Method for eliminating ribosomal RNA in pig total RNA sample

Abstract

The invention provides a method for eliminating ribosome RNA (Ribosome Ribonucleic Acid) in a pig total RNA (Ribosome Ribonucleic Acid) sample, which comprises the following steps: reversely transcribing the total RNA in the pig sample into cDNA (Complementary Deoxyribonucleic Acid), and amplifying the cDNA by adopting a primer sequence group to obtain a DNA fragment covering all sequences of the pig ribosome RNA; carrying out amplification by taking the DNA fragment as a template and adopting a single primer in the primer sequence group to obtain a single-stranded DNA probe; hybridizing the total RNA of the pig sample by adopting a single-stranded DNA probe, and performing RNase H digestion to obtain a digestion product; sequentially carrying out DNase I digestion and RNA purification on the digestion product to obtain a target product; wherein the primer sequence group comprises first to fifteenth upstream primers and first to fifteenth downstream primers, and the primer sequence group has the characteristics of low cost, stable performance and high reduction efficiency.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological detection, and particularly relates to a method for eliminating ribosomal RNA in a total RNA sample of a pig. BACKGROUND

[0002] Transcriptome sequencing technology (RNA sequencing, RNA-seq) is a technology for quantitative analysis of cells at the transcription level based on high-throughput sequencing. In the early stage, it mainly aimed at sequencing analysis of mRNA of eukaryotes. Nowadays, it has developed into whole transcriptome analysis (WTA) technology, which can accurately reflect the transcription level of messenger RNA (mRNA), various small RNAs and non-coding RNAs, and is widely used in almost all biological related fields such as agricultural breeding, variety resources, nutrition metabolism and medicine. Metatranscriptome is similar to WTA, but it is aimed at sequencing of total RNA of a sample, including mRNA and various non-coding RNAs in the sample, and possible bacterial mRNA and non-coding RNA, viral RNA, etc.

[0003] Transcriptome and metatranscriptome sequencing both include three important parts of RNA extraction and processing, library construction sequencing and data analysis. In prokaryotic and eukaryotic cells, ribosomal RNA (Ribosomal RNA, rRNA) usually accounts for more than 80% of total RNA in cells. If direct library construction sequencing is performed on total RNA samples, more than 90% of the sequencing data comes from rRNA, and the information of various low-abundance RNAs is not easy to be detected.

[0004] The rRNA of eukaryotic cells usually accounts for 80%-90% of the total RNA quality, tRNA accounts for 10%-15%, mRNA accounts for 1%-5%, and other ncRNA accounts for 1%-5%. The proportion of various RNAs in cells also varies with different eukaryotic species, different growth stages and different parts. Bacteria as a representative of prokaryotes, the proportion of rRNA is about 80%-85%, the proportion of tRNA is about 10%-15%, the proportion of mRNA is about 2%-5%, and the proportion of other small RNAs and non-coding RNAs is about 1-2%. The proportion is slightly different due to differences in bacterial species and growth conditions. Most researchers are not interested in rRNA and tRNA, which become a nuisance in RNA-seq, and the common sequencing scheme rarely sequences tRNA due to its rich base modification and stable and compact secondary and tertiary structure. Therefore, the elimination of rRNA in total RNA has become an important part of library construction in transcriptome and metatranscriptome sequencing.

[0005] The depletion of rRNA can greatly increase the proportion of mRNA, regulatory RNA and other types of RNA, thereby increasing their sequencing coverage, detection efficiency and sensitivity. An ideal rRNA depletion method should be simple, efficient, reliable and cost-effective. There are many strategies for ribosomal RNA depletion, mainly including: Olig dT magnetic bead capture, "pull-out" method, RNase H selective depletion and DSN selective depletion, etc., among which the former three are the most commonly used. Olig dT magnetic bead capture based on poly A tail can only capture eukaryotic mRNA, and cannot capture those non-poly A (NPA) transcripts such as miRNA, enhancer RNA (eRNA) and various lncRNA, as well as bacterial and viral RNA in the sample. DSN selective depletion method also has some systematic problems in practical application, and the depletion efficiency is not as expected.

[0006] RNase H selective depletion of rRNA is the most popular strategy at present, which principle is to artificially synthesize 50-80 bp antisense DNA probes, which are complementary to the sequences to be depleted and cover the entire rRNA, thereby forming RNA:DNA hybrids, and then using RNase H to treat the hybrid double-stranded to deplete the remaining DNA probes by using DNase I. Pig ribosomal rRNA includes: 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, as well as mitochondrial rRNA (12S and 16S), with a total length of up to 9130 bp, so more than 100 antisense DNA probes need to be artificially synthesized, which is high in cost, time-consuming and labor-intensive, and the total amount of antisense DNA probes obtained is very limited, which is the main reason why the current ribosomal RNA elimination kit is very expensive.

[0007] Therefore, it is necessary to provide a method for eliminating ribosomal RNA in pig total RNA samples, which is low in cost, stable in performance and high in depletion efficiency. SUMMARY

[0008] In order to solve the above technical problems, the present application provides a method for eliminating ribosomal RNA in pig total RNA samples to solve the problems in the background art, including the preparation of long single-stranded antisense DNA probes with low cost and the optimization of supporting reagents and reaction conditions, so as to provide a method for eliminating ribosomal RNA in pig total RNA samples with low preparation cost, stable performance and high depletion efficiency.

[0009] In one aspect, the present application provides the following technical scheme, a method for eliminating ribosomal RNA in pig total RNA samples, comprising: The total RNA in the pig sample is reversely transcribed into cDNA, and the cDNA is amplified by using a primer sequence group to obtain DNA fragments covering all sequences of ribosomal RNA of the pig; The DNA fragments are used as templates and a single primer in the primer sequence group is used for amplification to obtain single-strand DNA probes; The total RNA of the pig sample is hybridized by using the single-strand DNA probes and then subjected to RNase H digestion to obtain digestion products; The digestion products are sequentially subjected to DNase I digestion and RNA purification to obtain target products; The primer sequence group comprises first to fifteenth upstream primers and first to fifteenth downstream primers, the sequences of the first to fifteenth upstream primers are shown in SEQ ID NO. 1 to SEQ ID NO. 15, and the sequences of the first to fifteenth downstream primers are shown in SEQ ID NO. 16 to SEQ ID NO. 30.

[0010] According to the method for eliminating ribosomal RNA in a total RNA sample of a pig provided in the application, the application has the following beneficial effects: The application can quickly and massively prepare single-strand antisense DNA probes covering all sequences of ribosomal RNA of the pig, and only a small amount of primers are used, without the need for manually synthesizing 50-80 bp antisense DNA probes, so that the cost of probe preparation is greatly reduced.

[0011] In addition, the method for eliminating ribosomal RNA in a total RNA sample of a pig provided in the application can also have the following additional technical features: Preferably, the step of reversely transcribing the total RNA in the pig sample into cDNA comprises: The total RNA of the pig lung tissue is extracted by using an RNA extraction kit, and the total RNA is reversely transcribed by using a reverse transcription kit to obtain cDNA.

[0012] Preferably, in the step of reversely transcribing the total RNA in the pig sample into cDNA, the reaction system comprises RNase-free ddH2O, 4 × All-in-One Ultra qRT SuperMix, and template RNA.

[0013] Preferably, in the step of amplifying the cDNA with the primer sequence group to obtain DNA fragments covering the entire sequence of the ribosomal RNA of the pig, the reaction system comprises ddH2O, 2 × Taq Plus Master Mix, template cDNA, the first to the fifteenth upstream primers, and the first to the fifteenth downstream primers.

[0014] Preferably, in the step of amplifying the DNA fragments with a single primer in the primer sequence group as the template, the reaction system comprises ddH2O, 2 × Taq Plus Master Mix, template DNA fragments, and the first to the fifteenth downstream primers.

[0015] Preferably, the step of hybridizing the single-stranded DNA probe with the total RNA of the pig sample and then performing RNase H digestion to obtain a digestion product comprises the following steps: A nuclease-free PCR tube is taken, ddH2O and the total RNA of the pig sample are added to the PCR tube, and the PCR tube is placed on ice for standby. The single-stranded DNA probe and the Probe Buffer are added to the PCR tube, and then the sample is fully mixed by gently blowing with a pipette. The sample is collected at the bottom of the tube by instantaneous centrifugation, and the sample at the bottom of the tube is placed in a PCR instrument for processing to obtain a processing product. The RNase H Buffer and the RNase H digestion reagent are added to the processing product, and then the sample to be digested is fully mixed by gently blowing with a pipette. The sample to be digested is collected at the bottom of the tube by instantaneous centrifugation, and the sample to be digested at the bottom of the tube is placed in a PCR instrument for RNase H digestion reaction to obtain a digestion product.

[0016] Preferably, the step of sequentially performing DNase I digestion and RNA purification on the digestion product to obtain a target product comprises the following steps: The digestion product is subjected to DNase I digestion to obtain a second digestion product. The Hieff NGS® RNA Cleaner magnetic beads are added to the second digestion product, the sample is fully mixed by blowing with a pipette and incubated at room temperature. The magnetic beads and the liquid are separated in a magnetic stand, and the supernatant is removed after the solution is clarified to obtain a tentative product. The tentative product is sequentially subjected to rinsing, elution, and quantification to obtain a target product. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0018] Figure 1 A reverse transcription PCR amplification result diagram of ribosomal RNA in total RNA of pigs provided by different primers of an embodiment of the present application is shown in Figure 1; Figure 2 A single-stranded DNA probe preparation electrophoresis diagram (taking a probe for 18S rRNA of pig ribosome as an example) provided by an embodiment of the present application is shown in Figure 2; Figure 3 A fluorescence quantitative PCR result diagram of total RNA of pigs with different input amounts in Example 4 of the present application is shown in Figure 3; Figure 4 A fluorescence quantitative PCR result diagram of ribosomal RNA before and after removal of ribosomal RNA from total RNA of pigs in Example 4 of the present application is shown in Figure 4.

[0019] The present application will be further described below in conjunction with the accompanying drawings and the description of the drawings. DETAILED DESCRIPTION

[0020] Embodiments of the present application are described in detail below, examples of which are shown in the accompanying drawings, in which the same or similar reference numerals represent the same or similar elements or elements having the same or similar functions throughout. The embodiments described below by reference to the accompanying drawings are exemplary and are intended to explain the embodiments of the present application, and cannot be understood as limiting the present application.

[0021] The present application provides a method for eliminating ribosomal RNA in total RNA samples of pigs. Those skilled in the art can improve the process parameters as appropriate based on the content herein. In particular, it is pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are all considered to be included in the present application. The method and application of the present application have been described by the preferred embodiments, and the relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0022] For the method for eliminating ribosomal RNA in total RNA samples of pigs of the present application, it comprises: S1, reverse transcribing total RNA in a pig sample into cDNA, amplifying the cDNA using a primer sequence group to obtain a DNA fragment covering all sequences of ribosomal RNA of pigs; S2, using the DNA fragment as a template and using a single primer in the primer sequence group to amplify to obtain a single-stranded DNA probe; S3, hybridizing the single-stranded DNA probe to total RNA of the pig sample and performing RNase H digestion to obtain a digestion product; S4, sequentially performing DNase I digestion and RNA purification on the digestion product to obtain a target product; The primer sequence group comprises first to fifteenth upstream primers and first to fifteenth downstream primers, the sequence of the first to fifteenth upstream primers is shown in SEQ ID NO. 1 to SEQ ID NO. 15, and the sequence of the first to fifteenth downstream primers is shown in SEQ ID NO. 16 to SEQ ID NO. 30.

[0023] The total RNA in the pig sample is reversely transcribed into cDNA. Pig lung tissue is obtained, total RNA of the pig lung tissue is extracted by an RNA extraction kit, and the total RNA is reversely transcribed by a reverse transcription kit to obtain cDNA.

[0024] In the step of reversely transcribing the total RNA in the pig sample into cDNA, the reaction system comprises RNase-free ddH2O, 4 × All-in-One Ultra qRT SuperMix, and template RNA.

[0025] The RNase-free ddH2O is nuclease-free water, and the 4 × All-in-One Ultra qRT SuperMix is a fluorescence quantitative PCR special type reverse transcription reagent kit (produced by Nanjing Vazyme Company, and the article number is R433).

[0026] In the step of amplifying the cDNA by using the primer sequence group to obtain DNA fragments covering all sequences of ribosomal RNA of the pig, the reaction system comprises ddH2O, 2 × Taq Plus Master Mix, template cDNA, first to fifteenth upstream primers, and first to fifteenth downstream primers.

[0027] The 2 × Taq Plus Master Mix is a high-fidelity polymerase premix (Vazyme, P213).

[0028] In the step of amplifying the DNA fragments by using a single primer in the primer sequence group as a template, the reaction system comprises ddH2O, 2 × Taq Plus Master Mix, template DNA fragments, and first to fifteenth downstream primers.

[0029] The total RNA in the pig sample is reversely transcribed into cDNA. Take a nuclease-free PCR tube, add ddH2O and total RNA from the pig sample to the PCR tube, and place it on ice for later use. Add a single-stranded DNA probe and Probe Buffer to the PCR tube, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to the bottom of the tube. Place the sample at the bottom of the tube in a PCR instrument for processing to obtain the processed product. Add RNase H Buffer and RNase H digestion reagent to the processed product, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to be digested to the bottom of the tube. Place the sample to be digested at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product.

[0030] The Probe Buffer is a probe hybridization buffer, and the RNase H Buffer is an RNase H buffer.

[0031] The step of sequentially digesting the digested product with DNase I and purifying RNA to obtain the target product includes: The digestion product was digested with DNase I to obtain a second digestion product. Hieff NGS® RNA Cleaner magnetic beads were added to the second digestion product, and the mixture was thoroughly mixed by pipetting and incubated at room temperature. Then, the magnetic beads and liquid were separated in a magnetic rack. After the solution became clear, the supernatant was removed to obtain the product to be determined. The product to be determined was then washed, eluted, and quantified sequentially to obtain the target product.

[0032] Among them, Hieff NGS® RNA Cleaner magnetic beads are RNA purification magnetic beads (yeasen, 12600ES).

[0033] It should be noted that the present invention also provides a kit comprising the reagents and consumables required in the above-described method for eliminating ribosomal RNA from porcine total RNA samples.

[0034] The reagents and consumables used in this invention are all commercially available products. The invention is further illustrated below with reference to the embodiments: Example 1 Primer sequence construction The primer sequence set in this application specifically includes the first to fifteenth upstream primers and the first to fifteenth downstream primers. The sequences of the first to fifteenth upstream primers are shown in SEQ ID NO.1 to SEQ ID NO.15, and the sequences of the first to fifteenth downstream primers are shown in SEQ ID NO.16 to SEQ ID NO.30. Meanwhile, the primer sequence set mentioned above is a primer design that covers the entire sequence of porcine rRNA. Porcine ribosomal rRNA includes 6 types, such as 5S rRNA, 5.8S rRNA, 18S rRNA, 28S rRNA, and mitochondrial rRNA (12S and 16S). A total of 15 pairs of primer sequences were designed. The primer annealing temperature was controlled between 58 and 62°C, and the amplification fragment of each primer pair was controlled between 100bp and 1000bp. Therefore, the first upstream primer and the first downstream primer are amplification primers for porcine ribosomal 5S rRNA, and their sequences are shown in SEQ ID NO.1 and SEQ ID NO.16. It should be noted that all the following primers have 5' and 3' adapters at both ends, and the first to fifteenth upstream primers and the first to fifteenth downstream primers have a one-to-one upstream-downstream correspondence, as follows: SEQ ID NO.1: TACGGCCATACCACCCTGAA; SEQ ID NO.16: CTACAGCACCCGGTATTCCC; The second upstream and second downstream primers are amplification primers for porcine ribosomal 5.8S rRNA, and their sequences are shown in SEQ ID NO.2 and SEQ ID NO.17, respectively: SEQ ID NO.2: CTCTTAGCGGTGGATCACTCG; SEQ ID NO.17: GCAAGTGCGTTCGAAGTGTC; The third to sixth upstream primers and the third to sixth downstream primers are amplification primers for porcine ribosomal 18S rRNA, and their sequences are shown in SEQ ID NO.3~SEQ ID NO.6 and SEQ ID NO.18~SEQ ID NO.21, respectively: SEQ ID NO.3: CCGGTCCCGACGTGACTGCT; SEQ ID NO.4:TCGCTCGCTCCTCTCCTACTT; SEQ ID NO.5: GACGGACCAGAGCGAAAGCATT; SEQ ID NO.6: CAGGTCTGTGATGCCCTTAGATGTC; SEQ ID NO.18: GGACGAGCGACCAAAGGAA; SEQ ID NO.19: TTCGCTCTGGTCCGTCTTGC; SEQ ID NO.20: CGGACATCTAAGGGCATCACAGAC; SEQ ID NO.21: CGCAGGTGGAGGAGGCGAGA; The seventh to eleventh upstream primers and the seventh to eleventh downstream primers are amplification primers for porcine ribosomal 28S rRNA, and their sequences are shown in SEQ ID NO.7~SEQ ID NO.11 and SEQ ID NO.22~SEQ ID NO.26, respectively: SEQ ID NO.7: CGACCCGCTGAATTTAAGCATATT; SEQ ID NO.8: GCGGACTGTCCCCAGTGCGC; SEQ ID NO.9:GCTGCGGGATGAACCGAACG; SEQ ID NO.10: CCCGTGCCTTGGAAAGCGTC; SEQ ID NO.11: CTGGGGCGGTACACCTGTCA; SEQ ID NO.22: ACTGGGGACAGTCCGCCCCGAG; SEQ ID NO.23: GCTTACCAAAAGTGGCCCACTAG; SEQ ID NO.24: CGACGCTTTCCAAGGCACGG; SEQ ID NO.25: GGTGTACCGCCCAGTCAAACTC; SEQ ID NO.26: GTCGAGGGCTGACTTTCAATAGATC; The twelfth and thirteenth upstream primers and the twelfth and thirteenth downstream primers are amplification primers for porcine mitochondrial 12S S rRNA, and their sequences are shown in SEQ ID NO.12~SEQ ID NO.13 and SEQ ID NO.27~SEQ ID NO.28, respectively: SEQ ID NO.12: TGGTCCTGGCCTTTCTATTA; SEQ ID NO.13: CCGCCATCTTCAGCAAACCC; SEQ ID NO.27: TTCCAACCCATAAGCTACAC; SEQ ID NO.28:TTTCCAGTATGCTTACCTTGT; The fourteenth and fifteenth upstream primers and the fourteenth and fifteenth downstream primers are amplification primers for porcine mitochondrial 16S S rRNA, and their sequences are shown in SEQ ID NO.14~SEQ ID NO.15 and SEQ ID NO.29~SEQ ID NO.30, respectively: SEQ ID NO.14: GCTCAACATATTAAACAAATAC; SEQ ID NO.15: TAAACCAAAACAACACTAAAG; SEQ ID NO.29: TGTTTGGTTTTATTGATTGT; SEQ ID NO. 30: GGCTGGATTTATTATGAGTT.

[0035] Example 2: Determination of Single-Stranded DNA Probes Porcine lung tissue was collected, and total RNA was extracted using a commercially available RNA extraction kit suitable for animal tissues (e.g., Novizan FastPureCell / Tissue Total RNA Isolation Kit, RC101-01). Then, reverse transcription was performed using a reverse transcription kit (e.g., Novizan HiScript IV All-in-One Ultra RT SuperMix for qPCR, R433-01) to convert the RNA into cDNA.

[0036] The reaction system for cDNA synthesis is as follows: RNase-free ddH2O 5μl 4 × All-in-One Ultra qRT SuperMix 5μl, Template RNA 1 pg to 1 μg; RNase-free ddH2O was added to the reaction system to a total volume of 20 μl. The reaction conditions were: 50°C for 5 to 10 min, 85°C for 5 sec. After the reaction was completed, cDNA was obtained.

[0037] The first round of PCR amplification was used to prepare a DNA fragment covering the entire sequence of porcine ribosomal RNA: The first round of PCR amplification was performed using cDNA as a template, and the reaction system is as follows: ddH2O 5μl, 2 × Taq Plus Master Mix 2μl, 1 μl of template cDNA 0.25 μl of the first to fifteenth upstream primers, 0.25 μl of the first to fifteenth downstream primers; Add ddH2O to a total volume of 20 μl. Reaction conditions: 95°C / 5 min; 95°C / 1 min, 55°C / 15 sec, 72°C / 1 min, 40 cycles; 72°C / 2 min; 4°C, hold.

[0038] The DNA fragments amplified by the 15 primer pairs were subjected to electrophoresis to confirm that the product size met expectations. The amplification products were then purified using a DNA purification kit for use in the second round of PCR amplification.

[0039] The second round of PCR preparation of single-stranded DNA probes uses the following reaction system: ddH2O 5 μl, 2 × Taq Plus Master Mix 2 μl, 1 μl of template DNA fragment 3 μl of the first to fifteenth downstream primers; Add ddH2O to a total volume of 20 μl. Reaction conditions: 95°C / 5 min; 95°C / 1 min, 55°C / 15 sec, 72°C / 1 min, 50 cycles; 4°C, hold. After the reaction, a probe DNA sequence containing a large number of single strands was obtained. The amplification product was purified using a DNA purification kit, and its single-stranded DNA content was determined to obtain a single-stranded DNA probe. It should be noted that, in practice, primers can be designed according to specific needs to prepare single-stranded DNA probes of different lengths. Furthermore, by changing the single primer used in the second round of amplification, positive DNA single strands (using only the upstream primer) or antisense DNA single strands (using only the downstream primer) can be prepared. Meanwhile, the reverse transcription PCR amplification results of ribosomal RNA in total porcine RNA using 17 primer pairs are as follows: Figure 1 As shown, in Figure 1 In the image, from left to right, are: marker; 5S rRNA - 113bp; 5.8S rRNA - 110bp; 18S rRNA - 434 bp, 875 bp, 533 bp, 467 bp; 28S rRNA - 767 bp, 673 bp, 713 bp, 739 bp, 781 bp; mitochondrial 12S rRNA - 700 bp, 571 bp; and mitochondrial 16S rRNA - 716 bp, 842 bp.

[0040] The electrophoresis pattern of the single-stranded DNA probe is as follows: Figure 2As shown, in this application, a probe of porcine ribosomal 18S rRNA is used as an example. From left to right, the probe is a marker, and the single-stranded DNA prepared using 4 μl, 1 μl, and 0.25 μl of primers are shown.

[0041] Example 3 Removal of Ribosomal RNA 1. Pre-processing In a nuclease-free PCR tube, adjust the total RNA concentration to 500 ng / μl using nuclease-free ddH2O and place on ice. Remove the components needed for the next step from -30 to -15°C and place on ice. Prepare the reaction solution: 2 μl total RNA, 3 μl Probe Buffer, 1.5 μl single-stranded DNA probe obtained in the previous step, and add ddH2O to a total volume of 20 μl. Gently pipette 10 times to mix thoroughly. Briefly centrifuge to collect the sample to the bottom of the tube. Place the sample in the PCR instrument and follow the procedure: 95°C for 2 min, slowly cool from 95°C to 37°C at 0.1°C / sec, and incubate at 37°C for 5 min, for a total time of approximately 10-15 min. Briefly centrifuge again to collect the sample to the bottom of the tube and place on ice to obtain the processed product, then proceed to the next step.

[0042] 2. RNase H digestion Remove the RNase H digestion reagent from -20℃, thaw and mix well, then place on ice for later use. Prepare the RNase H digestion reaction system: 3 μl RNase H Buffer, 2 μl RNase H digestion reagent, and 15 μl of the digested product, for a total of 20 μl. RNase H Buffer and RNase H digestion reagent should be added separately. If a large sample volume requires additional preparation, prepare fresh for each use. Gently mix using a pipette, then centrifuge briefly to the bottom of the tube to obtain the sample to be digested. Place the PCR tube containing the sample to be digested in a PCR instrument and set the reaction program: 50℃ (heat capped); 37℃, 30 min; 4℃, hold, to perform the RNase H digestion reaction and obtain the digested product.

[0043] 3. DNase I digestion Remove the DNase I digestion reagent from -20°C, thaw and mix well, then place on ice for later use. Prepare the DNase I digestion reaction system: 27.5 μl DNase I Buffer, 2.5 μl DNase I digestion reagent, and 20 μl digestion product, for a total of 50 μl. Gently mix with a pipette, briefly transfer to the bottom of the tube, and place the PCR tube in a PCR instrument. Set the reaction program: 50°C with hot cap; 37°C, 30 min; 4°C, hold, to perform the DNase I digestion reaction to obtain the second digestion product.

[0044] 4. RNA purification Preparation: Remove the Hieff NGS® RNA Cleaner beads from the refrigerator and allow them to equilibrate at room temperature for at least 30 minutes. Prepare 80% ethanol using nuclease-free H2O.

[0045] Adsorption: Vortex or thoroughly invert the magnetic beads to mix them. Add 110 μL of Hieff NGS® RNA Cleaner magnetic beads to the second digestion product. Mix thoroughly by pipetting and incubate at room temperature for 5 min. The ratio of magnetic beads to the second digestion product is 2.2:1.

[0046] Place the PCR tube in a magnetic rack to separate the magnetic beads and liquid. After the solution becomes clear (about 3 minutes), carefully remove the supernatant.

[0047] Rinsing: Keep the PCR tube in the magnetic rack at all times, add 200 μl of Nuclease-free H2O and freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, carefully remove the supernatant, repeat the rinsing once, and rinse twice in total. Use a 10 μL pipette to remove any remaining liquid.

[0048] Keep the PCR tubes in the magnetic rack at all times, and open the caps to dry the magnetic beads at room temperature (5-10 min).

[0049] Elution: Remove the PCR tube from the magnetic rack, add 11 μl of Nuclease-free H2O (or elution buffer), gently pipette until fully mixed, and let stand at room temperature for 5 min. Nuclease-free H2O is nuclease-free water.

[0050] Briefly centrifuge the PCR tube and place it on a magnetic rack to stand until the solution becomes clear (about 3 min). Carefully transfer 10 μl of supernatant (adjust according to the actual elution volume) into a new Nuclease-free PCR tube.

[0051] Quantitative analysis: The concentration of the eluted nucleic acid sample is determined to obtain the corresponding target product.

[0052] Example 4 Evaluation of Ribosomal RNA Removal Efficacy 1. Take freshly extracted porcine total RNA and dilute it to 1 μg / μl and 10 μl concentrations, respectively. -1 μg / μl, 10 -2 μg / μl, 10 -3 μg / μl, 10 -4 μg / μl, 10 -5 μg / μl, 10 -6 μg / μl, 10-7 μg / μl of total RNA was added, and 1 μl was used as a template. RT-qPCR was performed using the method provided in this invention for eliminating ribosomal RNA in porcine total RNA samples. The reaction conditions were: 50℃ for 15 min; 95℃ for 30 sec; 95℃ for 10 sec; 60℃ for 30 sec, for 45 cycles. The results are as follows: Figure 3 As shown.

[0053] 2. Samples before and after ribosomal RNA removal were subjected to quantitative real-time PCR (qPCR). A blank control group without single-stranded DNA probe treatment and a negative control group with ddH2O as the qPCR template were added. The CT values ​​were compared to determine the ribosomal RNA removal efficiency. For the untreated sample group, 1 μg of porcine total RNA was added as the template for qPCR. For the rRNA-removed sample group, 1 μg of porcine total RNA was added as the template for qPCR, followed by the sample treated with a single-stranded DNA probe. For the blank control group, 1 μg of porcine total RNA was added as the template for qPCR, followed by the sample without single-stranded DNA probe treatment. For the negative control group, ddH2O was added as the template. The results are as follows: Figure 4 As shown; according to Figure 3 and Figure 4 It can be seen that the CT value of the rRNA-deactivated sample is 21.32; the positive sample diluted to 10... -2 At μg, the CT value was 17.52; positive samples diluted to 10 μg... -3 At μg, the CT value was 22.46; this indicates that the content of the target 28S rRNA in the sample after rRNA removal treatment was reduced to between 0.1% and 1%, with an rRNA removal efficiency of over 99%, which is quite significant and far exceeds the level of commercially available kits.

[0054] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention are equivalent substitutions and are included within the protection scope of the present invention.

Claims

1. A method for eliminating ribosomal RNA from a porcine total RNA sample, characterized in that, include: Total RNA from pig samples was reverse transcribed into cDNA, and the cDNA was amplified using a primer sequence set to obtain a DNA fragment covering the entire sequence of pig ribosomal RNA. Using the DNA fragment as a template and a single primer from the primer sequence set for amplification, a single-stranded DNA probe is obtained; The total RNA of the pig sample was hybridized using the single-stranded DNA probe and then digested with RNase H to obtain the digestion product; The digestion products were sequentially digested with DNase I and purified with RNA to obtain the target product; The primer sequence set includes first to fifteenth upstream primers and first to fifteenth downstream primers. The sequences of the first to fifteenth upstream primers are shown in SEQ ID NO.1 to SEQ ID NO.15, and the sequences of the first to fifteenth downstream primers are shown in SEQ ID NO.16 to SEQ ID NO.

30.

2. The method for eliminating ribosomal RNA from porcine total RNA samples according to claim 1, characterized in that, The step of reverse transcribing total RNA from a pig sample into cDNA includes: Porcine lung tissue was obtained, and total RNA was extracted from the porcine lung tissue using an RNA extraction kit. The total RNA was then reverse transcribed using a reverse transcription kit to obtain cDNA.

3. The method for eliminating ribosomal RNA from porcine total RNA samples according to claim 1, characterized in that, In the step of reverse transcribing total RNA from pig samples into cDNA, the reaction system includes RNase-free ddH2O, 4 × All-in-One Ultra qRT SuperMix, and template RNA.

4. The method for eliminating ribosomal RNA from porcine total RNA samples according to claim 1, characterized in that, In the step of amplifying cDNA using primer sequence sets to obtain a DNA fragment covering the entire sequence of porcine ribosomal RNA, the reaction system includes ddH2O, 2 × Taq Plus Master Mix, template cDNA, first to fifteenth upstream primers, and first to fifteenth downstream primers.

5. The method for eliminating ribosomal RNA from porcine total RNA samples according to claim 1, characterized in that, In the step of amplification using the DNA fragment as a template and a single primer from the primer sequence set, the reaction system includes: ddH2O, 2 × Taq Plus Master Mix, template DNA fragment, and first to fifteenth downstream primers.

6. The method for eliminating ribosomal RNA from porcine total RNA samples according to claim 1, characterized in that, The steps of hybridizing the total RNA of the pig sample with the single-stranded DNA probe and then digesting it with RNase H to obtain the digestion product include: Take a nuclease-free PCR tube, add ddH2O and total RNA from the pig sample to the PCR tube, and place it on ice for later use. Add a single-stranded DNA probe and Probe Buffer to the PCR tube, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to the bottom of the tube. Place the sample at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product. Add RNase H Buffer and RNase H digestion reagent to the digested product, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to be digested to the bottom of the tube. Place the sample to be digested at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product.

7. The method for eliminating ribosomal RNA from porcine total RNA samples according to claim 1, characterized in that, The steps of sequentially digesting the digested product with DNase I and purifying RNA to obtain the target product include: The digestion product was digested with DNase I to obtain a second digestion product. Hieff NGS® RNA Cleaner magnetic beads were added to the second digestion product, and the mixture was thoroughly mixed by pipetting and incubated at room temperature. Then, the magnetic beads and liquid were separated in a magnetic rack. After the solution became clear, the supernatant was removed to obtain the product to be determined. The product to be determined was then washed, eluted, and quantified sequentially to obtain the target product.

Images