Application of GmNSE1 gene in regulation and control of soybean root nodule nitrogen fixation efficiency

Abstract

The invention discloses application of a GmNSE1 gene in regulation and control of soybean root nodule nitrogen fixation efficiency. The application of the GmNSE1 gene or a biological material related to the GmNSE1 gene in at least one of the following aspects: A1) regulating and controlling the nitrogen fixation efficiency of soybean root nodules or preparing a product for regulating and controlling the nitrogen fixation efficiency of the soybean root nodules; a2) cultivating soybeans with improved nitrogen fixation efficiency or preparing products for improving the nitrogen fixation efficiency of the soybeans; a3) preparing transgenic soybeans; the nucleotide sequence of the GmNSE1 gene is as shown in SEQ ID NO. 1. The specificity of the GmNSE1 gene is expressed in a root nodule infection area, the GmNSE1 gene has E3 ubiquitin ligase enzyme activity in vitro, and the activity of a mutant with the GmNSE1 gene knocked out is remarkably reduced compared with that of wild nitrogenase, so that the GmNSE1 gene plays an important role in the process of regulating and controlling the symbiotic nitrogen fixation capacity of soybean root nodules; the method has application prospects in research on nitrogen fixation mechanisms of leguminous crops and agricultural production.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically involving GmNSE1 Application of genes in regulating nitrogen fixation efficiency in soybean root nodules. Background Technology

[0002] How legumes achieve symbiotic nitrogen fixation with rhizobia is a crucial scientific question with significant economic and ecological value. Over 100 million years of co-evolution, legumes and rhizobia have developed a stable and efficient symbiotic relationship. To ensure coordinated interaction, each stage of symbiotic nitrogen fixation is strictly regulated by the symbiotic system. In recent years, with in-depth research, our understanding of the regulatory processes of symbiotic nitrogen fixation has deepened, and a series of regulatory factors have been identified. However, current research on the regulatory mechanisms of symbiotic nitrogen fixation mainly focuses on transcriptional regulation, with limited research on protein regulation. Therefore, in-depth analysis of the regulatory mechanisms of symbiotic nitrogen fixation at the protein level will contribute to a comprehensive understanding of the molecular mechanisms of symbiotic nitrogen fixation and provide a theoretical basis for achieving biological nitrogen fixation in non-legume plants.

[0003] Protein ubiquitination is an important protein-level regulatory mechanism in eukaryotic cells, and its regulation of protein fate provides crucial support for the orderly occurrence of life processes. Symbiotic nitrogen fixation is accompanied by drastic changes in the cellular environment, requiring the reintegration of protein systems. In this process, protein ubiquitination may play a vital regulatory role. Therefore, studying root nodule-specific ubiquitinated components is of great significance for systematically elucidating the symbiotic nitrogen fixation mechanism of legumes such as soybean. It can help improve the efficiency of symbiotic nitrogen fixation in legumes and significantly reduce the application of chemical nitrogen fertilizers in the field, providing new ideas for achieving sustainable agriculture with a green economy. Summary of the Invention

[0004] To address the technical problems existing in the prior art, the present invention provides... GmNSE1 Application of genes in regulating nitrogen fixation efficiency in soybean root nodules.

[0005] The first aspect of the present invention provides GmNSE1 Use of genes or related biological materials in at least one of the following: A1) Regulate the nitrogen fixation efficiency of soybean root nodules or prepare products that regulate the nitrogen fixation efficiency of soybean root nodules. A2) Cultivate soybeans with improved nitrogen fixation efficiency or prepare products that improve the nitrogen fixation efficiency of soybeans; A3) Preparation of genetically modified soybeans; The GmNSE1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] > GmNSE1 CDS sequence In some embodiments, the biomaterial includes one or more of the following: A1) GmNSE1 The gene-encoded protein and / or containing the above GmNSE1 Gene recombinant vectors, recombinant microorganisms, or transgenic soybean cell lines; A2) Contains negative regulation GmNSE1 Nucleic acid molecules expressing genes, recombinant vectors, recombinant microorganisms, or transgenic soybean cell lines.

[0007] In some embodiments, regulating the nitrogen fixation efficiency of soybean root nodules includes regulating the activity of nitrogenase in soybean root nodules.

[0008] In some specific embodiments, the regulation of nitrogenase activity in soybean root nodules includes: through positive regulation GmNSE1 Gene expression is used to improve nitrogen fixation efficiency in soybean root nodules.

[0009] In some specific implementations, through negative regulation GmNSE1 Gene expression is used to reduce nitrogen fixation efficiency in soybean root nodules.

[0010] In some embodiments, the containing GmNSE1 Gene recombination vectors include basic vectors and GmNSE1 The underlying carrier includes pDEST or pMalC2 carrier.

[0011] In some embodiments, the containing GmNSE1 Recombinant microorganisms include Agrobacterium rhizogenes K599.

[0012] In some implementations, the negative regulation GmNSE1 The nucleic acid molecule expressing the gene includes a guide RNA, the nucleotide sequence of which is shown in SEQ ID NO.4.

[0013] In some implementations, the negative regulation GmNSE1 The recombinant vector for gene expression includes a base vector, which is the pGES201 vector.

[0014] In some implementations, the negative regulation GmNSE1 Recombinant microorganisms that express genes include Agrobacterium strain EHA105.

[0015] In some embodiments, the GmNSE1 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.1.

[0016] >GmNSE1 amino acid sequence *(SEQ ID NO.2) The second aspect of the invention provides positive regulation GmNSE1 Application of gene-expressing biomaterials in cultivating soybeans with improved nitrogen fixation efficiency; GmNSE1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0017] In some implementations, the positive regulation GmNSE1 Biological materials for gene expression include: GmNSE1 The gene-encoded protein and / or containing the above GmNSE1 Gene recombinant vectors, recombinant microorganisms, or transgenic soybean cell lines.

[0018] In some embodiments, the improved nitrogen fixation efficiency includes: increasing the activity of nitrogenase in soybean root nodules.

[0019] A third aspect of the present invention provides a method for improving the nitrogen fixation efficiency of soybeans, comprising: Positive regulation GmNSE1 Gene-expressing biological materials are transferred into soybeans.

[0020] Positive regulation GmNSE1Gene-expressing biological materials can be transferred into soybean plants using methods such as Agrobacterium-mediated transformation, gene gun methods, and pollen pathway methods, which can be selected by those skilled in the art according to actual needs. In this application, positive regulatory genes are transferred using Agrobacterium-mediated transformation. GmNSE1 Biological materials for gene expression.

[0021] A fourth aspect of the present invention provides a method for cultivating soybeans with improved nitrogen fixation efficiency, comprising: Positive regulation GmNSE1 Gene-expressing biological materials are transferred into soybeans and cultivated.

[0022] Positive regulation GmNSE1 Gene-expressing biological materials can be transferred into soybean plants using methods such as Agrobacterium-mediated transformation, gene gun methods, and pollen pathway methods, which can be selected by those skilled in the art according to actual needs. In this application, positive regulatory genes are transferred using Agrobacterium-mediated transformation. GmNSE1 Biological materials for gene expression.

[0023] In some embodiments, the GmNSE1 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.1.

[0024] In some embodiments, the containing GmNSE1 Gene recombination vectors include basic vectors and GmNSE1 The underlying carrier includes pDEST or pMalC2 carrier.

[0025] In some embodiments, the containing GmNSE1 Recombinant microorganisms include Agrobacterium rhizogenes K599.

[0026] Compared with the prior art, the present invention has the following beneficial effects: This invention discovers GmNSE1 The gene is specifically expressed in the nodule infection zone and possesses E3 ubiquitin ligase activity in vitro. Knockout... GmNSE1 The mutant obtained from the gene showed a significant decrease in nitrogenase activity compared to the wild type, with a reduction of approximately 30%, indicating that... GmNSE1 Genes play an important role in regulating the nitrogen fixation capacity of soybean root nodules, which has promising applications in the study of nitrogen fixation mechanisms in legumes and in agricultural production. GmNSE1 The discovery of this gene not only provides a new perspective for the study of nitrogen fixation mechanisms in legumes, but also has significant application value for agricultural production. Therefore, it can be utilized... GmNSE1 Genes can be used to develop new strategies to improve nitrogen fixation efficiency in legumes, thereby promoting sustainable agriculture. Attached Figure Description

[0027] Figure 1This is a spectrum of the pDEST-GUS carrier of the present invention.

[0028] Figure 2A For the observation of GUS staining in this invention GmNSE1 Gene expression patterns.

[0029] Figure 2B For different tissues of the present invention GmNSE1 Gene expression analysis.

[0030] Figure 2C This is a schematic diagram of the GmNSE1 protein structure of the present invention.

[0031] Figure 2D The detection of GmNSE1 protein in vitro using E3 ubiquitin ligase is based on the present invention.

[0032] Figure 2E For the present invention Gmnse1 Gene editing forms in mutants.

[0033] Figure 2F For the wild-type WT and of the present invention Gmnse1 Assay of nitrogenase activity in root nodules of mutants.

[0034] Figure 2G For the wild-type WT and of the present invention Gmnse1 Microscopic observation results of a semi-thin section of the root nodule of the mutant. The solid frame in the upper right corner is an enlarged view of the dashed frame.

[0035] Figure 2H For the wild-type WT and of the present invention Gmnse1 A statistical diagram showing the number of vesicular structures in the root nodule-infected cells of the mutant.

[0036] Figure 2I For the wild-type WT and of the present invention Gmnse1 A statistical chart of the number of rhizobia in the root nodule-infected cells of the mutant.

[0037] Figure 3 This is a spectrum of the carrier pGES201 of the present invention.

[0038] Figure 4 This is a spectrum of the carrier pMalC2 of the present invention. Detailed Implementation

[0039] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited to the described contents. Unless otherwise specified, the methods in this embodiment are operated according to conventional methods, and the reagents used are conventional reagents unless otherwise specified.

[0040] Table 1

[0041] Table 2

[0042] Example 1 The inventors performed RNA-seq on root tissues, nodule infection zones, and nodule cortical zones of the American soybean variety Williams 82 (W82), and used differential gene expression analysis of each tissue to screen for genes specifically expressed in the nodule infection zone. They cloned a gene, Glyma.17G105500 (referred to as Glyma.17G105500 in this paper), which regulates the symbiotic nitrogen fixation ability of soybean (Glycine max). GmNSE1 (Nodule-Specific E3 Ubiquitin ligase1)).

[0043] GmNSE1 The coding gene is located at Chr17:8276315..8280421 in the Williams 82a4.V1 genome sequence. GmNSE1 Gene cloning provides a theoretical basis and genetic resources for subsequent molecular-assisted breeding and molecular design breeding.

[0044] Example 2 GmNSE1 Gene expression levels during symbiotic nitrogen fixation 2.1 Construction of the Transient Expression System First, it was constructed. GmNSE1 A vector linking the gene promoter sequence (the 3000 bp region before the ATG translation start site) to the β-glucuronidase (GUS) encoding gene was constructed. This vector used spectinomycin as a bacterial resistance gene and employed the AtUBQ10 promoter to drive the DsRed gene as a positive soybean selection marker. A suitable restriction enzyme site was selected and inserted before the ATG in the GUS sequence. GmNSE1 Promoter sequence. See pDEST-GUS vector map. Figure 1 .

[0045] > GmNSE1 nucleotide sequence of gene promoter GmNSE1-GUS-F: ccacaacggcgcgcccccgggTTGTTTTTTGCTACTAACAAG (SEQ ID NO.5) GmNSE1-GUS-R: tacaggacgtaacatactagtGACTTGGAGTGGAAAGAGATG (SEQ ID NO.6) Then, Agrobacterium rhizogenes K599 (Zhuangmeng Biotechnology (ZC1506D)) was introduced by electroporation (see Table 3 for electroporation conditions) and then transformed using the soybean hairy root transformation system.

[0046] Table 3

[0047] The steps for root-cutting transformation using the soybean hairy root transformation system are as follows: 1) In a clean bench, place 100 wild-type soybean seeds in a 500 mL beaker, add a mixture of ethanol and hydrogen peroxide for sterilization for 10 min, wash repeatedly with ddH2O 4-5 times, then discard the ddH2O. Three days later, add 200 μL of the appropriate plasmid-containing medium to LB medium containing the corresponding plasmid resistance. GmNSE1 The Agrobacterium tumefaciens K599 bacterial culture containing the gene promoter plasmid was evenly spread, sealed, and then incubated upside down in a 28°C bacterial incubator for 2 days to obtain K599 bacterial moss.

[0048] 2) Five days after soybean seeds germinate, use a blade to cut off the roots of the germinating soybean seedlings in a clean bench, leaving the hypocotyl 3 cm. Apply as much of the cultured K599 mycelium as possible to the cut surface of the hypocotyl.

[0049] 3) Then place the soybean hypocotyl explants in agar medium pre-covered with 12 cm × 6 cm filter paper (only pour half of the medium to ensure that the soybean cotyledons do not come into contact with the medium), with 5-6 hypocotyl explants per dish. After covering with filter paper, seal with sealing film and shield from light with aluminum foil. Incubate vertically in a soybean light culture room at 22℃ for 2 days.

[0050] 4) Transfer the hypocotyl explants cultured in step 3) into culture bags containing agar medium, cover the medium portion with aluminum foil, and culture in a 22°C light culture room for 4 days (lower light intensity is preferable).

[0051] 5) In a clean bench, place the soybean hypocotyl explants cultured in step 4) in ddH2O to remove excess bacteria (if new roots are produced on the explants at this time, they must be removed).

[0052] 6) After cleaning the explants in step 5), transfer them into new germination bags and add 1 / 2 Hoagland solution (nitrogen-free) (formulas are shown in Tables 1 and 2, mix before use). Incubate in a soybean light culture room at 22℃ (light intensity should be slightly lower). Change the culture medium regularly during the culture period and promptly remove any roots growing on the stems.

[0053] 7) Generally, after 5-7 days of culture, transformed roots will grow from the callus. Once the transformed roots have grown to 2 cm, the transformed roots of the explant will be examined under a fluorescence stereomicroscope to see if they are positive. False positive roots will be removed, and the positive transformed roots will be transplanted into vermiculite or used for other experiments.

[0054] 2.2 GUS staining Inoculate the positively transformed roots from step 2.1 with rhizobium USDA110 at a rate of 20 mL per root. OD 600 =0.02, water with 1 / 2 Hoagland solution (nitrogen-free) every 7 days (formulas are shown in Tables 1 and 2, mix before use), and collect after 28 days of incubation at 25℃. pGmNSE1-GUS Transformed root nodules were then subjected to GUS histochemical staining of root and root nodule tissues.

[0055] The steps for GUS histochemical staining are as follows: Roots and nodules inoculated with USDA110 rhizobium for 21 days were collected and placed in GUS staining solution (100 mM NaH2PO4, 10 mM Na2EDTA, 0.5 mM K4Fe(CN)6, 0.5 mM K3Fe(CN)6, 0.1% Triton X-100, 10% Methanol, 1 mM X-Gluc) to completely immerse the samples. The samples were then fixed under vacuum at room temperature for 1 h (to remove gas) and incubated at 37°C in the dark for 6 h. The staining solution was removed, and the reaction was terminated by adding 100 mM sodium phosphate buffer (pH 7.2). Subsequently, 70% ethanol solution was added for destaining at room temperature overnight. The results were observed using a Leica stereomicroscope. (See attached image). Figure 2A .

[0056] from Figure 2A It can be seen that the blue signal from GUS staining specifically appears in soybean root nodules, while almost no GUS signal is seen in root tissue, indicating that... GmNSE1 It is a gene specifically expressed in soybean root nodule tissue.

[0057] 2.3 In the infected area and cortical area GmNSE1 Gene expression Nodules can be mainly divided into two parts: the infection region (IR) and the cortex region (CR). The infection region is the most important area responsible for nitrogen fixation.

[0058] Using micromanipulation, soybean root nodule IR and CR tissues cultured for 28 days in step 2.2 were isolated, and RNA was extracted and detected by RT-qPCR in each tissue. GmNSE1 The gene expression level was determined. Simultaneously, RNA was extracted from root tissue and analyzed by RT-qPCR; the results are shown below. Figure 2B .

[0059] RNA extraction and RT-qPCR detection are as follows: 1) RNA was extracted from three tissues using an RNA extraction kit, namely the Kangwei Century CW0581 ultrapure RNA nucleic acid extraction kit.

[0060] The RT-PCR primers are as follows: GmNSE1-qF:CATCTCTTTCCACTCCAAGTCA(SEQ ID NO.7) GmNSE1-qR: GTGCCACATAGAAGAGACGAT (SEQ ID NO.8) Internal control primer ATP synthase subunit beta (ATS1) GmATS1-qF: GCGATTCTTAAGCCAGCCTTT (SEQ ID NO.9) GmATS1-qR: ACACACCCTGGAAACTGGTGA (SEQ ID NO.10) 2) Perform real-time quantitative PCR using the Tiangen Talent qPCR PreMix (SYBR Green) kit. First, dilute the soybean sample cDNA obtained from reverse transcription in step 1) 20 times and place it on ice as an RT-qPCR template. At the same time, thaw the reagents in the kit, vortex to mix, and place on ice for later use.

[0061] The reaction system consisted of: 10 μL of 2 × Talent qPCR PreMix, 0.6 μL each of 10 μM primers, 4 μL of diluted cDNA template, and 2.8 μL of RNase-Free ddH2O.

[0062] Cover the reaction tube, mix gently, centrifuge briefly for 30 seconds to the bottom, and place the reaction system in a real-time PCR instrument for reaction.

[0063] The reaction procedure is as follows: Step 1: 95 ℃ for 3 min; Step 2: 95 ℃ for 5 s; Step 3: 60 ℃ for 15 s; Step 4: 72 ℃ for 15 s; Step 5: Repeat steps 2-4 40 times; Step 6: Analysis of the dissolution curve.

[0064] from Figure 2B It can be seen that the discovery GmNSE1 It is specifically expressed in the nodule-infected area, but rarely expressed in the root tissue and cortex.

[0065] In summary, from steps 2.2 and 2.3, we can conclude that... GmNSE1 Genes play an important role in the symbiotic nitrogen fixation process of soybeans.

[0066] Example 3 GmNSE1 The protein participates in symbiotic nitrogen fixation as an E3 ubiquitin ligase. 3.1 The amino acid sequence of the GmNSE1 protein was analyzed. The amino acid sequence of the GmNSE1 protein was analyzed using the online SMART website https: / / smart.embl.de / smart / change_mode.cgi. The results are shown below. Figure 2C .

[0067] from Figure 2C It is known that the C segment of the GmNSE1 protein possesses a typical C3H2C3 type ring-finger domain. The ring-finger domain is one of the key features of E3 ubiquitin ligases. This domain mediates the ubiquitination process of proteins, that is, the covalent attachment of ubiquitin molecules to substrate proteins, thereby regulating protein stability, localization, and function.

[0068] 3.2. The GmNSE1 protein possesses E3 ubiquitin ligase activity. Furthermore, to confirm that the GmNSE1 protein does indeed possess E3 ubiquitin ligase activity, its E3 ubiquitin ligase activity was measured in vitro.

[0069] Western blotting was performed using ubiquitin antibody (Ub antibody), and the results are shown in [Figure number missing]. Figure 2D Wherein, nUb represents the polyubiquitin chain.

[0070] This study involved the in vitro E3 ubiquitin ligase activity assay, which included E1 ubiquitin activator, E2 ubiquitin conjugate, Ub, and the E3 ubiquitin ligase to be tested, all performed under appropriate reaction buffers and temperatures. For the assay of GmNSE1 protein activity in vitro using Ubiquitin ligase, Arabidopsis thaliana E1 UBA1 (E1), human E2 UbcH5B (E2), and commercially available Ub protein (Ub) were selected. Except for the commercially available Ub protein, all other proteins were purified through prokaryotic expression.

[0071] The specific experimental procedure is as follows: 1.5 μL of 20× reaction buffer, 1 μL (50 ng) of AtE1 (also known as UBA1), 1 μL (100 ng) of UbcH5B, 2 μL (4 μg) of Ub, 2 μL (400 ng) of MBP-GmNSE1 (obtained through prokaryotic expression, the prokaryotic expression is as follows), and 22.5 μL of ddH2O.

[0072] Prokaryotic expression of MBP-GmNSE1: 1) First, a system was built. GmNSE1 Gene CDS sequence ligated into pMalC2 vector (see) Figure 4 This vector uses ampicillin as the bacterial resistance gene. A suitable restriction site was selected before the ATG sequence of the MBP (maltose-binding protein) sequence to insert the GmNSE1 CDS sequence. The primers used are as follows. GmNSE1-pMalC2-F:gagggaaggatttcagaattcATGGGTTCTTCCTCTAGTCGA (SEQ ID NO. 11) GmNSE1-pMalC2-R: acgacggccagtgccaagcttTCAATGAGACTGCACTTCTGA (SEQ IDNO.12) 2) Prokaryotic expression and purification of MBP-NSE1 protein: The target plasmid obtained in step 1) was chemically transformed into E. coli Transetta(DE3) (CD801) competent cells. The next day, single clones were picked and purified in 5 mL of Amp + Incubate overnight in LB broth at 37°C and 200 rpm. Add 300 mL of Amp-containing medium to the overnight culture. + Incubate the antibiotic in LB liquid medium at 37°C and 200 rpm for 2-3 hours to allow the bacterial culture to reach OD500. 600When the pH reaches 0.6-0.8, add 0.6 mM IPTG and 0.2% glucose to a final concentration and induce expression for 16 h at 16°C and 160 rpm. The next day, transfer the induced bacterial culture to a pre-chilled 500 mL centrifuge bottle and centrifuge at 4°C and 3800 rpm for 20 min. Disrupt the cells twice with 5 mL of column buffer (Tris-HCl (pH 7.4) 20 mM, NaCl 200 mM, EDTA 1 mM) using a cell pressure disruptor until the culture becomes clear. Transfer the disrupted culture to centrifuge tubes and centrifuge at 4°C and 13000 rpm for 40 min using an ultracentrifuge. Retain the supernatant and discard the precipitate, storing at 4°C for later use. 3) All experiments below were performed at 4℃. Amylose Resinbeads (NEB, E8021L) were equilibrated and rinsed three times with column buffer, and the supernatant was discarded after centrifugation. The beads were added to the lysed bacterial culture, centrifuged, and the supernatant was discarded after centrifugation. The mixture was slowly rotated for 4 h, then centrifuged at 5000 rpm for 30 s and the supernatant was discarded. The beads were rinsed with column buffer and rapidly rotated for 10 min, then centrifuged and the supernatant was discarded. This process was repeated four times. 600 μL of elution buffer (column buffer with 10 mM Maltose) was added, and the MBP fusion protein was eluted by slow rotation for 30 min. The mixture was then centrifuged at 3500 rpm for 30 s, and the supernatant was transferred to a new centrifuge tube and placed on ice. 500 mL of ddH2O was added to moisten a 10 kD ultrafiltration tube. After removing the ddH2O, 500 mL of ultrafiltration buffer (50 mM Tris-HCl, pH 7.4, 100 mM NaCl) was added, and the tube was centrifuged at 12000 rpm for 5 min and the liquid in the collection tube was discarded. Add protein elution supernatant to the ultrafiltration tube and centrifuge at 12000 rpm for 5 min until 200 mL of liquid remains in the tube. Then, add ultrafiltration buffer and centrifuge at 12000 rpm for 5 min. Repeat this process 4-5 times. Finally, collect the purified MBP fusion protein (i.e., MBP-GmNSE1 protein) for subsequent experiments or store it at -80℃.

[0073] Add each experimental component to a 1.5 mL centrifuge tube according to the above proportions, centrifuge to mix, and then react at 30°C and 900 rpm for 90 min on a constant temperature mixer. After the reaction is complete, add SDS-PAGE loading buffer to the reaction tube, mix, centrifuge, and then perform SDS-PAGE electrophoresis and Western blotting at 42°C for 10 min.

[0074] The Western blotting procedure is as follows: Protein electrophoresis at 150 V for 1 hour, followed by protein transfer using a PVDF membrane and filter paper at 110 V for 75 minutes. Blocking is performed in 5% skim milk powder (dissolved in PBS) for 1 hour. 1 / 10000 ubiquitin antibody (Sigma-Aldrich, catalog number 041586247) diluted in 3% skim milk powder (dissolved in PBS) is added for 1 hour. Washing is performed 3 times with 0.5‰ PBST for 10 minutes. 1 / 5000 mouse secondary antibody (Abmart M21001) is added for 1 hour. Washing is performed 3 times with PBST for 10 minutes. The A and B chemiluminescence solutions used in HRP-ECL are mixed 1:1 and evenly added to the surface of the PVDF membrane (1 ml of chromogenic solution for an 8 cm x 5 cm membrane). Developing is performed for 2-3 minutes, and the band signals are scanned using an instrument.

[0075] from Figure 2D It can be seen that, compared with the control lane which lacks ubiquitin activator E1, ubiquitin conjugator E2, or potential E3 ubiquitin ligase MBP-GmNSE1 protein, only reaction systems containing E1, E2, and MBP-GmNSE1 protein can show the polyubiquitination modification band of MBP-GmNSE1 protein.

[0076] This result indicates that GmNSE1 does indeed possess in vitro E3 ubiquitin ligase activity, which is the molecular basis for its participation in the symbiotic nitrogen fixation process in soybeans.

[0077] Example 4 GmNSE1 Regulating nitrogen fixation in soybean root nodules 4.1 Obtaining Gene-Edited Plants Editing using the CRISPR-Cas9 gene editing system GmNSE1 Gene.

[0078] 1) First, design GmNSE1 The gRNA of the gene (gRNA: ACGTTGCAACAAATAGTCAGAGG (SEQ ID NO.4)) was constructed into the pGES201 vector (Plasmid #190197, see...) Figure 3 After that, the cells were electroporated into Agrobacterium strain EHA105 (Zhuangmeng Biotechnology, ZC142D) and transfected into wild-type W82 soybean to obtain explants.

[0079] Using BsaI as the restriction site, the products of annealing oligonucleotides gRNA-F and gRNA-R into double strands were ligated into the vector.

[0080] gRNA-F: GGATTGACGTTGCAACAAATAGTCAG (SEQ ID NO.13) gRNA-R: AAACCTGACTATTTGTTGCAACGTCA (SEQ ID NO.14) After sterilization, W82 soybeans germinate on the culture medium for 2-3 days. Once the hypocotyl emerges, it is horizontally cut at the cotyledon node, retaining two intact cotyledons and the hypocotyl cut with meristem tissue as explants. The fresh cut surfaces of the explants are then immersed in Agrobacterium tumefaciens solution EHA105 (OD200). 600 In a solution of 0.6 g / mL, gently shake for about 15–30 minutes to ensure the bacterial solution fully contacts the transformation site. Then, aspirate any excess bacterial solution from the surface and co-culture at 25°C in the dark for 24–48 hours. Subsequent culturing yields stable T0 generation transformed plants.

[0081] 2) Detect the insertion of gRNA in T0-band plants.

[0082] 3) After culturing positive T0 plants, T1 generation plants were obtained. Subsequent gene editing detection was performed using the Hi-Tom platform. GmNSE1 The gene-edited positive T1 was subsequently sequenced to obtain homozygous T1. Gmnse1 Mutant plants. See reference 1 for gene editing (Bai M, Yuan J, Kuang H, Gong P, Li S, Zhang Z, Liu B, Sun J, Yang M, Yang L, Wang D, Song S, Guan Y. Generation of a multiplex mutagenesis population via pooled CRISPR-Cas9 in soya bean. Plant Biotechnol J. 2020 Mar;18(3):721-731. doi: 10.1111 / pbi.13239.).

[0083] 4) True leaf tissues were collected at 14 days of age and sequenced using the Hi-TOM (High-throughput Tracking of Mutations) high-throughput detection platform, designed specifically for identifying gene-editing mutations, at the Chinese Soybean Research Institute, Chinese Academy of Agricultural Sciences. (See [link to article]). Figure 2E .

[0084] from Figure 2E It can be seen that, through the editing method of CAS9, Gmnse1 Translation of the GmNSE1 protein terminates prematurely in mutant plants.

[0085] 4.2, Regarding Gmnse1 Analysis of the symbiotic nitrogen fixation capacity of mutant root nodules Rhizobium USDA110 was kindly donated by Professor Hans-Martin Fischer of ETH Zurich (Ledermann et al., 2015). Ledermann, R., Bartsch, I., Remus-Emsermann, MN, Vorholt, JA, and Fischer, HM (2015).

[0086] Rhizobium USDA110 was inoculated onto wild-type soybean and Gmnse1 Mutant, each inoculated volume is 20 mL, OD 600 =0.02, and the nitrogenase activity of the root nodules was measured 21 days after inoculation.

[0087] Gmnse1 The root nodules of the mutant were placed in 20 mL sample vials, and an equal volume of air was replaced with 2 mL of acetylene. After standing at room temperature for 1 h, the samples were passed through a gas chromatograph (GC-4100; EWAI). The wild type was used as a control.

[0088] Chromatographic column: Porapak N (50 / 80 mesh, 2 m × 3.2 mm) Column temperature: 80 ℃ (isothermal) Inlet / detector temperature: 120 ℃ Carrier gas: N2 (approximately 20-40 mL / min; or N2 at 200 kPa), FID uses H2 and Air at approximately 50 kPa respectively. Injection volume: 1.0 mL headspace (0.5-0.8 mL if necessary) Estimated retention times: C2H4 0.7-0.8 min, C2H2 1.2 min) Click to start the analysis. The ethylene peak appears at 1 min 45 s, and the acetylene peak appears at 3 min 30 s. The analysis ends after approximately 5 minutes, and the area ratio of the ethylene peak is recorded. See the results below. Figure 2F .

[0089] The formula for calculating enzyme activity AR is as follows:

[0090] In the formula P 1 atm R = gas constant, defined as 0.0821 atm·L·mol -1 k -1 T = Temperature 301.15K (28℃) V = the amount of acetylene added (2 mL) E R =Ethylene peak area ratio measured by the instrument t = incubation time with acetylene A0 represents the ethylene conversion factor. See reference 2 (KAV David, SK Apte, A. Banerji, J. Thomas, Acetylene reduction assay for nitrogenase activity: Gaschromatographic determination of ethylene per sample in less than one minute. Appl. Environ. Microbiol. 39, 1078–1080 (1980)).

[0091] from Figure 2F It can be seen that, Gmnse1 The nitrogenase activity of mutant root nodules was only 73% of that of wild-type root nodules, indicating that the GmNSE1 protein plays an important role in regulating the symbiotic nitrogen fixation ability of soybean root nodules.

[0092] Example 4 GmNSE1 Mechanism study of gene nitrogen fixation Analysis using cellular experiments Gmnse1 The mechanism by which the nitrogen-fixing capacity of the mutant root nodule is reduced includes the following: Nodule sampling and fixation: 12 days after inoculation with rhizobium USDA110 Gmnse1 Nodule material was collected from the roots of the mutant soybean and placed in PBS buffer. Under a stereomicroscope, the nodules were quickly bisected with a sharp blade and placed in 1 mL of 2.5% glutaraldehyde fixative (50% glutaraldehyde stock solution diluted with PBS buffer) to completely immerse the samples. The samples were then vacuum-fixed at room temperature for 2 h (to remove gas from the samples), and the 2.5% glutaraldehyde fixative was replaced and incubated overnight at 4°C. The next day, the samples were washed with PBS buffer, mixed thoroughly, and allowed to stand for 10 min. This washing process was repeated four times. For sample dehydration and resin permeation, 10%, 20%, 30%, 50%, 70%, 80%, and 90% ethanol solutions were added sequentially to the samples and mixed thoroughly. Each ethanol dehydration process was allowed to stand for 30 min, and finally, 100% ethanol solution was added three times for further dehydration. The samples were then subjected to permeation replacement in different ratios of ethanol:resin (2:1, v / v) for 4 h, ethanol:resin (1:1, v / v) for 4 h, and ethanol:resin (1:2, v / v) for 4 h. The final sample was permeated in 100% resin overnight, and the 100% resin was replaced the next day. Sample embedding: The infiltrated sample was transferred to the top of the embedding plate containing embedding agent under a stereomicroscope according to the proportion. After removing air bubbles, the sample was polymerized at 35℃ for 12 h, 45℃ for 12 h, and 60℃ for 48 h in a constant temperature oven. Semi-thin section preparation: The embedded block was trimmed into a trapezoidal shape with a blade to expose the sample. Then, the sample was cut into 2 μm thick sections using a resin microtome and placed on a glass slide. Staining: The glass slide containing the semi-thin section sample was placed in 0.1% toluidine blue-O (TBO) solution and stained at room temperature for 3 min. It was then immediately rinsed in single-distilled water until all the stain was removed. The glass slide was then placed on a 60℃ slide oven for 10 min for later use.

[0093] Observation of semi-thin sections: Place the dried slide in a fume hood, use a pipette to draw 0.5 mL of quick-drying xylene sealing agent and drop it onto the slide, gently cover it with a clean coverslip to avoid sealing air bubbles under the coverslip, dry horizontally for 1 h and then transfer it to a ZEISS optical microscope for observation.

[0094] Calculate the number of vacuoles and the number of rhizobia. Take wild-type and... Gmnse1 Semi-thin sections were prepared from the root nodules of mutants inoculated with rhizobium for 12 days. The infected cells were observed under a Zeiss microscope at 100x oil immersion. A certain number of representative infected cells were selected from the parallel replicate semi-thin sections for observation. The vesicular structures and the number of rhizobium in the infected cells were counted. Finally, the data were analyzed and plotted.

[0095] Observation of W82 wild-type soybean and Gmnse1 Results of semi-thin sections of the root nodule of the mutant, see [link to results]. Figure 2G The dashed boxes represent infected cells.

[0096] from Figure 2G It can be seen that, compared with the root nodules of wild-type WT, Gmnse1 The mutant significantly increased the number of vesicular structures in infected cells. Gmnse1 Nearly half of the volume of the mutant nodule-infected cells is occupied by vesicular structures, while wild-type WT (also known as W82) nodule-infected cells have only a small number of vesicular structures.

[0097] from Figure 2H and 2I It can be seen that, Gmnse1 The mutant root nodules showed a significantly increased number of intracellular vesicular structures in infected cells compared to wild-type WT (W82), indicating that... Gmnse1 The mutant's root nodule cells exhibited significant developmental defects. Furthermore, compared to wild-type WT (also known as W82) root nodule-infecting cells, Gmnse1 The mutant showed a significant reduction in the number of rhizobium colonizing the root nodule cells.

[0098] This embodiment describes... Gmnse1 The reduced nitrogen-fixing capacity of the mutant nodules is due to defects in the development of the mutant nodule-infecting cells and the colonization of rhizobia.

[0099] This invention is not limited to the specific textual description above. Various changes can be made to this invention within the scope outlined in the claims, and all such changes are within the scope of this invention.

Claims

1. GmNSE1 Use of genes or related biological materials in at least one of the following: A1) Regulate the nitrogen fixation efficiency of soybean root nodules or prepare products that regulate the nitrogen fixation efficiency of soybean root nodules. A2) Cultivate soybeans with improved nitrogen fixation efficiency or prepare products that improve the nitrogen fixation efficiency of soybeans; A3) Preparation of genetically modified soybeans; The GmNSE1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application as described in claim 1, characterized in that, The biomaterials include one or more of the following: A1) GmNSE1 The gene-encoded protein and / or containing the above GmNSE1 Gene recombinant vectors, recombinant microorganisms, or transgenic soybean cell lines; A2) Contains negative regulation GmNSE1 Nucleic acid molecules expressing genes, recombinant vectors, recombinant microorganisms, or transgenic soybean cell lines.

3. The application as described in claim 1 or 2, characterized in that, The regulation of nitrogen fixation efficiency in soybean root nodules includes: regulating the activity of nitrogenase in soybean root nodules.

4. The application as described in claim 3, characterized in that, The regulation of nitrogenase activity in soybean root nodules includes: through positive regulation GmNSE1 Gene expression to improve nitrogen fixation efficiency in soybean root nodules; Or, through negative regulation GmNSE1 Gene expression is used to reduce nitrogen fixation efficiency in soybean root nodules.

5. Positive regulation GmNSE1 Application of gene-expressing biomaterials in cultivating soybeans with improved nitrogen fixation efficiency; GmNSE1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. The application as described in claim 5, characterized in that, The biomaterial includes: GmNSE1 The gene encodes a protein and / or contains positive regulatory functions. GmNSE1 Recombinant vectors for gene expression, recombinant microorganisms, or transgenic soybean cell lines.

7. The application as described in claim 5, characterized in that, The improvement in nitrogen fixation efficiency includes: increasing the activity of nitrogenase in soybean root nodules.

8. A method for improving the nitrogen fixation efficiency of soybeans, characterized in that, include: Positive regulation GmNSE1 Gene-expressing biological materials are transferred into soybeans.

9. A method for cultivating soybeans with improved nitrogen fixation efficiency, characterized in that, include: Positive regulation GmNSE1 Gene-expressing biological materials are transferred into soybeans.

Images