics, immunosuppressants, or nutritional factors, or any combination thereof.

[0141] The compositions disclosed herein can be administered before or after the onset of symptoms of a disease, such as before or after partial or complete retinal cell degeneration and / or before or after partial or complete vision loss.

[0142] This disclosure also relates to non-human animal models incorporating expression cassettes, vectors, viral particles, or host cells.

[0143] These animal models can be used for in vivo studies of retinal cell function. When using the promoters, cassettes, vectors, or viral particles disclosed herein, for example by expressing reporter proteins, voltage-sensitive proteins, or calcium-sensitive proteins, retinal cells can be identified or tracked, or their activity can be monitored.

[0144] Non-human animal models can also be used in screening methods to identify or select agents that act on retinal cells.

[0145] Preferably, the non-human animal model is a mammal, more preferably a primate, rodent, rabbit, or miniature pig. The promoter, expression cassette, or vector can be maintained in the model cell in free gene form or integrated into its genome.

[0146] Methods for transfecting or transforming animal cells or producing transgenic animals that express desired nucleic acid sequences under the control of selected promoters (specifically, promoters of this disclosure) are well known to those skilled in the art and can be readily applied depending on the type of cell and animal.

[0147] All features set forth herein (including all appended claims, abstract and drawings) and / or all steps of any method or process so disclosed may be combined with any of the above embodiments in any combination, except that at least some of these features and / or steps are mutually exclusive combinations.

[0148] All patents, patent applications, provisional applications and publications described or cited herein are incorporated herein in their entirety by reference, including all figures and tables, provided that they are consistent with the explicit teachings herein.

[0149] The following implementation methods are provided for illustrative purposes and are not intended to be limiting.

[0150] Beneficial effects

[0151] The promoter for gene expression in retinal cells and the vector system containing the promoter disclosed herein can have the smallest unit that functions as a promoter and, unlike existing known promoters in retinal cells, can maintain a high expression level of the target gene, and therefore can be used to maximize the expression of the target protein in retinal cells. Attached Figure Description

[0152] To better understand this disclosure and to illustrate how embodiments of this disclosure can be implemented in practice, reference is now made to the accompanying drawings, which are provided by way of example:

[0153] Figure 1 The intensity of Gaussian luciferase is shown for promoter candidates targeting expression cassettes overexpressed in retinal cells.

[0154] Figure 2(A) shows the design of an expression cassette containing the GRK1 promoter and the PDE6B promoter selected from the promoter candidate group, and Figure 2(B) shows its Gaussian luciferase intensity as confirmed in HEK293FT and Y79 cells. The enhancer is IRBPe.

[0155] Figure 3(A) shows the expression cassette designed by selecting the GRK1 IRBP-derived enhancer sequence (GRK1e) and the IRBP enhancer (IRBPe) as new enhancer candidates and binding them with the GRK1 promoter and PDE6B promoter selected in Figure 2. Figure 3(B, C) shows the Gaussian luciferase intensity confirmed in HEK293FT, WERI-RB1 and Y79 cells.

[0156] Figure 4(A) shows the GRK1 promoter and PDE6B promoter in a simple insertion of a known photoreceptor-specific expression cassette (RS1 / IRBPe / RS1), and Figures 4(B, C) show the changes in relative tissue-specific expression efficiency confirmed in HEK293FT, WERI-RB1, and Y79 cells.

[0157] Figure 5(A) shows the removal of the N-terminus from a known photoreceptor-specific expression cassette (RS1 / IRBPe / RS1) and insertion into the GRK1e-PDE6B cassette selected in Figure 3, and Figure 5(B) shows the expression effect of the expression cassette system in photoreceptor 661W cells.

[0158] Figure 6(A) shows the vector designed to confirm the effects of increasing and decreasing expression of some sequences in the GRK1-derived enhancer (GRK1e) sequence, Figure 6(B) shows the expression effect in HEK293FT, Figure 6(C) shows the expression effect in 661W, and Figure 6(D) shows the expression effect in rMC1 cells.

[0159] Figure 7(A) shows the design of the vector, in which the polyA signal sequence in the expression system of Figure 6 is replaced with a sequence derived from the bovine growth hormone gene. Figure 7(B) shows the expression effect in HEK293FT. Figure 7(C) shows the expression effect in MIO-M1. Figure 7(D) shows the expression effect in 661W cells.

[0160] Figure 8(A) shows the expression cassette selected in Figure 6 packaged into adeno-associated virus serotype 8 to confirm the expression effect in the retina of wild-type mice, Figure 8(B) shows the immunofluorescence staining results confirmed by intravitreal injection, and Figure 8(C) shows the immunofluorescence staining results confirmed by subretinal injection.

[0161] Figure 9 shows the AAV serotype 8 packaged into the sample shown in Figure 8 according to the expression cassette system of the present disclosure to confirm the expression effect in wild-type mice. Figure 9(A) shows fundus images obtained using scanning laser ophthalmoscopy (SLO), and Figure 9(B) is a graph showing the quantification of the fundus images. Detailed Implementation

[0162] The present disclosure will be described in more detail below by way of examples. However, these examples are provided by way of illustration only, and the scope of the disclosure is not limited to these examples.

[0163] Example 1. Cell culture and maintenance

[0164] HEK293FT (R70007, ThermoFisher), Y79 (HTB-18, ATCC), WERI-RB1 (HTB-169-ATCC), rMC-1 (ENW001, Kerasfast), MIO-M1 (RPID: CVCL_0433, courtesy of Professor G. Astrid Limb, London Institute of Ophthalmology, UK), and 661W (courtesy of Muayyad Al-Ubaidi, University of Houston) were inoculated in 100φ flasks and cultured at 37°C and 5% CO2. Subculture was performed every 2 to 3 days at a 1:5 inoculation ratio. HEK293FT, rMC-1, and 661W were cultured in DMEM and high glucose (Gibco, 11995-065), Y79 and WERI-RB1 were cultured in RPMI 1640 (Gibco, 31800-022), and MIO-M1 was cultured in DMEM supplemented with 1% Glutamax (Gibco, 35050061) and high glucose (Gibco, 11995-065). 10% FBS (Gibco, 12483020) and 1% PS (penicillin / streptomycin, Gibco, 15140122) were added to all media used.

[0165] Example 2. Selection of promoter type for introducing new promoter sequences

[0166] To select retinal-specific promoters, genes specifically expressed in retinal tissue were examined. For this purpose, promoter types capable of functioning as retinal-specific promoters were selected. More specifically, PDE6B, GRK1, RHO, ABCA4, RLBP1, GUCY2F, RBP3, and RS1 promoters were selected as candidates, and a group of promoters likely to result in high expression levels was selected by confirming Gaussian luciferase.

[0167] More specifically, the coding sequence for Gaussian luciferase and the PCK6 AS1 polyadenylate (poly A) signaling sequence were inserted into the 3' end of the aforementioned promoter. The constructed vector was then transfected into HEK293FT cells using 500 ng of Liposome 2000 (11668019, Invitrogen). As a control, 500 ng of a vector expressing firefly luciferase via the SV40 promoter was simultaneously delivered. After 24 hours, the intensity of each luciferase was quantified, and the Gaussian luciferase intensity was divided by the firefly luciferase intensity to confirm changes in expression.

[0168] The results show Figure 1 In addition, the promoters that can significantly increase expression levels were identified as PDE6B and GRK1.

[0169] Furthermore, the sequences of the PDE6B and GRK1 genes were identified relatively accurately, and it is known that the sequences of the corresponding promoters include some 5'-UTR sequences. Considering this, subsequent experiments were performed using PDE6B and GRK1, which have high development potential as promoters.

[0170] Example 3. Progress in promoter optimization

[0171] To optimize promoter function and length, various versions of promoters have been created. Promoter designs are based on promoter sequences with or without GRK1 or PDE6B in the 5'-UTR. At the 3' end of the promoter, the coding sequence for Gaussian luciferase and the PCK6 AS1 polyadenylate signal sequence are inserted.

[0172] The specific sequence-related information of the design is shown in Table 1 and Figure 2(A).

[0173] [Table 1]

[0174]

[0175] *Use "gtcgac" (SEQ ID NO: 25) as a spacer between the enhancer and promoter sequences.

[0176] *The coding sequence for Gaussian luciferase, which is linked to the promoter terminus or downstream of the 5'UTR, is as follows:

[0177] ""(SEQ ID NO: 41).

[0178] As described above, the sequence for the expression cassette used in AAV is designed to include an enhancer, a promoter, and a 5' UTR sequence. Specifically, in this experiment, the known enhancer IRBP was used to confirm the characterization of the promoter.

[0179] The constructed vector was transferred into HEK293FT and Y79 cells using 500 ng of liposome 2000. As a control, 500 ng of a vector expressing firefly luciferase via the SV40 promoter was simultaneously delivered. After 24 hours, the intensity of each luciferase was quantified, and the Gaussian luciferase intensity was divided by the firefly luciferase intensity to confirm changes in expression.

[0180] The results are shown in Figure 2(B), confirming that the GRK1 and PDE6B promoters according to this disclosure exhibited higher-than-expected expression enhancement efficiency in HEK293FTY79 cells. In particular, the PDE6B promoter demonstrated superior efficacy.

[0181] Furthermore, it was confirmed that expression levels were improved in all cases including the 5'UTR sequence, thus enabling sequence design by including the 5'UTR sequence together with the promoter sequence.

[0182] Example 4. Progress in enhancer optimization

[0183] To maximize the desired therapeutic efficacy, high levels of expression in cells such as retinal cells are required. Therefore, enhancers are modified to further optimize the enhancement of expression levels.

[0184] Specifically, the expression cassette was designed in a manner similar to that of Example 3 described above, but with the GRK1 enhancer inserted instead of the IRBP enhancer for the experiment. The specific vector design is shown in Table 2 and Figure 3(A).

[0185] [Table 2]

[0186]

[0187] *As a spacer region between the enhancer and promoter sequences, “gtcgac” (SEQ ID NO:25) is used in the vectors of SEQ ID NO:2 and SEQ ID NO:4, and “aagaggtcgac” (SEQ ID NO:34) is used in the vectors of SEQ ID NO:10 and SEQ ID NO:11.

[0188] *The coding sequence for Gaussian luciferase, linked downstream of the 5'UTR, is as follows:

[0189] "(SEQ ID NO: 41).

[0190] Experiments were conducted according to the method described in Example 3 to confirm the changes in Gaussian luciferase expression in HEK293FT, Y79, and WERI-RB1 cells.

[0191] The results are shown in Figures 3(B) and 3(C), and confirm that replacing the commonly used IRBP enhancer with the GRK1 enhancer (SEQ ID NO:12) resulted in a significant increase in expression levels.

[0192] Therefore, the GRK1 enhancer was used as the main enhancer in subsequent experiments.

[0193] In addition, to optimize the GRK1 enhancer, the sequences contained therein, namely SEQ ID NO:13 to 18 and SEQ ID NO:28 to 31, were designed separately, and new expression boxes were constructed by simply replacing the enhancer and combining it with the promoters described above in the same manner.

[0194] Example 5. Preparation of a combined expression cassette for improving tissue specificity of the RS1 promoter region

[0195] The AAV8-scRS1 / IRBP-hRS1 vector is a vector system prepared during a clinical trial registered under NCT02317887 and is described as a vector for photoreceptor-specific expression. However, this vector system has issues such as the need for high-dose administration, which may cause inflammatory responses, or the lack of sufficient efficacy when administered at low doses.

[0196] Therefore, expression cassettes with improved expression were designed using the GRK1 and PDE6B promoters, which were designed to exhibit overexpression characteristics. Specifically, based on the scRS1 / IRBP-hRS1 sequence, the sequence corresponding to hRS1 was altered to the GRK1 and PDE6B promoters, and their efficacy was examined.

[0197] More specifically, the expression box was designed in a manner similar to that of Example 3, and the results are shown in Table 3 and Figure 4(A).

[0198] [Table 3]

[0199]

[0200] *Use "gtcgac" (SEQ ID NO: 25) as a spacer between the enhancer and promoter sequences.

[0201] *The coding sequence for Gaussian luciferase, linked downstream of the 5'UTR, is as follows:

[0202] "(SEQ ID NO: 41).

[0203] Experiments were conducted according to the method described in Example 3 to confirm the changes in expression in HEK293FT, Y79, and WERI-RB1 cells. The results are shown in Figures 4(B) and 4(C), and it was confirmed that modification of the PDE6B or GRK1 promoter resulted in improved activity compared to the expression cassette called scRS1 / IRBP-hRS1.

[0204] Furthermore, expression in HEK293FT cells also partially increased with increasing total expression levels, but the increase in expression was significantly higher in WERI-RB1 and Y79 cells in terms of specificity.

[0205] Example 6: Confirmation of retinal cell-specific promoter activity

[0206] This allows for the selection of promoter and enhancer candidates that can increase absolute expression levels.

[0207] In this context, the combination of the GRK1 enhancer and the PDE6B promoter was considered to be capable of significantly increasing retinal cell-specific expression, and the extent to which these combinations improved tissue specificity compared to known scRS1 / IRBP-hRS1 expression cassette systems was evaluated.

[0208] For comparison, the expression box was designed in a manner similar to that of Example 3, and the carrier design is shown in Table 4 and Figure 5(A).

[0209] [Table 4]

[0210]

[0211] *As a spacer between the enhancer and promoter sequences, “gtcgac” (SEQ ID NO: 25) is used in the vectors of SEQ ID NO: 19 and SEQ ID NO: 26, and “aagaggtcgac” (SEQ ID NO: 34) is used in the vector of SEQ ID NO: 27.

[0212] *The coding sequence for Gaussian luciferase, linked downstream of the 5'UTR, is as follows:

[0213] "(SEQ ID NO: 41).

[0214] Experiments were conducted according to the method described in Example 3 to confirm the changes in expression in 661W cells (photoreceptor cells), and the results are shown in Figure 5(B).

[0215] As shown in Figure 5(B), pRS1-IRBPe-RS1 and pIRBPe-ΔN-RS1 did not exhibit tissue-specific expression efficacy in 661W cells (retinal photoreceptor cells). On the other hand, pGRK1e-PDE6B demonstrated a specific expression effect that significantly improved photoreceptors in 661W cells.

[0216] In particular, these results demonstrate that the pGRK1e-PDE6B-based expression cassette according to this disclosure can significantly enhance the specific expression of target genes on target cells in the absence of RS1 promoters known to be photoreceptor-specific.

[0217] This confirms that the promoter and enhancer candidates according to this disclosure can be used as suitable expression cassette systems compared to existing photoreceptor-specific expression systems.

[0218] Example 7: Confirmation of GRK1 enhancer engineering and expression efficiency

[0219] The sequences (SEQ ID NO: 30, 31) obtained by repeating the Ga1 (SEQ ID NO: 28) or Ga4 (SEQ ID NO: 29) sequence derived from the GRK1 enhancer (SEQ ID NO: 17) twice were combined with the PDE6B promoter (SEQ ID NO: 7) and RS1 5′UTR (SEQ ID NO: 24) to prepare novel expression cassettes (SEQ ID NO: 32, 33).

[0220] The specific carrier design is shown in Table 5 and Figure 6(A).

[0221] [Table 5]

[0222]

[0223] *As a spacer between the enhancer and promoter sequences, “gtcgac” (SEQ ID NO: 25) is used in the vector of SEQ ID NO: 19, and “aagaggtcgac” (SEQ ID NO: 34) is used in the vectors of SEQ ID NO: 27, 32 and 33.

[0224] *The coding sequence for Gaussian luciferase, linked downstream of the 5'UTR, is as follows:

[0225] "(SEQ ID NO: 41).

[0226] Experiments were conducted according to the method described in Example 3 to confirm changes in expression in HEK293FT, 661W, and rMC-1 cells. Results for each cell are shown in Figures 6(B) through 6(D), and the results confirm that the expression level showed the greatest improvement when the enhancer was repeated twice with the Ga1 sequence.

[0227] Example 8: Confirmation of expression improvement based on polyA signal sequence replacement

[0228] In the expression system of Example 7, the polyA signal sequence was replaced. More specifically, the polyA signal sequence derived from the PCK6 AS1 gene, which is linked to the 3' end of the Gaussian luciferase coding sequence, was replaced with a polyA signal sequence derived from the bovine growth hormone (BGH) gene.

[0229] The specific carrier design is shown in Table 6 and Figure 7(A).

[0230] [Table 6]

[0231]

[0232] *As a spacer between the enhancer and promoter sequences, “gtcgac” (SEQ ID NO: 25) is used in the vector of SEQ ID NO: 19, and “aagaggtcgac” (SEQ ID NO: 34) is used in the vectors of SEQ ID NO: 27, 32 and 40.

[0233] *The coding sequence for Gaussian luciferase, linked downstream of the 5'UTR, is as follows:

[0234] "" (SEQ ID NO: 41).

[0235] Experiments were conducted according to the method described in Example 3 to confirm changes in expression in HEK293FT, 661W, and MIO-M1 cells. Results for each cell type are shown in Figures 7(B) through 7(D), and the results confirm that the expression level showed the greatest improvement when the BGH polyA signaling sequence was used.

[0236] Example 9: AAV vector construction and virus production

[0237] The combination of the GRK1 enhancer and PDE6B promoter, which demonstrated excellent expression in Example 7, was inserted into the AAV vector. More specifically, the enhancer and PDE6B promoter were inserted sequentially between the ITR sequences on either side, and the mCherry-encoding gene and the human β-globulin polyA sequence were inserted at the 3' end of the promoter. The completed vector was then packaged into adeno-associated virus serotype 8 and used for subsequent in vivo experiments.

[0238] AAV was constructed using a three-plasmid transfection system without helper virus, employing HEK293 cells. pHelper (#6230, AAVpro Helper Free system, TAKARA BIO INC) was used instead of helper virus. The mCherry fluorescent protein constructed in Example 8 was expressed using the pAAV-promoter-mCherry expression vector, and the AAV serotype 8 capsid was packaged using the pRep2-Cap8 vector. After packaging in HEK293 cells, AAV was purified by CsCl2 ultracentrifugation to produce high-purity AAV. Genomic titers were measured using primer-F: CACTACGACGCTGAGGTCAA (SEQ ID NO:37) and primer-R: TAGTCCTCGTTGTGGGAGGT (SEQ ID NO:38).

[0239] Example 10: In vivo AAV injection and immunofluorescence

[0240] Mice (C57BL / 6J, DBL) were 8-week-old males housed in an SPF facility. Using a NanoFil syringe (World Precision Instruments Inc., Sarasota, Flt., USA) equipped with a 35-gauge needle, mice were injected with 4.5 × 10⁴ mg / L of urea solution via intravitreal and subretinal injection. 10 vg / 1.5μl of AAV.

[0241] Four weeks after viral injection, mice were euthanized under anesthesia to remove their eyes, and the expression of the mCherry fluorescent protein gene in the retina was confirmed using a scanning laser ophthalmoscopy (SLO). After separating the retina from the removed eye, retinal sections were stained with primary anti-mCherry antibody (PA5-34974, Invitrogen) and secondary anti-mCherry antibody (a secondary antibody highly cross-linked with donkey anti-rabbit IgG (H+L), Alexa Fluor™ 568, A10042, Invitrogen). The distribution and intensity of mCherry protein in the retina were imaged using LeicaDMi8 (Leica). The expression intensity of mCherry was quantified using ImageJ software, and the collected data were statistically analyzed using the Kruskal-Wallis test implemented in SPSS statistical program (Windows version 22.0; IBM Corp., Armonk, NY). Post-hoc validation was performed using the Mann-Whitney U test.

[0242] The results of intravitreal injection are shown in Figure 8(B), and the results of subretinal injection are shown in Figures 8(C) and 9.

[0243] As shown in Figure 8(B), the expression system with the combination of the Ga1X2 enhancer and the PDE6B promoter (denoted as Ga1X2P in Figure 8) showed improved protein expression levels compared to the existing patented model (denoted as RIR in Figure 8) and GRK1e (denoted as GRK1eP in Figure 8). According to Figures 8(C) and 9, the same results were shown even in subretinal injection, confirming that the expression level was approximately 2.6 times or more than that of the existing patented model when gene expression was quantified.

[0244] As described above, those skilled in the art will understand that this disclosure may be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the above embodiments are exemplary and not restrictive in any way. The scope of this disclosure should be construed as including all changes or modifications derived from the meaning and scope of the claims described below and their equivalents, but not from the detailed description.

Claims

1. A promoter of 100 to 400 nucleotides in length, comprising a nucleotide sequence as a core nucleotide sequence, said nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO:6 or SEQ ID NO:7, or being the sequence of SEQ ID NO:6 or SEQ ID NO:

7.

2. The promoter according to claim 1, wherein, The promoter is a retina-specific promoter.

3. The promoter according to claim 1, wherein, The promoter comprises a nucleotide sequence having a sequence having SEQ ID NO: 6 or SEQ ID NO:

7.

4. An expression cassette comprising: a promoter of 100 to 400 nucleotides in length, the promoter comprising a nucleotide sequence as a core nucleotide sequence having at least 90% identity with a sequence of SEQ ID NO:6 or SEQ ID NO:7, or being a sequence of SEQ ID NO:6 or SEQ ID NO:7; and nucleotides encoding a polypeptide operatively linked to the promoter.

5. The expression cassette according to claim 4, further comprising any one of the enhancers selected from the group consisting of SEQ ID NO: 12 to 18 and 28 to 31.

6. The expression box according to claim 4, wherein, The promoter comprises a nucleotide sequence having a sequence having SEQ ID NO: 6 or SEQ ID NO:

7.

7. The expression box according to claim 4, further comprising any 5'UTR selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO:

24.

8. The expression box according to claim 4, wherein, The polypeptide is a therapeutic protein or a reporter protein.

9. A carrier comprising an expression cassette according to any one of claims 4 to 8.

10. The carrier according to claim 9, wherein, The vector may be a viral vector or a non-viral vector.

11. The carrier according to claim 10, wherein, The viral vector is selected from any one of the following groups: Moloney's murine leukemia virus vector (MoMLV), murine stem cell virus (MSCV), spleen focal formation virus (SFFV), myeloproliferative sarcoma virus (MPSV) or SNV, lentiviral vectors (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), adenovirus (Ad) vector, adeno-associated virus (AAV) vector, simian virus 40 (SV-40) vector, bovine papillomavirus vector, Epstein-Barr virus vector, herpesvirus vector, vaccinia virus vector, Harvey's murine sarcoma virus vector, murine mammary tumor virus vector, ring virus vector, and Rous sarcoma virus vector.

12. The carrier according to claim 11, wherein, The viral vector is an adeno-associated virus (AAV) vector.

13. The carrier according to claim 10, wherein, The non-viral vector is selected from any one of the group consisting of lipid nanoparticles (LNP), polymer nanoparticles (PNP), exosomes, and virus-like particles (VLP).

14. A viral particle comprising the vector according to claim 9.

15. An adeno-associated virus (AAV) particle comprising the vector of claim 9 and an AAV-derived capsid.

16. A cell transformed with the expression cassette according to any one of claims 4 to 8.

17. The cell according to claim 16, wherein, The cells in question are photoreceptor cells.

18. A pharmaceutical composition comprising an expression cassette according to any one of claims 4 to 8; and a pharmaceutically acceptable excipient.

19. A pharmaceutical composition for the prevention or treatment of eye diseases, comprising an expression cassette according to any one of claims 4 to 8.

20. A method for enhancing the expression of a target gene in the retina, comprising administering an expression cassette according to any one of claims 4 to 8 to a subject in need.

Images