Dsrna for controlling anthracnose in crops and use thereof

By designing a dsRNA targeting the gene encoding inositol phosphatidylceramide (IPC) synthase and combining it with nanolayered double hydroxides, the problems of low delivery efficiency and high cost of RNA pesticides in the control of anthracnose were solved, achieving efficient and targeted disease control.

CN121022845BActive Publication Date: 2026-02-17HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511556377.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-29
Publication Date
2026-02-17
Estimated Expiration
2045-10-29

AI Technical Summary

Technical Problem

Existing RNA pesticides are easily degraded by environmental enzymes when controlling anthracnose, resulting in low delivery efficiency and high cost, making it difficult to achieve efficient and targeted disease control.

Method used

We designed dsRNA targeting the gene encoding inositol phosphatidylceramide (IPC) synthase and combined it with nanolayered double hydroxides to form LDH-dsRNA nanocompositions, which can be sprayed/spotted onto crop surfaces to improve control efficacy.

Benefits of technology

It significantly reduces the area of ​​anthracnose lesions, improves control efficiency, and reduces disease occurrence, making it suitable for efficient and targeted control of crop anthracnose.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121022845B_ABST
    Figure CN121022845B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of RNA biological control, and particularly relates to dsRNA for preventing and treating crop anthracnose and application thereof. The dsRNA is target myo-inositol phosphatidylceramide (IPC) synthase coding gene dsRNA, which is transcribed from a partial sequence (SEQ ID No. 1) of myo-inositol phosphatidylceramide (IPC) synthase coding gene CaAUR1. The gene segment is a segment of a target gene for preventing and treating crop anthracnose. The transcribed dsRNA can obviously reduce the pathogenicity of Guignardia mangiferae, has application prospects of mango preservation and prevention of crop anthracnose, and can be used for preventing and treating crop anthracnose or preparing products for preventing and treating crop anthracnose.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of RNA biological control technology, specifically relating to a dsRNA for controlling crop anthracnose and its application. Background Technology

[0002] Anthrax ( genus Anthrax) Colletotrichum Anthracnose, caused by the fungus *Anthracnose*, is widely recognized as one of the top ten most important fungal plant pathogens globally. It severely damages various crops, cash crops, and horticultural plants, leading to leaf death, fruit rot, and yield loss. Statistics show that the quality of exported fruits from tropical, subtropical, and Mediterranean regions has significantly declined due to anthracnose infection, resulting in economic losses of up to 60%-80% annually after harvest.

[0003] RNA pesticides are novel biological pesticides developed based on RNA interference (RNAi) technology. Essentially, they specifically bind to the mRNA transcribed from specific genes in target organisms. Through the naturally occurring RNAi pathway within the target organism, they cause transcript degradation or inhibit translation, thereby interfering with the normal growth of the target organism and its harm to the host plant, ultimately achieving pest control and plant protection. RNA pesticides are defined as biological pesticides. Compared to traditional chemical pesticides, double-stranded RNA (dsRNA) pesticides have many advantages. First, dsRNA has strong specificity and efficient gene silencing ability without involving transgenic technology. Second, based on target design, dsRNA can inhibit the growth of viruses, bacteria, and fungi, thus controlling the diseases they cause. Furthermore, dsRNA can cross cell membranes and be delivered within the body. Finally, dsRNA is easily degraded in the environment, making it an environmentally friendly pesticide. Based on these advantages, RNA pesticides offer significant benefits for pest and disease control: high specificity, good efficacy, low risk of resistance development, non-toxic, harmless, and residue-free, with low development costs, representing a cutting-edge direction in green agricultural pest control.

[0004] However, the application of RNA pesticides also faces many challenges. For example, naked dsRNA is easily degraded by enzymes and ultraviolet light in the environment, resulting in short-lived efficacy; the epidermis of harmful organisms hinders the absorption of dsRNA, leading to low dsRNA delivery efficiency and affecting the silencing effect of target genes; and large-scale synthesis of dsRNA is costly. Therefore, how to obtain highly efficient and targeted anthrax RNA pesticides is an urgent problem to be solved in this field. Summary of the Invention

[0005] The purpose of this invention is to provide a dsRNA that targets the gene encoding inositol phosphatidylceramide (IPC) synthase for efficient and targeted control of crop anthracnose.

[0006] This invention provides the application of dsRNA in the control of crop anthracnose and / or the preparation of products for the control of crop anthracnose, wherein the dsRNA is transcribed from the target gene segment shown in SEQ ID. No. 1, and the nucleotide sequence of the dsRNA is shown in SEQ ID No. 2; the crop includes mango and / or rubber; the pathogen of the crop anthracnose is *Anthracnose asiaticus* (…). Colletotrichum asianum ) and / or Siamese anthrax bacteria ( Colletotrichum siamense ).

[0007] Preferably, the product comprises the dsRNA and nanolayered double hydroxides described in the above technical solution; the nanolayered double hydroxides include one or more of magnesium / aluminum layered double hydroxides, zinc / aluminum layered double hydroxides, nickel / iron layered double hydroxides, and nickel / aluminum layered double hydroxides; the dsRNA is transcribed from the target gene segment shown in SEQ ID No. 1; the nucleotide sequence of the dsRNA is shown in SEQ ID No. 2.

[0008] The present invention also provides a method for preventing and controlling crop anthracnose, comprising the following steps:

[0009] Apply the dsRNA or the product described in the above technical solution to crops.

[0010] Preferably, the application method includes spraying or spot application.

[0011] Preferably, when the crop is a mango, the part to which the application is made is the fruit; when the crop is a rubber tree, the part to which the application is made is the leaf.

[0012] The beneficial effects of this invention are:

[0013] This invention provides a dsRNA targeting the inositol phosphatidylceramide (IPC) synthase encoding gene; the dsRNA targeting the inositol phosphatidylceramide (IPC) synthase encoding gene is transcribed from the target gene segment shown in SEQ ID No. 1. This gene segment is a target gene segment for the control of crop anthracnose and can be used to control crop anthracnose or to prepare products for the control of crop anthracnose.

[0014] Based on the above-mentioned technical advantages, this invention also provides an LDH-dsCaAUR1 formulation. This invention combines dsRNA with nanomaterials and uses highly pathogenic anthrax bacteria. Colletotrichum asianum02-3 were the experimental materials. First, the dsRNA segment of the target gene was obtained using in vitro dsRNA synthesis technology. Then, it was compounded with layered double hydroxide (LDH) nanomaterials to obtain a dsRNA nanocomposite for crop control. The dsRNA nanocomposite was sprayed / spotted onto mango fruits, and then the mango fruits were inoculated with *Anthracnose asiaticus*. Colletotrichum asianum 02-3, measure the area of ​​lesions to obtain a combination of dsRNA, a target gene for the effective control of anthracnose in mango fruit, and nano-LDH, which can efficiently and effectively control crop anthracnose. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0016] Figure 1 Electrophoresis diagram of the transcription product provided by this invention;

[0017] Figure 2 The diagram illustrates the effectiveness of mango anthracnose control provided by this invention.

[0018] Figure 3 The image shows the preservation effect of mangoes in preventing anthracnose provided by this invention.

[0019] Figure 4 This is a statistical result of the severity of disease after the mangoes were stored for different numbers of days in an embodiment of the present invention;

[0020] Figure 5 This image shows the effectiveness of anthrax control in rubber plants. Detailed Implementation

[0021] In this invention, unless otherwise specified, the materials, reagents and equipment used are all conventional selections.

[0022] This invention provides a segment of a target gene for the control of crop anthracnose, wherein the target gene segment is anthracnose fungus. CaAUR1The gene target gene segment is selected from the N-terminal sequence of the coding region of the gene, and its nucleotide sequence is shown in SEQ ID No. 1, specifically: 5'-ACCGGCAACATCAACTTCGCAAAACTCAACCCCATACCGCACCGATACCGATCCAACCGAGCAAAGAGGAATCAGAAGAAGCGCGCCAGCGGCCCCGAAGATGTCGTATCTCTGCAAAAGTCCCTCAACCCTCTCGAGACCCTTTCAAAGTTGAGGAATCACAAGTGGAGACTGCTCGACTTGCAGTACATCATCCTCGTCGCCCTCATCGTCTTCTCCCTCTGTATCACGCCCTCAGCGCCCTTGATCAAGACCGCCGCCGTCGCTGGTGGTCTCCTTCTCCTCACCGTTCCTCTCACCAGCCAGTTCTTCTTTCCTGGATTGAGCATATGGGCCTACCT-3'.

[0023] This invention provides anthrax bacteria CaAUR1 The dsCaAUR1 gene for controlling crop anthracnose, transcribed from a gene target region; the nucleotide sequence of the dsCaAUR1 is shown in SEQ ID. As shown in No. 2, specifically: 5'-AGGUAGGCCCAUAUGCUCAAUCCAGGAAAGAAGAACUGGCUGGUGAGAGGAACGGUGAGGAGAAGGAGACCACCAGCGACGGCGGCGGUCUUGAUCAAGGGCGCUGAGGGCGUGAUACAGAGGGAGAAGACGAUGAGGGCGACGAGGAUGAUGUACUGCAAGUCGAGCAGUCUCCACUUGUGAUUCCUCAACUUUGAAAGGGUCUCGAGAGGGUUGAGGGACUUUUGCAGAGAUACGACAUCUUCGGGGCCGCUGGCGCGCUUCUUCUGAUUCCUCUUUGCUCGGUUGGAUCGGUAUCGGUGCGGUAUGGGGUUGAGUUUUGCGAAGUUGAUGUUGCCGGU-3'; The dsRNA sequence shown in SEQ ID No. 2 is inversely complementary to the nucleotide sequence shown in SEQ ID No. 1.

[0024] The layered double hydroxides described in this invention include magnesium / aluminum layered double hydroxides, zinc / aluminum layered double hydroxides, nickel / iron layered double hydroxides, and nickel / aluminum layered double hydroxides. The layered double hydroxides described in the following examples are magnesium / aluminum layered double hydroxides (MgAl-LDH two-dimensional layered bimetallic hydroxides), which were purchased from Nanjing Xianfeng Nanomaterials Technology Co., Ltd.

[0025] To further illustrate the present invention, the solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0026] Example 1

[0027] 1. Previous studies have shown that anthrax bacteria inositol phosphatidylceramide (IPC) synthase... CaAUR1 Gene( CaAUR1 The gene (accessed via NCBI at accession number PX226849) is an important pathogenic factor of Bacillus anthracis, and this gene may have the potential to serve as a target for anthracis control; according to CaAUR1 A pair of specific primers, dsCaAUR1-F (SEQ ID No. 3) and dsCaAUR1-R (SEQ ID No. 4), were designed for gene synthesis. Using the extracted DNA from the highly pathogenic wild-type strain 02-3 as a template, a DNA fragment (SEQ ID No. 1) was amplified and used for subsequent dsCaAUR1 synthesis. The specific primer sequences are shown in Table 1.

[0028] Table 1 Primer Information

[0029]

[0030] 2. dsRNA was synthesized in vitro using the T7RNAi Transcription Kit from Nanjing Vazyme Biotech Co., Ltd. T7 RNA ploymerase recognizes DNA templates with T7 promoters and uses four NTPs as substrates for in vitro transcription to synthesize dsCaAUR1. The specific method is as follows:

[0031] a. Configure the reaction system as shown in Table 2.

[0032] Table 2 Reaction System

[0033]

[0034] b. The PCR product dsCaAUR1 (SEQ ID No. 2) was obtained by reacting at 37°C for 6 hours in a PCR instrument.

[0035] c. Dilute 100 U / μL RNase T1 to 10 U / μL with RNase T1 Dilution Buffer, and incubate the transcription product to digest excess template DNA and single-stranded RNA. The incubation system is shown in Table 3.

[0036] Note: RNase T1 specifically degrades single-stranded RNA and the three G bases at the 5' end. Diluted RNase T1 should be used as soon as possible and should not be stored.

[0037] Table 3 Incubation System

[0038]

[0039] Note: After mixing, gently pipette to mix thoroughly, and briefly centrifuge the reagent to the bottom of the tube.

[0040] d. Incubate at 37℃ for 30 min to obtain pure dsCaAUR1 (SEQ ID No. 2).

[0041] e. Electrophoresis was used to detect the transcription product (i.e., dsCaAUR1 as shown in SEQ ID No. 2), and the results are as follows: Figure 1 As shown (in) Figure 1 In the diagram, a represents the position of dsCaAUR1 on the CaAUR1 protein; b represents the electrophoresis diagram of the transcript, where lane M is the DNA DL2000 marker and lane 1 is the electrophoresis result of dsCaAUR1.

[0042] f. Product purification

[0043] RNA was purified using the magnetic bead method.

[0044] Remove the RNA Clean Beads from 4°C and allow them to equilibrate to room temperature for 30 minutes. Invert or vortex to mix well before use.

[0045] (2) Add 80 μL of magnetic bead solution to the transcription product and pipette to mix the solution thoroughly more than 10 times.

[0046] (3) Incubate at room temperature for 8 min to allow the RNA to fully bind with the magnetic beads.

[0047] (4) Place the PCR tube on the magnetic rack for about 5 minutes. After the solution becomes clear, carefully remove the supernatant. When aspirating the supernatant, be careful not to disturb the magnetic beads.

[0048] (5) Keep the PCR tube on the magnetic rack at all times, add 200 μL of freshly prepared 80% ethanol, being careful not to disturb the magnetic beads, incubate at room temperature for 30 sec, and carefully remove the supernatant. Repeat this step once.

[0049] (6) Open the lid and air dry the magnetic beads for 5-10 minutes. Dry until there is no water on the surface of the magnetic beads. Over-drying will affect the elution of RNA.

[0050] (7) Remove the PCR tube from the magnetic rack, add 40 μL of RNase-free H2O, use a pipette to blow the magnetic beads off the tube wall, mix thoroughly, and incubate at room temperature for 3 min.

[0051] (8) Place the PCR tube on a magnetic rack. After the solution has clarified, carefully transfer the supernatant to a new RNase-free EP tube, being careful not to pick up the magnetic beads. To avoid the magnetic beads affecting subsequent experiments, reserve 1-2 μL of solution when transferring the product to prevent picking up the magnetic beads.

[0052] (9) Detect the A260 absorbance of the product to determine its concentration, and store the purified product (i.e. dsCaAUR1) at -20℃.

[0053] 3. Preparation of Anthrax Inoculum: Activate the *Anthracis mangosteen* strain 02-3 from the inoculum tube on PDA solid medium. Scrape fresh mycelia from the edge of the activated strain onto PDA solid medium and incubate at 28℃ for 5 days. Collect appropriately sized 02-3 mycelial cakes for later use.

[0054] 4. Layered double hydroxide (LDH) nanomaterials supporting dsCaAUR1

[0055] LDH (magnesium / aluminum layered double hydroxide) nanomaterials were dissolved in DEPC water to obtain LDH working solution (200 μg / mL). dsRNA was diluted with LDH working solution to prepare LDH-dsRNA mixture (final dsRNA concentration in the mixture was 200 ng / μL). The diluted LDH-dsRNA mixture was placed in a 55 ℃ water bath and allowed to stand for 1 min, then quickly transferred to a high-speed vortex mixer and vortexed for 2 min, followed by standing for 2 min. At this point, dsRNA was adsorbed onto the LDH surface, forming stable LDH-dsRNA nanoparticles.

[0056] 5. Application of LDH-dsCaAUR1 in the control of mango anthracnose

[0057] The preventive effects of dsCaAUR1 and LDH-dsCaAUR1 nano-formulations on mango anthracnose were analyzed, and four treatment groups were designed respectively.

[0058] The first group was treated with naked dseGFP (dsRNA synthesized from the green fluorescent protein encoding gene sequence, prepared in the same way as dsCaAUR1 treatment) as control 1;

[0059] The second group was treated as control 2 by adding LDH-dseGFP.

[0060] The third group was treated with exposed dsCsAUR1;

[0061] The fourth group was treated with LDH-dsCaAUR1 dropwise.

[0062] Select mangoes with similar growth and size for inoculation. Inoculate 6 points on each mango, and repeat the experiment 5 times.

[0063] 20 μL of dsCaAUR1 and the control dseGFP, and 20 μL of LDH-dsCaAUR1 and the control LDH-dseGFP were applied by spot application / spraying, respectively. After 24 hours of treatment, the mango fruit surface was pricked to create wounds, and then inoculated with mycelial cakes (0.5 cm in diameter) of Asian anthracnose 02-3. The results are shown in the figure. Figure 2 (exist Figure 2 In the figure, Figure a shows the phenotype of mango anthracnose lesions after spraying with dsRNA; Figure b shows the area of ​​mango anthracnose lesions after spraying with dsRNA; Figure c shows the phenotype of mango anthracnose lesions after spot application of dsRNA; and Figure d shows the area of ​​mango anthracnose lesions after spot application of dsRNA.

[0064] Combination Figure 2 The results showed no significant difference between the naked dseGFP and LDH-dseGFP treatments. The lesion area was significantly smaller in both the naked dsCaAUR1 and LDH-dsCaAUR1 treatments compared to the control. Specifically, after spraying dsRNA and applying a puncture wound treatment, the lesion area decreased by 41.23% in the naked dsCaAUR1 treatment compared to control 1, and by 68.90% in the LDH-dsCaAUR1 treatment compared to control 2. This indicates that applying either naked dsCaAUR1 or LDH-dsCaAUR1 can effectively reduce anthracnose infection of mango fruits and provides good protection, but LDH can enhance the control efficacy.

[0065] 6. Application of LDH-dsCaAUR1 in postharvest preservation of mango anthracnose

[0066] The application of LDH-dsCaAUR1 nano-formulation in postharvest preservation of mango anthracnose was analyzed;

[0067] Select fruits with uniform appearance and maturity, rinse them with running water and air dry them for later use, and design three treatment groups respectively.

[0068] The first group was treated with water and served as control 1.

[0069] The second group was sprayed with LDH-dseGFP and served as control 2.

[0070] The third group was treated with LDH-dsCaAUR1 spray;

[0071] After treatment, store in a clean, cool, and well-ventilated place. Take photos and record the disease condition on the fruit surface at 0, 3, 5, 7, 9, and 12 days. Figure 3 As shown; the severity of disease in mangoes on days 7, 9, and 12 was statistically analyzed, and the results are as follows. Figure 4 As shown.

[0072] Combination Figure 3 and Figure 4 The results showed that the severity of anthracnose disease in mangoes treated with LDH-dsCaAUR1 for 12 days was less than that in the control and control 2, indicating that LDH-dsCaAUR1 can effectively reduce the occurrence of anthracnose.

[0073] Example 2

[0074] The experiment on the prevention of rubber anthrax by dsCaAUR1 was analyzed, involving two treatment groups;

[0075] The first group was treated as control 1 by adding dseGFP (dsRNA synthesized from the gene sequence encoding green fluorescent protein);

[0076] The second group was added dropwise with dsCaAUR1;

[0077] Select rubber leaves with uniform growth for inoculation. Inoculate 6 points on each rubber leaf, and repeat the experiment 5 times.

[0078] After applying 10 μL of dsCaAUR1 and the control dseGFP respectively, and treating for 24 h, the rubber leaves were pricked to create wounds, and then inoculated with *H. siamese anthracnose* HN08 (0.5 cm diameter fungal cake). Results are shown in [Figure missing]. Figure 5 (exist Figure 5 In the figure, figure a shows the phenotype of rubber anthrax lesions after spot application of dsRNA; figure b shows the area of ​​rubber anthrax lesions after spot application of dsRNA.

[0079] Combination Figure 5 The results showed that, compared with the control group exposed to naked dseGFP, the lesion area treated with dsCaAUR1 decreased by 71.57%. This indicates that dsCaAUR1 can effectively reduce the infection of rubber leaves by anthracnose fungi and has a good protective effect on rubber leaves.

[0080] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of a dsRNA for controlling anthracnose in crops, characterized in that, The dsRNA is transcribed from a target gene segment shown in SEQ ID No. 1; the nucleotide sequence of the dsRNA is shown in SEQ ID No. 2; the crops include mango and / or rubber; and the pathogenic bacteria of anthracnose of the crops are Colletotrichum gloeosporioides and / or C. siam.

2. Use of a dsRNA in the manufacture of a product for controlling anthracnose in a crop, characterized in that, The product comprises dsRNA and nano-layered double hydroxide; the nano-layered double hydroxide comprises one or more of magnesium / aluminum layered double hydroxide, zinc / aluminum layered double hydroxide, nickel / iron layered double hydroxide and nickel / aluminum layered double hydroxide; the dsRNA is transcribed from a target gene segment shown in SEQ ID No. 1; the nucleotide sequence of the dsRNA is shown in SEQ ID No. 2; The crops include mango and / or rubber; and the pathogenic bacteria of anthracnose of the crops are Colletotrichum gloeosporioides and / or C. siam.

3. A method of controlling anthracnose disease in crops, characterized by, The method comprises the following steps: The dsRNA of claim 1 or the product of claim 2 is applied to crops; the crops are mango and / or rubber; The pathogenic bacteria of anthracnose of the crops are Colletotrichum gloeosporioides and / or C. siam.

4. The method of claim 3, wherein, The application mode comprises spraying or point application.

5. The method of claim 3, wherein, When the crops are mango, the application site is fruit; and when the crops are rubber, the application site is leaf.

Citation Information

Patent Citations

  • LDH-dsRNA nano preparation for preventing and treating crop anthracnose and application of LDH-dsRNA nano preparation

    CN118109462A

  • Application of dsRNA of targeting sphingolipid C-4 hydroxylase coding gene

    CN120192969A