Method for eliminating ribosomal RNA in bovine total RNA sample

By using primer sequence amplification and enzymatic digestion, a low-cost single-stranded DNA probe was prepared, which solved the problem of high cost and low efficiency in ribosomal RNA removal from bovine total RNA samples, and achieved efficient and economical ribosomal RNA removal.

CN121022980APending Publication Date: 2025-11-28INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510986288.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-17
Publication Date
2025-11-28

AI Technical Summary

Technical Problem

Existing technologies are costly and inefficient in eliminating ribosomal RNA from bovine total RNA samples. Furthermore, traditional methods require the artificial synthesis of a large number of antisense DNA probes, resulting in high costs and long processing times.

Method used

A low-cost method for preparing long single-stranded antisense DNA probes was adopted. cDNA was amplified by primer sequence set, and RNase H digestion and DNase I digestion were combined with optimized reaction conditions to achieve efficient removal of ribosomal RNA from bovine total RNA.

Benefits of technology

This method enables the rapid and economical preparation of single-stranded DNA probes covering the entire sequence of bovine ribosomal RNA, reducing probe preparation costs and improving the removal efficiency of ribosomal RNA, with a removal efficiency of up to 99%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121022980A_ABST
    Figure CN121022980A_ABST
Patent Text Reader

Abstract

The invention provides a method for eliminating ribosomal RNA in a bovine total RNA sample, which comprises the following steps: reversely transcribing the total RNA in the bovine sample into cDNA, and amplifying the cDNA by using a primer sequence group to obtain a DNA fragment covering all sequences of the bovine ribosomal RNA; carrying out amplification by taking the DNA fragment as a template and adopting a single primer in the primer sequence group to obtain a single-stranded DNA probe; hybridizing the total RNA of the cattle sample by adopting a single-stranded DNA probe, and performing RNase H digestion to obtain a digestion product; sequentially carrying out DNase I digestion and RNA purification on the digestion product to obtain a target product; wherein the primer sequence group comprises first to seventeenth upstream primers and first to seventeenth downstream primers, and the primer sequence group has the characteristics of low cost, stable performance and high reduction efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological detection, and particularly relates to a method for eliminating ribosomal RNA in a total RNA sample of a cow. BACKGROUND

[0002] Transcriptome sequencing technology (RNA sequencing, RNA-seq) is a technology for quantitative analysis of cells at the transcription level based on high-throughput sequencing. In the early stage, it mainly aimed at sequencing analysis of mRNA of eukaryotes. Nowadays, it has developed into whole transcriptome analysis (WTA) technology, which can accurately reflect the transcription level of messenger RNA (mRNA), various small RNAs and non-coding RNAs, and is widely used in almost all biological related fields such as agricultural breeding, variety resources, nutrition metabolism and medicine. Metatranscriptome is similar to WTA, but it is aimed at sequencing of total RNA of a sample, including mRNA and various non-coding RNAs in the sample, and possible bacterial mRNA and non-coding RNA, viral RNA, etc.

[0003] Transcriptome and metatranscriptome sequencing both include three important parts of RNA extraction and processing, library construction sequencing and data analysis. In prokaryotic and eukaryotic cells, ribosomal RNA (Ribosomal RNA, rRNA) usually accounts for more than 80% of total RNA in cells. If direct library construction sequencing is performed on total RNA samples, more than 90% of the obtained sequencing data comes from rRNA, and the information of various low-abundance RNAs is not easy to be detected.

[0004] The rRNA of eukaryotic cells usually accounts for 80%-90% of the total RNA quality, tRNA accounts for 10%-15%, mRNA accounts for 1%-5%, and other ncRNA accounts for 1%-5%. The proportion of various RNAs in cells also varies with different eukaryotic species, different growth stages and different parts. Bacteria as a representative of prokaryotes, the proportion of rRNA is about 80%-85%, the proportion of tRNA is about 10%-15%, the proportion of mRNA is about 2%-5%, and the proportion of other small RNAs and non-coding RNAs is about 1-2%. The proportion is slightly different due to differences in bacterial species and growth conditions. Most researchers are not interested in rRNA and tRNA, which become a nuisance in RNA-seq, and the rich base modification and stable and compact secondary and tertiary structure of tRNA are rarely sequenced by commonly used sequencing schemes. Therefore, the elimination of rRNA in total RNA has become an important part of library construction in transcriptome and metatranscriptome sequencing.

[0005] The depletion of rRNA can greatly increase the proportion of mRNA, regulatory RNA and other types of RNA, thereby increasing their sequencing coverage, detection efficiency and sensitivity. An ideal rRNA depletion method should be simple, efficient, reliable and cost-effective. There are many strategies for ribosomal RNA depletion, mainly including: Olig dT magnetic bead capture, "pull-out" method, RNase H selective depletion and DSN selective depletion, etc., among which the former three are the most commonly used. Olig dT magnetic bead capture based on poly A tail can only capture eukaryotic mRNA, and cannot capture those non-poly A (NPA) transcripts such as miRNA, enhancer RNA (eRNA) and various lncRNA, as well as bacterial and viral RNA in the sample. DSN selective depletion method also has some systematic problems in practical application, and the depletion efficiency is not as expected.

[0006] RNase H selective depletion of rRNA is the most popular strategy at present, which principle is to artificially synthesize 50-80 bp antisense DNA probes, which are complementary to the sequences to be depleted and cover the entire rRNA, thereby forming RNA:DNA hybrids, and then using RNase H to treat the hybrid double-stranded to deplete the remaining DNA probes by using DNase I. Bovine ribosomal rRNA includes: 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, as well as mitochondrial rRNA (12S and 16S), with a total length of up to 9130 bp, so more than 100 antisense DNA probes need to be artificially synthesized, which is high in cost, time-consuming and labor-intensive, and the total amount of antisense DNA probes obtained is very limited, which is the main reason why the current ribosomal RNA elimination kit is very expensive.

[0007] Therefore, it is necessary to provide a method for eliminating ribosomal RNA in bovine total RNA samples, which is low in cost, stable in performance and high in depletion efficiency. SUMMARY

[0008] In order to solve the above technical problems, the present application provides a method for eliminating ribosomal RNA in bovine total RNA samples to solve the problems in the background art, including the preparation of long single-stranded antisense DNA probes with low cost and the optimization of supporting reagents and reaction conditions, so as to provide a method for eliminating ribosomal RNA in bovine total RNA samples with low preparation cost, stable performance and high depletion efficiency.

[0009] In one aspect, the present application provides the following technical scheme, a method for eliminating ribosomal RNA in bovine total RNA samples, comprising: The total RNA in the bovine sample is reversely transcribed into cDNA, and the cDNA is amplified by using a primer sequence group to obtain DNA fragments covering the whole sequence of ribosomal RNA of bovine; The DNA fragments are taken as templates and a single primer in the primer sequence group is used for amplification to obtain single-stranded DNA probes; The single-stranded DNA probes are hybridized to the total RNA of the bovine sample and subjected to RNase H digestion to obtain digestion products; The digestion products are subjected to DNase I digestion and RNA purification in sequence to obtain target products; The primer sequence group comprises first to seventeenth upstream primers and first to seventeenth downstream primers, the sequences of the first to seventeenth upstream primers are shown in SEQ ID NO. 1 to SEQ ID NO. 17, and the sequences of the first to seventeenth downstream primers are shown in SEQ ID NO. 18 to SEQ ID NO. 34.

[0010] According to the method for eliminating ribosomal RNA in a total RNA sample of bovine provided in the application, the application has the following beneficial effects: The application can quickly and massively prepare single-stranded antisense DNA probes covering the whole sequence of ribosomal RNA of bovine, and only a small amount of primers are used, without the need for artificially synthesizing 50-80 bp antisense DNA probes, so that the cost of probe preparation is greatly reduced.

[0011] In addition, the method for eliminating ribosomal RNA in a total RNA sample of bovine provided in the application can also have the following additional technical features: Preferably, the step of reversely transcribing the total RNA in the bovine sample into cDNA comprises: The total RNA of the bovine lung tissue is extracted by using an RNA extraction kit, and the total RNA is reversely transcribed by using a reverse transcription kit to obtain cDNA.

[0012] Preferably, in the step of reversely transcribing the total RNA in the bovine sample into cDNA, the reaction system comprises RNase-free ddH2O, 4 × All-in-One Ultra qRT SuperMix and template RNA.

[0013] Preferably, in the step of amplifying the cDNA with the primer sequence group to obtain DNA fragments covering the entire sequence of bovine ribosomal RNA, the reaction system comprises ddH2O, 2 × Taq Plus Master Mix, template cDNA, the first to the seventeenth upstream primers, and the first to the seventeenth downstream primers.

[0014] Preferably, in the step of amplifying the DNA fragments with a single primer in the primer sequence group as a template, the reaction system comprises ddH2O, 2 × Taq Plus Master Mix, template DNA fragments, and the first to the seventeenth downstream primers.

[0015] Preferably, the step of hybridizing the single-stranded DNA probe with the total RNA of the bovine sample and then performing RNase H digestion to obtain a digestion product comprises the following steps: A nuclease-free PCR tube is taken, ddH2O and the total RNA of the bovine sample are added to the PCR tube, and the PCR tube is placed on ice for standby. The single-stranded DNA probe and the Probe Buffer are added to the PCR tube, and then the sample is fully mixed by gently blowing with a pipette. The sample is then collected at the bottom of the tube by instantaneous centrifugation, and the sample at the bottom of the tube is placed in a PCR instrument for processing to obtain a processing product. The RNase H Buffer and the RNase H digestion reagent are added to the processing product, and then the sample to be digested is fully mixed by gently blowing with a pipette. The sample to be digested is then collected at the bottom of the tube by instantaneous centrifugation, and the sample to be digested at the bottom of the tube is placed in a PCR instrument for RNase H digestion reaction to obtain a digestion product.

[0016] Preferably, the step of sequentially performing DNase I digestion and RNA purification on the digestion product to obtain a target product comprises the following steps: The digestion product is subjected to DNase I digestion to obtain a second digestion product. The Hieff NGS® RNA Cleaner magnetic beads are added to the second digestion product, which is fully mixed by blowing with a pipette and incubated at room temperature. The magnetic beads and the liquid are then separated in a magnetic stand, and the supernatant is removed after the solution is clarified to obtain a tentative product. The tentative product is sequentially subjected to rinsing, elution, and quantification to obtain a target product. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0018] Figure 1 The reverse transcription PCR amplification result diagram of ribosomal RNA in total RNA of a cow provided by different primers of the embodiment of the present application is shown in the following table: Figure 2 The electrophoresis diagram of single-stranded DNA probe preparation (taking one probe of bovine ribosomal 18S rRNA as an example) provided by the embodiment of the present application is shown in the following table: Figure 3 The fluorescence quantitative PCR result diagram of different input amounts of total RNA of a cow in the embodiment 4 of the present application is shown in the following table: Figure 4 The ribosomal RNA fluorescence quantitative PCR result diagram before and after removing ribosomal RNA of total RNA of a cow in the embodiment 4 of the present application is shown in the following table.

[0019] The present application will be further described below in conjunction with the accompanying drawings and the description of the drawings. DETAILED DESCRIPTION

[0020] The embodiments of the present application are described in detail below, and examples of the embodiments are shown in the accompanying drawings, in which the same or similar notations represent the same or similar elements or elements having the same or similar functions throughout. The embodiments described below by reference to the accompanying drawings are exemplary and are intended to explain the embodiments of the present application, and cannot be understood as limiting the present application.

[0021] The present application provides a method for eliminating ribosomal RNA in total RNA sample of a cow. Those skilled in the art can improve the process parameters appropriately according to the content herein. In particular, it is pointed out that all similar replacements and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The method and application of the present application have been described by the preferred embodiments, and the related personnel can obviously modify or appropriately change and combine the method and application herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0022] For the method for eliminating ribosomal RNA in total RNA sample of a cow of the present application, it comprises: S1, reverse transcribing total RNA in a cow sample into cDNA, amplifying the cDNA by using a primer sequence group to obtain a DNA fragment covering all sequences of ribosomal RNA of the cow; S2, using the DNA fragment as a template and using a single primer in the primer sequence group to amplify to obtain a single-stranded DNA probe; S3, hybridizing the single-stranded DNA probe to total RNA of the cow sample and performing RNase H digestion to obtain a digestion product; S4, sequentially performing DNase I digestion and RNA purification on the digestion product to obtain a target product; The primer sequence group comprises first to seventeenth upstream primers and first to seventeenth downstream primers, the sequence of the first to seventeenth upstream primers is shown as SEQ ID NO. 1 to SEQ ID NO. 17, and the sequence of the first to seventeenth downstream primers is shown as SEQ ID NO. 18 to SEQ ID NO. 34.

[0023] The total RNA in the bovine sample is reversely transcribed into cDNA. The total RNA in the bovine sample is reversely transcribed into cDNA.

[0024] In the step of reversely transcribing the total RNA in the bovine sample into cDNA, the reaction system comprises RNase-free ddH2O, 4 × All-in-One Ultra qRT SuperMix, and template RNA.

[0025] The RNase-free ddH2O is nuclease-free water, and the 4 × All-in-One Ultra qRT SuperMix is a special reverse transcription reagent for fluorescent quantitative PCR (produced by Nanjing Vazyme Company, and the article number is R433).

[0026] In the step of amplifying the cDNA by using the primer sequence group to obtain DNA fragments covering all sequences of bovine ribosomal RNA, the reaction system comprises ddH2O, 2 × Taq Plus Master Mix, template cDNA, first to seventeenth upstream primers, and first to seventeenth downstream primers.

[0027] The 2 × Taq Plus Master Mix is a high-fidelity polymerase premix (Vazyme, P213).

[0028] In the step of amplifying the DNA fragments by using a single primer in the primer sequence group as a template, the reaction system comprises ddH2O, 2 × Taq Plus Master Mix, template DNA fragments, and first to seventeenth downstream primers.

[0029] The total RNA in the bovine sample is reversely transcribed into cDNA. Taking a nuclease-free PCR tube, adding ddH2O and total RNA of the bovine sample into the PCR tube, and placing on ice for standby, adding single-stranded DNA probe and Probe Buffer into the PCR tube, then gently blowing and mixing with a pipette, then centrifuging for a moment to collect the sample at the bottom of the tube, and placing the sample at the bottom of the tube in a PCR instrument for processing to obtain a processing product, adding RNase H Buffer and RNase H digestion reagent into the processing product, then gently blowing and mixing with a pipette, then centrifuging for a moment to collect the sample to be digested at the bottom of the tube, and placing the sample to be digested at the bottom of the tube in a PCR instrument for RNase H digestion reaction to obtain a digestion product.

[0030] In the formula, Probe Buffer is a probe hybridization buffer, and RNase H Buffer is an RNAse H buffer.

[0031] The step of sequentially performing DNase I digestion and RNA purification on the digestion product to obtain a target product comprises: The digestion product is subjected to DNase I digestion to obtain a second digestion product, Hieff NGS® RNA Cleaner magnetic beads are added into the second digestion product, a pipette is used for fully blowing and mixing and incubation at room temperature, then the magnetic beads and the liquid are separated in a magnetic stand, and after the solution is clarified, the supernatant is removed to obtain a tentative product, and the tentative product is sequentially subjected to rinsing, elution and quantification treatment to obtain a target product.

[0032] In the formula, Hieff NGS® RNA Cleaner magnetic beads are RNA purification magnetic beads (yeasen, 12600ES).

[0033] It should be noted that the present application also provides a kit comprising reagent consumables required for the method for eliminating ribosomal RNA in a bovine total RNA sample.

[0034] The reagent consumables used in the present application are all ordinary commercially available goods, and the present application will be further described below in combination with examples: Example 1 Construction of primer sequence group The primer sequence group in the present application specifically comprises first to seventeenth upstream primers and first to seventeenth downstream primers, the sequences of the first to seventeenth upstream primers are shown in SEQ ID NO. 1 to SEQ ID NO. 17, and the sequences of the first to seventeenth downstream primers are shown in SEQ ID NO. 18 to SEQ ID NO. 34. Meanwhile, the primer sequence group is designed to cover the whole sequence of bovine rRNA, which includes 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, and 6 types of mitochondrial rRNA (12S and 16S), a total of 17 pairs of primer sequences, the annealing temperature of the primer is controlled between 58-62℃, and the amplification fragment of each pair of primer is controlled between 100bp-1000bp; Therefore, the first upstream primer and the first downstream primer are the amplification primers of bovine ribosome 5S rRNA, the sequences of which are shown in SEQ ID NO. 1 and SEQ ID NO. 18, and it should be noted that the two ends of all the following primers are connected with 5' adapter and 3' adapter, and the first-seventeenth upstream primer and the first-seventeenth downstream primer are in one-to-one corresponding relationship, which are as follows: SEQ ID NO. 1: CACCCTGAACGCACCCAATC; SEQ ID NO. 18: GCCTATGGCACCTGGTATTCC; The second upstream primer and the second downstream primer are the amplification primers of bovine ribosome 5.8S rRNA, the sequences of which are shown in SEQ ID NO. 2 and SEQ ID NO. 19, which are as follows: SEQ ID NO. 2: GACTCTTAGCGGTGGATCACTC; SEQ ID NO. 19: GCAAGTGCGTTCGAAGTGTC; The third-fifth upstream primers and the third-fifth downstream primers are the amplification primers of bovine ribosome 18S rRNA, the sequences of which are shown in SEQ ID NO. 3-SEQ ID NO. 5 and SEQ ID NO. 20-SEQ ID NO. 22, which are as follows: SEQ ID NO. 3: TGGTTGATCCTGCCAGTAGC; SEQ ID NO. 4: GCGGTAATTCCAGCTCCAATA; SEQ ID NO. 5: CTCTTTCTCGATTCCGTGGGT; SEQ ID NO. 20: ATACGCTATTGGAGCTGGAATTAC; SEQ ID NO. 21: CCAGAGTCTCGTTCGTTATCG; SEQ ID NO. 22: TAATGATCCTTCCGCAGGTTCA; The sixth-twelfth upstream primers and the sixth-twelfth downstream primers are amplification primers for bovine ribosome 28S rRNA, and the sequences are shown in SEQ ID NO. 6-SEQ ID NO. 12, SEQ ID NO. 23-SEQ ID NO. 29, respectively: SEQ ID NO. 6: GACCCGCTGAATTTAAGCATATTAG; SEQ ID NO. 7: GAGGGCGTGAAACCGTTAAG; SEQ ID NO. 8: ACACGGACCAAGGAGTCTAAC; SEQ ID NO. 9: ACTCACCTGCCGAATCAACTA; SEQ ID NO. 10: CATGTTGGAACAATGTAGGTAAGG; SEQ ID NO. 11: GCCTAGCAGCCGACTTAGAAC; SEQ ID NO. 12: ACAGGGATAACTGGCTTGTG; SEQ ID NO. 23: TAACGGTTTCACGCCCTCTT; SEQ ID NO. 24: TTAGACTCCTTGGTCCGTGTT; SEQ ID NO. 25: TGATTCGGCAGGTGAGTTGT; SEQ ID NO. 26: GCTGTTCACCTTGGAGACCT; SEQ ID NO. 27: GTCCGCACCAGTTCTAAGTC; SEQ ID NO. 28: CCGCCACAAGCCAGTTATCC; SEQ ID NO. 29: CGAGGGCTGACTTTCAATAGA; The thirteenth-fourteenth upstream primers and the thirteenth-fourteenth downstream primers are amplification primers for bovine mitochondrial 12S S rRNA, and the sequences are shown in SEQ ID NO. 13-SEQ ID NO. 14, SEQ ID NO. 30-SEQ ID NO. 31, respectively: SEQ ID NO. 13: GGTCCCAGCCTTCCTGTTAA; SEQ ID NO. 14: CCTACAATAGCCGACGCACTA; SEQ ID NO. 30: GCTATTGTAGGGTCACTTTCGT; SEQ ID NO. 31: TCCAAGCACACTTTCCAGTATG; The fifteenth to seventeenth upstream primers and the fifteenth to seventeenth downstream primers are amplification primers for bovine mitochondrial 16S S rRNA, and the sequences thereof are shown in SEQ ID NO. 15 to SEQ ID NO. 17, SEQ ID NO. 32 to SEQ ID NO. 34, respectively: SEQ ID NO. 15: AGACCTAGCCCAAAGATACCC; SEQ ID NO. 16: GCCTAACGAGCCTGGTGATA; SEQ ID NO. 17: GTGAAATTGACCTTCCCGTGAA; SEQ ID NO. 32: CGTTAGGCATGTCACCTCTAC; SEQ ID NO. 33: TCACGGGAAGGTCAATTTCAC; SEQ ID NO. 34: CCTGTTCTAGGGCAGGGTTT.

[0035] Example 2 Determination of single-stranded DNA probe Bovine lung tissue was taken, and a commercial RNA extraction kit suitable for animal tissue (such as Nuaidian FastPure Cell / Tissue Total RNA Isolation Kit, RC101-01) was used to extract total RNA, and a reverse transcription kit (such as Nuaidian HiScript IV All-in-One Ultra RT SuperMix for qPCR, R433-01) was used to reverse transcribe the cDNA.

[0036] The reaction system for cDNA synthesis is as follows: RNase-free ddH2O 5μl, 4 × All-in-One Ultra qRT SuperMix 5μl, Template RNA 1pg~1μg; RNase-free ddH2O was added to the reaction system to a total volume of 20μl, and the reaction conditions were 50°C / 5~10 min, 85°C / 5 sec. After the reaction was completed, the cDNA was obtained.

[0037] The first round of PCR amplification was used to prepare DNA fragments covering the whole sequence of bovine ribosomal RNA. The first round of PCR amplification was performed using cDNA as a template, and the reaction system was as follows: ddH2O 5 μl, 2 × Taq Plus Master Mix 2 μl, Template cDNA 1 μl, First-seventeenth upstream primer 0.25 μl, First-seventeenth downstream primer 0.25 μl; ddH2O was added to a total volume of 20 μl. The reaction conditions were as follows: 95°C / 5 min; 95°C / 1 min, 55°C / 15 sec, 72°C / 1 min, 40 cycles; 72°C 2 min; 4°C, hold.

[0038] The DNA fragments amplified by the 17 pairs of primers were detected by electrophoresis, and the product size was confirmed to be as expected. The amplified products were purified using a DNA purification kit for the second round of PCR amplification.

[0039] The second round of PCR was used to prepare single-stranded DNA probes, and the reaction system was as follows: ddH2O 5 μl, 2 × Taq Plus Master Mix 2 μl, Template DNA fragment 1 μl, First-seventeenth downstream primer 3 μl; ddH2O was added to a total volume of 20 μl. The reaction conditions were as follows: 95°C / 5 min; 95°C / 1 min, 55°C / 15 sec, 72°C / 1 min, 50 cycles; 4°C, hold. After the reaction was completed, a probe DNA sequence containing more single strands was obtained. The amplified product was purified using a DNA purification kit, and the single-stranded DNA content was determined to obtain single-stranded DNA probes; It should be noted that in actual situations, primers can be designed according to specific needs to prepare single-stranded DNA probes of different lengths. Also, by changing the single primer used in the second round of amplification, either positive DNA single strands (using only upstream primers) or negative DNA single strands (using only downstream primers) can be prepared; At the same time, the results of reverse transcription PCR amplification of ribosomal RNA in bovine total RNA by 17 pairs of primers are shown in Figure 1 Figure 1 ​From left to right are marker; 5S rRNA-104bp; 5.8S rRNA-112bp; 18S rRNA-645 bp, 733 bp, 571 bp; 28S rRNA-403 bp, 788 bp, 701 bp, 745 bp, 769 bp, 817 bp, 660 bp; Mitochondrial 12S rRNA-381 bp, 571 bp; Mitochondrial 16S rRNA-341 bp, 700 bp, 551 bp.

[0040] The electrophoretogram of the single-stranded DNA probe is shown in Figure 2, and in this application, a probe for bovine ribosomal 18S rRNA is taken as an example. From left to right are marker, single-stranded DNA prepared using 4 μl, 1 μl, and 0.25 μl of the probe. Figure 2

[0041] Example 3 Removal of ribosomal RNA 1. Pretreatment In a nuclease-free PCR tube, the total RNA concentration was adjusted to 500 ng / μl with nuclease-free ddH2O, and the tube was placed on ice for standby. The components required for the next step were taken out from -30 ~ -15 °C and placed on ice for standby. The reaction solution was prepared: total RNA 2 μl, Probe Buffer 3 μl, single-stranded DNA probe 1.5 μl obtained in the previous step, and ddH2O was added to a total volume of 20 μl. The sample was mixed thoroughly by gently blowing with a pipette for 10 times. The sample was collected at the bottom of the tube by centrifugation, and was placed in a PCR instrument for operation according to the following program: 95 °C / 2 min, 95 - 37 °C slow cooling at 0.1 °C / sec, 37 °C incubation for 5 min, and the total time was about 10 - 15 min. The sample was collected at the bottom of the tube by centrifugation, and was placed on ice to obtain the treatment product, and then the next step was performed.

[0042] 2. RNase H digestion The RNase H digestion reagent was taken out from -20 °C, thawed, mixed, and placed on ice for standby. The RNase H digestion reaction system was prepared: RNase H Buffer 3 μl, RNase H digestion reagent 2 μl, and treatment product 15 μl, for a total of 20 μl. RNase H Buffer and RNase H digestion reagent were added separately, and if the sample volume was large, they were prepared immediately before use. The reaction solution was mixed thoroughly by gently blowing with a pipette, and was centrifuged to the bottom of the tube to obtain the sample to be digested. The PCR tube containing the sample to be digested was placed in a PCR instrument, and the reaction program was set: hot lid 50 °C; 37 °C, 30 min; 4 °C, hold, for RNase H digestion reaction to obtain the digestion product. ​

[0043] 3. DNase I digestion Take DNase I digestion reagent from -20℃, thaw and mix well, then place on ice for standby. Prepare DNase I digestion reaction system: DNase I Buffer 27.5 μl, DNase I digestion reagent 2.5 μl, digestion product 20 μl, total 50 μl, gently blow and mix well with pipette, centrifuge to the bottom of the tube, place the above PCR tube in the PCR instrument, set the reaction program: hot cover 50℃; 37℃, 30 min; 4℃, hold, carry out DNase I digestion reaction to obtain the second digestion product.

[0044] 4. RNA purification Preparation: Take Hieff NGS® RNA Cleaner magnetic beads from the refrigerator, equilibrate at room temperature for at least 30 min. Prepare 80% ethanol with Nuclease free H2O.

[0045] Adsorption: vortex or mix well the magnetic beads, take 110 μL Hieff NGS® RNA Cleaner magnetic beads to the second digestion product, mix well with pipette, incubate at room temperature for 5 min, the ratio of magnetic beads to second digestion product is 2.2:1.

[0046] Place the PCR tube in the magnetic stand to separate the magnetic beads and the liquid, after the solution is clear (about 3 min), carefully remove the supernatant.

[0047] Rinse: keep the PCR tube in the magnetic stand at all times, add 200 μl Nuclease free H2O freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, carefully remove the supernatant, repeat the rinse once, a total of two rinses, use 10 μL pipette to absorb the residual liquid.

[0048] Keep the PCR tube in the magnetic stand at all times, dry the magnetic beads at room temperature (5-10 min) with the cap off.

[0049] Elution: take the PCR tube off the magnetic stand, add 11 μl Nuclease free H2O (or elution buffer), gently blow and mix well with pipette, incubate at room temperature for 5 min, Nuclease free H2O is nuclease-free water.

[0050] Centrifuge the PCR tube briefly and place it in the magnetic stand, wait for the solution to clear (about 3 min), carefully remove 10 μl of supernatant (adjust according to the actual elution volume) to a new Nuclease free PCR tube.

[0051] Quantification: The concentration of the eluted nucleic acid sample is determined, and the corresponding target product is obtained.

[0052] Example 4: Evaluation of ribosomal RNA removal effect 1. Freshly extracted total RNA of bovine was diluted to 1 μg / μl, 10 -1 μg / μl, 10 -2 μg / μl, 10 -3 μg / μl, 10 -4 μg / μl, 10 -5 μg / μl, 10 -6 μg / μl, and 10 -7 μg / μl total RNA, respectively, and 1 μl was used as a template to perform RT-QPCR reaction using the method for eliminating ribosomal RNA in the total RNA sample of bovine provided in the application, and the reaction conditions were as follows: 50℃ for 15 min; 95℃ for 30 sec; 95℃ for 10 sec, 60℃ for 30 sec, 45 cycles, and the results are shown in Table 1. Figure 3

[0053] 2. The samples before and after ribosomal RNA removal were subjected to fluorescent quantitative PCR, and a blank control group without single-stranded DNA probe treatment and a negative control group with ddH2O as the fluorescent quantitative PCR template were added at the same time, and the CT values were compared to determine the ribosomal RNA removal efficiency. The template for the fluorescent quantitative PCR of the untreated sample group was 1 μg of bovine total RNA; the template for the fluorescent quantitative PCR of the rRNA-removed sample group was 1 μg of bovine total RNA treated with single-stranded DNA probe; the template for the fluorescent quantitative PCR of the blank control group was 1 μg of bovine total RNA without single-stranded DNA probe treatment; and the template for the fluorescent quantitative PCR of the negative control group was ddH2O, and the results are shown in Table 2. Figure 4 According to Figure 3 and Figure 4 , the CT value of the rRNA-removed sample was 21.42; the CT value of the positive sample diluted to 10 -2 μg was 19.87; and the CT value of the positive sample diluted to 10 -3 μg was 22.14; which indicated that the content of the target 28S rRNA in the rRNA-removed sample was reduced to between 0.1% and 1%, the rRNA removal effect was more than 99%, and the removal efficiency was relatively obvious, far exceeding the level of commercially available kits.

[0054] The above merely describes preferred embodiments of the application and is not intended to limit the application. Any modification, equivalent replacement, and improvement made within the spirit and principle of the application are equivalent replacement modes and are included in the protection scope of the application.​​

Claims

1. A method for eliminating ribosomal RNA from a total RNA sample of bovine, characterized in that, The application relates to a method for preparing a single-stranded DNA probe for detecting bovine ribosomal RNA. The method comprises the following steps: (1) reverse transcription of total RNA in a bovine sample into cDNA, amplification of the cDNA by using a primer sequence group to obtain DNA fragments covering the whole sequence of bovine ribosomal RNA; (2) amplification by using a single primer in the primer sequence group as a template of the DNA fragments to obtain a single-stranded DNA probe; (3) hybridization of the single-stranded DNA probe to total RNA in the bovine sample and RNase H digestion to obtain a digestion product; (4) DNase I digestion and RNA purification of the digestion product to obtain a target product; 2. The method for eliminating ribosomal RNA in a total RNA sample of a bovine according to claim 1, characterized by, The primer sequence group comprises first to seventeenth upstream primers and first to seventeenth downstream primers, the sequence of the first to seventeenth upstream primers is shown in SEQ ID NO. 1-SEQ ID NO. 17, and the sequence of the first to seventeenth downstream primers is shown in SEQ ID NO. 18-SEQ ID NO.

34. The step of reverse transcription of total RNA in a bovine sample into cDNA comprises the following steps:

3. The method for eliminating ribosomal RNA in a total RNA sample of a bovine according to claim 1, characterized by, (1) obtaining bovine lung tissue, extracting total RNA of the bovine lung tissue by using an RNA extraction kit, and reverse transcribing the total RNA by using a reverse transcription kit to obtain cDNA.

4. The method for eliminating ribosomal RNA in a total RNA sample of a bovine according to claim 1, characterized by, In the step of reverse transcription of total RNA in a bovine sample into cDNA, the reaction system comprises RNase-free ddH2O, 4x All-in-One Ultra qRT SuperMix and template RNA.

5. The method of claim 1, wherein the total RNA sample is from a bovine. In the step of amplification of the cDNA by using a primer sequence group to obtain DNA fragments covering the whole sequence of bovine ribosomal RNA, the reaction system comprises ddH2O, 2x Taq Plus Master Mix, template cDNA, first to seventeenth upstream primers and first to seventeenth downstream primers.

6. The method of claim 1, wherein the total RNA sample is from a bovine. In the step of amplification by using a single primer in the primer sequence group as a template of the DNA fragments, the reaction system comprises ddH2O, 2x Taq Plus Master Mix, template DNA fragments and first to seventeenth downstream primers. The step of hybridization of the single-stranded DNA probe to total RNA in the bovine sample and RNase H digestion to obtain a digestion product comprises the following steps: (1) taking a nuclease-free PCR tube, adding ddH2O and total RNA in the bovine sample into the PCR tube, and placing the PCR tube on ice for standby, adding the single-stranded DNA probe and Probe Buffer into the PCR tube, then gently blowing and mixing the sample by using a pipette, then instantaneously centrifuging the sample to collect the sample at the bottom of the tube, placing the sample at the bottom of the tube in a PCR instrument for treatment to obtain a treatment product, adding RNase H Buffer and RNase H digestion reagent into the treatment product, then gently blowing and mixing the sample by using a pipette, then instantaneously centrifuging the sample to be digested to collect the sample at the bottom of the tube, and placing the sample at the bottom of the tube in a PCR instrument for RNase H digestion reaction to obtain a digestion product.

7. The method of claim 1, wherein the total RNA sample is from a bovine. The step of sequentially performing DNase I digestion and RNA purification on the digestion product to obtain the target product comprises: The step of sequentially performing DNase I digestion and RNA purification on the digestion product to obtain the target product comprises: The step of sequentially performing DNase I digestion and RNA purification on the digestion product to obtain the target product comprises: