Sampling experiment and analysis method for eDNA (enhanced deoxyribonucleic acid) of habitat water environment of black neck crane in midstream valley of Yajiang River

By employing standardized sampling and efficient eDNA sampling and analysis techniques, the sampling challenges of the aquatic environment in the habitat of the black-necked crane in the middle reaches of the Yarlung Tsangpo River valley have been solved. This has enabled efficient identification and biodiversity analysis of the black-necked crane and its associated birds, providing a scientific basis and technical support for ecological protection and species management.

CN121022985APending Publication Date: 2025-11-28CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511245668.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-02
Publication Date
2025-11-28

AI Technical Summary

Technical Problem

Existing technologies lack efficient and convenient methods for eDNA sampling and analysis of the aquatic environment of the black-necked crane habitat in the middle reaches of the Yarlung Tsangpo River valley, making field surveys of the black-necked crane and its associated birds difficult and time-consuming.

Method used

Standardized sampling and preliminary processing, environmental DNA extraction, PCR amplification and homogenization, and sequencing analysis techniques were employed, including the use of sterile containers, sterile filter membranes, specific primers for PCR amplification, and high-throughput sequencing, combined with bioinformatics workflows for analysis.

Benefits of technology

This has enabled efficient identification and biodiversity analysis of the black-necked crane and its associated birds, providing scientific evidence, technical support for ecological protection and species management, and improving data accuracy and comparability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121022985A_ABST
    Figure CN121022985A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of water environment eDNA sample collection and analysis, and particularly discloses a Yajiang middle river valley black neck crane habitat water environment eDNA sampling experiment and analysis method which comprises the steps of S1, standardized sampling and primary treatment, S2, environment DNA extraction, S3, PCR amplification homogenization treatment and S4, sequencing treatment and analysis. According to the method disclosed by the invention, through a standardized sampling and processing flow, and in combination with efficient environmental DNA extraction, PCR amplification homogenization treatment and sequencing analysis technologies, the black necks and associated birds (spotted geese and ruddy ducks) of the black necks can be effectively identified from a water environment of a night place of the black necks. The technology provides important technical support for habit research and habitat protection of the black neck crane and the associated birds thereof, and has remarkable scientific value and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of water environment eDNA sample collection and analysis, and particularly relates to a water environment eDNA sampling experiment and analysis method for black-necked crane habitat in the middle reaches of the Yarlung Zangbo River. BACKGROUND

[0002] The black-necked crane and its associated birds (bar-headed goose and ruddy shelduck) refer to the black-necked crane distributed in the Qinghai-Tibet Plateau and its surrounding high-altitude areas, and the birds that often appear with the black-necked crane, mainly including the bar-headed goose and the ruddy shelduck. The black-necked crane is the only crane that grows and reproduces in the plateau, is a national first-class protected animal, and is listed in the Red List of Endangered Species of the World Natural Conservation Union. In the middle reaches of the Yarlung Zangbo River Valley black-necked crane national nature reserve, the bar-headed goose and the ruddy shelduck often forage and roost with the black-necked crane, and become the relatively stable associated birds of the latter.

[0003] The traditional method based on passive field observation and recording needs to track the activity track of the black-necked crane, consumes a large amount of time and energy, and at the same time, it is often very difficult to obtain the information such as species distribution and roosting site through direct observation in the field due to the limitation of bird habits, observation equipment and other conditions. The development and cross-fusion of environmental DNA technology and molecular biology make the active ecological investigation more convenient and efficient. At present, there is no specific method for water environment eDNA sampling experiment and analysis of the black-necked crane habitat in the middle reaches of the Yarlung Zangbo River. Therefore, the identification technology with more efficient and convenient molecular biology has important significance for the protection and research of the black-necked crane and its associated birds (bar-headed goose and ruddy shelduck).

[0004] In view of this, the present application provides a water environment eDNA sampling experiment and analysis method for the black-necked crane habitat in the middle reaches of the Yarlung Zangbo River, to solve the above problems. SUMMARY

[0005] The present application aims to provide a water environment eDNA sampling experiment and analysis method for the black-necked crane habitat in the middle reaches of the Yarlung Zangbo River, to solve the problems raised in the background.

[0006] To achieve the above-mentioned purpose, the present application provides the following technical scheme:

[0007] A water environment eDNA sampling experiment and analysis method for the black-necked crane habitat in the middle reaches of the Yarlung Zangbo River, comprising the following steps:

[0008] S1, standardized sampling and preliminary processing: using a sterile sampling container to collect 0.5-1L of water sample from the sampling site, using a sterile filter membrane to filter the sampled water, and storing the filter membrane after processing to obtain a sample to be detected;

[0009] S2, environmental DNA extraction: the sample obtained after step S1 is transferred to a DNA extraction device, and after genomic DNA extraction, the target DNA is obtained, and the target DNA obtained after extraction is detected using 1% agarose gel electrophoresis;

[0010] S3, PCR amplification uniformization treatment: according to the target DNA obtained in step S2, specific primers with barcode are synthesized according to the specified sequencing region, and the designed primer adapter is subjected to PCR amplification treatment by a PCR amplification device, and then the PCR amplification product is purified, and then the purified PCR product is subjected to quantitative uniformization treatment, to obtain the PCR product.

[0011] S4, sequencing processing and analysis: the PCR product obtained after the quantitative uniformization treatment in step S3 is subjected to DNA sequence library construction and sequencing, and then the DNA sequence is subjected to bioinformatics process analysis.

[0012] Preferably, the water collection of the eDNA water sample in step S1 is completed by any sterile container, and the pore size of the sterile filter membrane is 0.22 μm or 0.45 μm.

[0013] Preferably, 12S-3U_F1: ACCGCGGTCATACAAGAGAC and 12S-3U_R1: GCGTTTGTGCTCGTAGTTCTC are used as amplification primers during the PCR amplification uniformization treatment in step S3.

[0014] Preferably, the bioinformatics process includes species identification, abundance analysis, and community structure analysis.

[0015] Preferably, the method is particularly suitable for eDNA sampling and analysis of the habitat water environment of the black-necked crane and its associated birds, the bar-headed goose, and the red-breasted duck in the middle reaches of the Yalong River valley.

[0016] Compared with the prior art, the method has the following beneficial effects:

[0017] (1) The present application realizes effective amplification of target DNA fragments by synthesizing specific primers with barcode and performing PCR amplification, and provides convenience for subsequent sequencing data tracing and analysis through the introduction of barcode. At the same time, the purification and quantitative uniformization treatment of PCR amplification products further improve the accuracy and comparability of sequencing results. High-throughput sequencing technology can quickly construct DNA sequence library and perform sequencing, thereby obtaining a large amount of genetic information. Through the analysis of the bioinformatics process of the sequencing results, including species identification, abundance analysis and community structure analysis, the biodiversity status of the water environment of the habitat of the black-necked crane and its associated birds in the middle reaches of the Yalong River valley can be comprehensively understood, thereby providing a scientific basis for ecological protection and species management.

[0018] (2) The present application can effectively identify black-necked cranes and their associated birds (bar-headed geese and ruddy shelducks) in the water environment of the black-necked crane's roosting site through standardized sampling and processing procedures, combined with efficient environmental DNA extraction, PCR amplification uniformization treatment and sequencing analysis technology. This technology provides important technical support for the habit study and habitat protection of black-necked cranes and their associated birds, and has significant scientific value and application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 A flow chart of a method for eDNA sampling experiment and analysis of the water environment of the habitat of black-necked cranes in the middle reaches of the Yalong River valley. DETAILED DESCRIPTION

[0020] The technical solutions in the embodiments of the present application will be described clearly and completely in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0021] Embodiment one:

[0022] Please refer to Figure 1 A method for eDNA sampling experiment and analysis of the water environment of the habitat of black-necked cranes in the middle reaches of the Yalong River valley, as shown in the drawings, comprising the following steps:

[0023] S1, standardized sampling and preliminary processing: using a sterile sampling container to collect 0.5-1L of water sample from the sampling site, using a sterile filter membrane to filter the sampled water, and storing the filter membrane after processing to obtain a sample to be detected;

[0024] S2, environmental DNA extraction: the sample obtained after step S1 is transferred to a DNA extraction device, and after genomic DNA extraction, the target DNA is obtained, and 1% agarose gel electrophoresis is used to detect the target DNA obtained after extraction;

[0025] S3, PCR amplification uniformization treatment: according to the target DNA obtained in step S2, specific primers with barcode are synthesized according to the specified sequencing region, and then the designed primer adapter is subjected to PCR amplification treatment by a PCR amplification device, and then the PCR amplification product is purified, and then the purified PCR product is subjected to quantitative uniformization treatment, to obtain a PCR product;

[0026] Further, the PCR amplification process is:

[0027] According to the specified sequencing region, specific primers with barcode are synthesized.

[0028] In order to ensure the accuracy and reliability of subsequent data analysis, two conditions need to be met, 1) use low cycle number amplification as much as possible; 2) ensure that the cycle number of each sample amplification is consistent. Randomly select representative samples for pre-experiment to ensure that in the minimum cycle number, most samples can amplify the product with appropriate concentration.

[0029] PCR uses TransGen AP221-02: TransStart Fastpfu DNA Polymerase;

[0030] PCR instrument: ABI 9700 type;

[0031] All samples are subjected to formal experimental conditions, 3 repeats for each sample, the PCR products of the same sample are mixed and detected by 2% agarose gel electrophoresis, the PCR products are recovered by cutting the gel using AxyPrep DNA gel recovery kit (AXYGEN company), and Tris_HCl is used for elution; 2% agarose gel electrophoresis detection.

[0032] PCR uses TransStart Fastpfu DNA Polymerase, 20μl reaction system:

[0033] 5×FastPfu Buffer............4μl

[0034] 2.5mM dNTPs..................2μl

[0035] Forward Primer(5μM)..........0.8μl

[0036] Reverse Primer(5μM).........0.8μl

[0037] FastPfu Polymerase..........0.4μl

[0038] Template DNA............10ng

[0039] Add ddH2O to 20 μl

[0040] PCR reaction parameters are:

[0041] a.1cycles×(5minutes at 95℃);

[0042] b.cycles×(30seconds at 95℃; 30seconds at 58℃; 45seconds at 72℃);

[0043] c.10minutes at 72℃,10℃until halted by user

[0044] Quantitative PCR was performed using QuantiFluor, referring to the preliminary quantification results from electrophoresis. TM The quantification was performed using the ST blue fluorescence quantitative system (Promega), followed by mixing in appropriate proportions according to the sequencing volume requirements of each sample.

[0045] S4. Sequencing and Analysis: The PCR products obtained after quantitative homogenization in step S3 are used to construct a DNA sequence library and sequence the DNA sequence. Then, the DNA sequence is analyzed using a bioinformatics process.

[0046] PE250 Library Construction

[0047] 1) Connect the "Y" shaped connector;

[0048] 2) Use magnetic beads to screen and remove self-connected segments at the connector;

[0049] 3) Enrichment of library templates using PCR amplification;

[0050] 4) Sodium hydroxide denatures the DNA, producing single-stranded DNA fragments.

[0051] Preferably, the water collection of the eDNA water sample in step S1 is performed by any sterile container, and the sterile filter membrane has a pore size of 0.22 μm or 0.45 μm.

[0052] Preferably, in step S3, during the PCR amplification homogenization process, 12S-3U_F1:ACCGCGGTCATACAAGAGAC and 12S-3U_R1:GCGTTTGTGCTCGTAGTTCTC are used as amplification primers.

[0053] Preferably, the bioinformatics process includes species identification, abundance analysis, and community structure analysis.

[0054] Preferably, the method is particularly suitable for eDNA sampling and analysis of the habitat water environment of black-necked cranes and their associated birds, bar-headed geese and ruddy shelducks in the middle reaches of the Yarlung Tsangpo River valley, providing technical support for the study of the habits of black-necked cranes and their associated birds and the protection of their habitats.

[0055] PE250 sequencing

[0056] 1) One end of the DNA fragment is complementary to the primer bases and fixed on the chip;

[0057] 2) The other end randomly complements another nearby primer and is also fixed, forming a "bridge";

[0058] 3) PCR amplification produces DNA clusters;

[0059] 4) DNA amplicon linearizes into a single strand;

[0060] 5) Add modified DNA polymerase and dNTPs with 4 fluorescent labels, and synthesize only one base per cycle;

[0061] 6) Use a laser to scan the surface of the reaction plate and read the types of nucleotides that were polymerized in the first round of reaction for each template sequence;

[0062] 7) Chemically cleave the "fluorescent group" and "terminator group" to restore the 3' end stickiness and continue polymerizing the second nucleotide;

[0063] 8) Analyze the fluorescence signals collected in each round to determine the sequence of the template DNA fragment;

[0064] Data optimization and statistics:

[0065] The PE250 sequencing process first requires obtaining the valid sequences of all samples based on the barcode; then, the quality of the reads is filtered for quality control; next, based on the overlap relationship between PE reads, paired reads are merged into a single sequence; finally, high-quality sequences for each sample are obtained by splitting according to the barcode and primer sequence, and the sequence orientation is corrected and chimeras are removed during the process based on the forward and reverse barcodes and primer orientation.

[0066] Data cleanup methods and parameters:

[0067] Filter the bases with a quality value below 20 at the end of the read, set a 10bp window, and if the average quality value within the window is below 20, cut off the bases at the end of the window, filtering out reads below 50bp after quality control.

[0068] Based on the overlap relationship between PEreads, pairs of reads are merged into a single sequence, with a minimum overlap length of 10bp.

[0069] The maximum allowable mismatch ratio in the overlap region of the spliced ​​sequence is 0.2, and sequences that do not conform to the rules are filtered out.

[0070] Samples are distinguished based on the barcodes and primers at both ends of the sequence, and the sequence orientation is adjusted. The number of mismatches allowed for the barcode is 0, and the maximum number of mismatches for the primer is 2.

[0071] Using Usearch software and the Gold database, chimeras were removed by combining de novo and reference methods.

[0072] OTU clustering

[0073] OTUs (Operational Taxonomic Units) are standardized identifiers artificially assigned to a taxonomic unit (strain, genus, species, group, etc.) in phylogenetic or population genetics studies to facilitate analysis. To understand the number of species, genera, etc., in a sample's sequencing results, the sequences need to be clustered. Through clustering, sequences are grouped into many subgroups based on their similarity; each subgroup is an OTU.

[0074] The analysis steps are as follows:

[0075] Extracting non-repetitive sequences from optimized sequences helps reduce redundant computational load in intermediate analysis processes.

[0076] Remove single sequences without repetition;

[0077] OTU clustering is performed on non-repetitive sequences (excluding single sequences) based on 97% similarity. Chimeras are removed during the clustering process to obtain representative sequences of OTUs.

[0078] Map all optimized sequences to the OTU representative sequence, select sequences with a similarity of more than 97% to the OTU representative sequence, and generate an OTU table.

[0079] Taxonomic analysis

[0080] To obtain the species classification information corresponding to each OTU, the uclust algorithm was used to perform taxonomic analysis on the representative sequences of OTUs with 97% similarity. The community composition of each sample was statistically analyzed at each classification level: domain, kingdom, phylum, class, order, family, genus, and species.

[0081] The database to be compared is the NT database.

[0082] Table 1 below shows the test results of four collected samples—the number of reads for the species and their DNA sequences.

[0083] Table 1

[0084] As shown above, standardized sampling and preliminary processing steps ensured the sterility of water samples during collection and processing, effectively avoiding the influence of external contamination on experimental results and improving the accuracy and reliability of the data. Simultaneously, the use of sterile filter membranes efficiently retained environmental DNA (eDNA) in the water, providing a rich genetic information basis for subsequent analysis.

[0085] During the environmental DNA extraction stage, advanced DNA extraction technology is used to efficiently and accurately extract genomic DNA from the filter membrane, and the DNA is detected by agarose gel electrophoresis, ensuring the quality and integrity of the extracted DNA and laying a solid foundation for subsequent PCR amplification and sequencing analysis.

[0086] In the PCR amplification homogenization step, specific primers with barcodes were synthesized and PCR amplification was performed. This not only achieved efficient amplification of the target DNA fragment, but also facilitated subsequent sequencing data tracing and analysis through the introduction of barcodes. Simultaneously, purification and quantitative homogenization of the PCR amplification products further improved the accuracy and comparability of the sequencing results.

[0087] In the sequencing processing and analysis stage, high-throughput sequencing technology is used to rapidly construct DNA sequence libraries and perform sequencing, thereby obtaining a large amount of genetic information. By analyzing the sequencing results through a bioinformatics workflow, including species identification, abundance analysis, and community structure analysis, a comprehensive understanding of the biodiversity status of the habitat of the black-necked crane and its associated birds in the middle reaches of the Yarlung Tsangpo River valley can be obtained, providing a scientific basis for ecological protection and species management.

[0088] In summary, this invention, through standardized sampling and processing procedures combined with efficient environmental DNA extraction, PCR amplification and homogenization, and sequencing analysis techniques, can effectively identify black-necked cranes and their companion birds (bar-headed geese and ruddy shelducks) from the aquatic environment of their roosting sites. This technology provides important technical support for the study of the habits of black-necked cranes and their companion birds, as well as for habitat protection, and has significant scientific value and application prospects.

[0089] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Furthermore, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0090] The accompanying drawings of the embodiments disclosed in this invention only involve structures relevant to the embodiments disclosed in this invention. Other structures can be referred to with common designs. Unless otherwise specified, the same embodiment and different embodiments of this invention can be combined with each other.

[0091] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A method for eDNA sampling and analysis of the aquatic environment of the black-necked crane habitat in the middle reaches of the Yarlung Tsangpo River valley, characterized in that, include: S1. Standardized sampling and preliminary processing: Collect 0.5-1L of water sample from the sampling site using a sterile sampling container, filter the sampled water using a sterile filter membrane, and preserve the filter membrane after processing to obtain the sample to be tested; S2. Environmental DNA extraction: The sample to be tested obtained after step S1 is transferred to a DNA extraction device. After genomic DNA extraction, the target DNA is obtained and the target DNA obtained after extraction is detected by 1% agarose gel electrophoresis. S3. PCR amplification and homogenization: Based on the target DNA obtained in step S2, specific primers with barcodes are synthesized according to the specified sequencing region. The designed primer adapters are then subjected to PCR amplification using a PCR amplification device. The PCR amplification products are then purified and quantitatively homogenized to obtain the PCR products. S4. Sequencing and Analysis: The PCR products obtained after quantitative homogenization in step S3 are used to construct a DNA sequence library and sequence the DNA sequence. Then, the DNA sequence is analyzed using a bioinformatics process.

2. The method for eDNA sampling and analysis of the aquatic environment of the black-necked crane habitat in the middle reaches of the Yarlung Tsangpo River valley according to claim 1, characterized in that, In step S1, the water collection of the eDNA water sample is carried out by any sterile container, and the sterile filter membrane has a pore size of 0.22 μm or 0.45 μm.

3. The method for eDNA sampling and analysis of the aquatic environment of the black-necked crane habitat in the middle reaches of the Yarlung Tsangpo River valley according to claim 1, characterized in that, In step S3, during the PCR amplification homogenization process, 12S-3U_F1:ACCGCGGTCATACAAGAGAC and 12S-3U_R1:GCGTTTGTGCTCGTAGTTCTC are used as amplification primers.

4. The method for eDNA sampling and analysis of the aquatic environment of the black-necked crane habitat in the middle reaches of the Yarlung Tsangpo River valley according to claim 1, characterized in that, The bioinformatics process includes species identification, abundance analysis, and community structure analysis.

5. The method for eDNA sampling and analysis of the aquatic environment of the black-necked crane habitat in the middle reaches of the Yarlung Tsangpo River valley according to claim 1, characterized in that, The method is particularly suitable for eDNA sampling and analysis of the habitat water environment of black-necked cranes and their companion birds, bar-headed geese and ruddy shelducks in the middle reaches of the Yarlung Tsangpo River valley.