A snp molecular marker related to body length on pig chromosome 1 and application thereof

Abstract

The application belongs to the technical field of molecular biology and molecular marker, and particularly relates to a SNP molecular marker related to body length on chromosome 1 of pig and application. The SNP site of the SNP molecular marker related to body length on chromosome 1 of pig corresponds to C>G mutation at 93692371bp on chromosome 1 of international pig reference genome 11.1 version, and the polymorphism of the site base influences the body length trait. The application solves the problem of genetic improvement of pig body length by means of molecular breeding, and the superior allele frequency of the above-mentioned SNP can be increased generation by generation by selecting the superior allele, the pig body length is improved, the genetic improvement progress of pig is accelerated, and the economic benefit of pig breeding is effectively improved.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biological technology and molecular marker technology, and particularly relates to a SNP molecular marker related to body length on pig chromosome 1 and application. BACKGROUND

[0002] The body size trait of a pig refers to the body shape characteristics of the pig, including body length, body height, girth, chest circumference, etc. The body size is related to the meat yield of the pig and is one of the important economic traits of the pig. Research shows that the body size trait is related to many important economic traits and reflects the physiological health status of the pig to some extent. Therefore, the body size trait is an important consideration index for a breeder to select breeding pigs, and domestic and foreign pig breeding enterprises establish a scoring system for the body size characteristics of breeding pigs to select breeding pigs with high and uniform body size, robust limbs and well-developed hindquarters.

[0003] The body length is one of the important indexes for measuring the body size of the pig, and the body length is significantly positively correlated with the body height, chest circumference, chest width, eye muscle area, daily weight gain and other important economic traits. Therefore, genetic improvement of the body length of the pig is helpful to improve other important economic traits of the pig. The body length trait is a typical quantitative trait and is regulated by multiple genes. In addition, the heritability of the body length trait is above 0.35, which belongs to medium to high heritability and is easily affected by genetic factors. If the molecular marker assisted selection technology is used to select the body length trait of the pig at an early stage, significant effects can be achieved in a short time and the economic benefits of enterprises can be improved.

[0004] The genome-wide association study (GWAS) refers to searching for significant variation sites related to a trait in the whole genome, which is an effective method for analyzing quantitative traits. The significant variation sites detected by the method can be used for molecular marker assisted selection breeding. The marker density is one of the main factors affecting the statistical efficiency of GWAS. However, the marker sites of commercial chips on the market are generally 50-80 thousand, and the variation sites of the whole genome of the pig are as high as millions. Compared with commercial chips, the whole genome resequencing technology can capture variation sites up to several million, which can greatly improve the statistical efficiency of GWAS.

[0005] At present, the pork consumption in China mainly uses the “Duchangda” (Duroc pig x (Changbai pig x Dabai pig)) mating commercial pig produced by the lean-type breeding pig. Duroc, Changbai and Dabai pigs are the parents of the “Duchangda” commercial pig, and genetic improvement of the body length trait of the “Duchangda” commercial pig can indirectly improve other important economic traits of the pig and bring huge economic benefits to enterprises. SUMMARY

[0006] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present application is to provide a SNP molecular marker related to body length on pig chromosome 1.

[0007] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular markers.

[0008] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers.

[0009] The fourth objective of this invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs, and kits.

[0010] The fifth objective of this invention is to provide a method for detecting the body length trait of pigs.

[0011] The sixth objective of this invention is to provide a method for screening pig breeds with longer body lengths.

[0012] The seventh object of the present invention is to provide a method for genetic improvement of pigs.

[0013] The objective of this invention is achieved through the following technical solution:

[0014] A molecular marker of body length-related SNP located on pig chromosome 1, whose SNP site corresponds to the C>G mutation at 93692371 bp on chromosome 1 in International Pig Reference Genome Version 11.1. The polymorphism of the base at this site affects the body length trait of pigs; among them, the pig body length from largest to smallest is: CC genotype, CG genotype and GG genotype.

[0015] The preferred nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, where M in the sequence is C or G, and this SNP molecular marker affects the body length of pigs.

[0016] The SNP site of the SNP molecular marker is a single base mutation of C220-G220 at position 220 of the sequence marked in SEQ ID NO:1, named g.220 C>G (corresponding to position 93692371 bp on chromosome 1 of International Pig Reference Genome Version 11.1).

[0017] The preferred pigs are American Duroc pigs, Danish Landrace pigs, Danish Large White pigs, or their synthetic lines.

[0018] A primer pair for detecting the above-mentioned SNP molecular markers, comprising primers primer-F and primer-R, has the following nucleic acid sequence:

[0019] Upstream primer-F: 5'-CGTGTGGACCATTCGTCTCT-3';

[0020] Downstream primer primer-R: 5'-ACTCAAAGGCTGAGTTGTGGT-3'.

[0021] A kit for detecting the above-mentioned SNP molecular markers, comprising the above-mentioned primer pairs.

[0022] The kit preferably further comprises PCR reaction buffer, DNA polymerase, dNTPs, and Mg. 2+ At least one of the following.

[0023] The application of the SNP molecular markers, primer pairs, or kits in identifying pig body length-related traits, screening for pig breeds with longer body length, or in the genetic breeding of pig body length-related traits.

[0024] The preferred pigs are American Duroc pigs, Danish Landrace pigs, Danish Large White pigs, or their synthetic lines.

[0025] A method for detecting the body length trait in pigs includes the following steps:

[0026] The SNP sites of the above-mentioned SNP molecular markers on pig chromosome 1 are detected, and the pig body length trait is determined based on whether the single nucleotide of the SNP site is C or G; among them, the pig body length from largest to smallest is: CC genotype, CG genotype and GG genotype.

[0027] The preferred pigs are American Duroc pigs, Danish Landrace pigs, Danish Large White pigs, or their synthetic lines.

[0028] A method for selecting pig breeds with longer body length includes the following steps:

[0029] The SNP sites of the above-mentioned SNP molecular markers on chromosome 1 of pigs were detected. Individuals with the GG genotype at the SNP site were eliminated, while individuals with the CC and CG genotypes at the site were retained. The pig body length from largest to smallest was: CC genotype, CG genotype, and GG genotype.

[0030] The detection method includes the following steps:

[0031] (1) Extract genomic DNA from the pigs to be tested;

[0032] (2) Using the primer pairs mentioned above or the primer pairs in the kit mentioned above as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products;

[0033] (3) Sequencing the PCR amplification products to obtain sequencing results;

[0034] (4) Determine the genotype based on the sequencing results.

[0035] The preferred pigs are American Duroc pigs, Danish Landrace pigs, and Danish Large White pigs, or their synthetic lines.

[0036] A method for genetic improvement of pigs, comprising the following steps:

[0037] The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig herd were identified, and corresponding selections were made based on the SNP molecular markers: the successive generations of breeding pigs were selected for individuals with CC and CG genotypes at chromosome 93692371 bp on chromosome 1 of the International Swine Reference Genome 11.1, and individuals with GG genotypes at this locus were eliminated, so as to increase the frequency of allele C at this locus in each generation, thereby increasing the body length of the pigs.

[0038] The preferred pigs are American Duroc pigs, Danish Landrace pigs, Danish Large White pigs, or their synthetic lines.

[0039] The present invention has the following advantages and effects compared with the prior art:

[0040] (1) This invention takes American Duroc, Danish Landrace and Danish Large White as research objects. Based on genome-wide association analysis and genotype filling strategies and methods, it studies and determines that the SNP molecular marker related to the body length trait of pigs is located at 93692371 bp on chromosome 1 of the International Pig Reference Genome Version 11.1. It is a C>G mutation. The polymorphism of the base at this SNP site is significantly related to the body length trait of pigs.

[0041] (2) Based on the above-mentioned SNP molecular markers, this invention provides a primer pair and kit for detecting the above-mentioned SNP molecular markers. Based on the SNP molecular markers, primer pairs and kits, it is possible to identify pig body length related traits, screen for pig breeds with longer body lengths or use them for genetic breeding of pigs with corresponding body length traits. It also provides specific methods for detecting pig body length traits, specific methods for screening pig breeds with longer body lengths and specific methods for genetic improvement of pigs. This invention establishes a set of efficient and accurate molecular marker-assisted breeding technology (corresponding to the above-mentioned complete set of products and methods). Applying it to the genetic improvement of pig body length traits can increase pig body length, increase enterprise profits and increase core competitiveness.

[0042] (3) This invention solves the problem of genetic improvement of pig body length by using molecular breeding methods. By selecting the superior alleles of the above-mentioned SNPs, the frequency of superior alleles can be increased generation by generation, thereby increasing the body length of pigs and accelerating the progress of pig genetic improvement, thus effectively improving the economic benefits of breeding pigs. Attached Figure Description

[0043] Figure 1 This is a genome-wide association study (GWAS) diagram of the body length trait on chromosome 1 of pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log 10 ( P -value).

[0044] Figure 2 This is a chart analyzing the body length of pigs with different genotypes. Detailed Implementation

[0045] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0046] Example 1 provides a detailed explanation of the process for determining the factors affecting body length traits in this invention.

[0047] (1) Experimental animals

[0048] Experimental pig herd: This invention used a total of 55 American Duroc pigs, 182 Danish Landrace pigs, and 38 Danish Large White pigs. The experimental pig herd used in this invention was the core breeding herd of a certain breeding farm. The pigs had free access to feed and water, and the entire feeding method and rearing conditions were kept consistent, following conventional methods.

[0049] (2) Phenotypic trait determination

[0050] In this invention, all pigs were slaughtered at approximately 190 days of age, and their sex, weight, age, and body length were recorded using conventional methods. Body length was measured as follows: with the pig standing normally, a measuring tape was used to measure the length from the midpoint of the line connecting the base of the pig's ears along the pig's back to the base of its tail; this was the body length.

[0051] (3) Sample collection

[0052] Ear tissue samples from the above-mentioned pig herds were collected, soaked in a 75% ethanol solution, and stored at -20°C for later use.

[0053] Example 2 provides a detailed explanation of the invention process of the gene marker in this invention.

[0054] (1) Extraction of DNA from pig ear-like tissue

[0055] Whole-genome DNA was extracted from the experimental pig herd in Example 1 using the standard phenol-chloroform method. The quality and concentration of the whole-genome DNA from the experimental pig herd were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 ng / μL.

[0056] (2) Pig whole genome genotyping

[0057] ① The ear tissue DNA of the pig herd in Example 1 was resequencing using the DNBseq platform. The average sequencing depth was 10×, and the whole genome resequencing data was obtained in FASTQ format.

[0058] ② Use the default parameters of the FASTP software to perform adapter removal and data quality control on the whole-genome resequencing data obtained in step ①; then use BWA-MEM software to align the sequencing data processed by the FASTP software to the pig reference genome. Sscrofa 11.1 above; then use GATK software to perform SNP and indel calling to obtain genotype data (VCF file) containing information on all mutation sites.

[0059] ③ Use PLINK software (v1.90) to convert the genotype data obtained in step ② into binary files (.fam, .bim, .bed), and then perform quality control to remove SNPs with a detection rate <95%, a minimum allele frequency (MAF) of <1%, or that deviate from Hardy-Weinberg equilibrium (HWE). P ≤10 -6 SNP markers are used to delete SNPs on sex chromosomes.

[0060] (3) Genome-wide association analysis (GWAS)

[0061] This study used a univariate mixture model with GEMMA software to perform GWAS analysis on the pig body length trait. The specific analysis method is as follows:

[0062] ① The first five principal components were obtained by performing principal component analysis (PCA) on the experimental population in Example 1 using GCTA software to correct potential population stratification. The specific method is as follows: taking the genotype data obtained in step (2) as the object, the kinship matrix (GRM) of the experimental population was calculated using the --make-grm function of GCTA software. Then, the first five principal components were extracted using the --pca parameter. The first five principal components, variety, sex, and weight were used as covariates.

[0063] ② Genotype data, phenotypic data, and covariate data were incorporated into the model for association analysis. Furthermore, given the assumption that the number of independent haplotype frames is substantially the same in pigs and humans, and considering that the genomic significance threshold for human-related GWAS analysis was set at 5.00 × 10⁻⁶, [further details are needed]. -8 This invention references the human genome significance threshold, which is 5.00 × 10⁻⁶. -8 The significance threshold at the chromosome level is 1.00 × 10⁻⁶. -6 .

[0064] GWAS analysis results are as follows Figure 1 As shown. From Figure 1It is known that there are sites in pig chromosome 1 that significantly affect pig body length. The most strongly associated SNP site corresponds to the C>G mutation at position 93692371 bp on chromosome 1 of the International Pig Reference Genome Version 11.1 (a single-base mutation of C220-G220 at position 220 of SEQ ID NO:1, named g.220 C>G). P =7.37×10 -9 ).

[0065] (4) Association analysis between different genotypes and pig body length phenotype

[0066] according to Figure 1 As shown in Table 1, the SNP site g.220C>G of the molecular marker was significantly correlated with body length trait. P =7.37×10 -9 This indicates that this molecular marker significantly affects the body length trait in pigs. Assisted selection at this SNP site can increase pig body length, thereby accelerating the breeding process for this trait. Furthermore, according to Table 1... Figure 2 It is also known that the CC genotype has the longest body length, followed by the CG genotype, and the GG genotype has the shortest body length, indicating that the GG genotype is the most unfavorable for pig body length. Therefore, in the breeding process, it is necessary to gradually cull GG genotype breeding pigs and retain CC and CG genotype breeding pigs, especially retaining CC genotype breeding pigs, in order to increase the frequency of allele C at this locus in each generation, thereby increasing the body length of pigs.

[0067] Table 1. Correlation between molecular marker site g.220 C>G and body length trait in pigs.

[0068]

[0069] Note: A total of 275 individuals were used for the analysis, of which 3 individuals had missing genotypes.

[0070] (5) Correlation analysis of body length with other traits

[0071] To analyze the relationship between body length and other important economic traits, Pearson correlation analysis was performed on the phenotypes of body length and other important economic traits in 275 pigs using SPSS software. The results showed (Table 2) that body length was significantly positively correlated with body weight, body height, chest circumference, and leg-hip circumference. P <0.05). It is noteworthy that body length and eye muscle area showed a significant positive correlation ( P <0.01). Eye muscle area is one of the important indicators for measuring lean meat percentage. Generally, the larger the eye muscle area, the higher the lean meat percentage. These results indicate that body length affects pig meat yield. Selective breeding to improve pig body shape and lean meat percentage is beneficial.

[0072] Table 2 Correlation between body length and other traits

[0073]

[0074] Note: P <0.05 (*); P <0.01 (**).

[0075] Example 3 explains in detail the invention process of detecting SNP markers according to the present invention.

[0076] (1) The target fragment containing SNP sites significantly associated with the body length trait of pigs is a 413 bp nucleotide sequence from chromosome 1 (SEQ ID NO:1). The upstream and downstream primers for sequence amplification are primer-F and primer-R, and their nucleic acid sequences are as follows:

[0077] Upstream primer-F: 5'-CGTGTGGACCATTCGTCTCT-3';

[0078] Downstream primer primer-R: 5'-ACTCAAAGGCTGAGTTGTGGT-3'.

[0079] (2) PCR amplification system and conditions

[0080] Prepare a 10 μL system, including 1.0 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR reaction program is as follows: 95°C for 3 min; 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0081] (3) DNA sequence sequencing identification

[0082] Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions (forward and reverse). The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:

[0083] CGTGTGGACCATTCGTCTCTTTTGTCATCACCACTTTTATGAAGACACATTAACACACATGGTTTTAAGAGTAGTCATATTTGTAAAGTATGAGATTAATCTCATATTATACTTAAGTGTTCCAAGAGTGATCAACTGTCAAAAGTTTGGCCAATCAATATTTTTCTCCAGAAATTAGGACTAAGTAGTTCCAGAACAACATGGTTGATCTCCCTAAAA M (C / G) ATGAGATTAAAAAAGTCAGTAATGTCTACTTTCCATGACAGGCATTGGTAAATAAAGTTGCCAGAAGCAAAAGCAAAGATTAAAGCAGGTATAGAAAGAGAAACAGTGATGGGAAACAGAGAAAGAAAATTCTGTGCCCTGAATCATTATTTTAGTCTATTTCTGAGGTAAAACCACAACTCAGCCTTTGAGT

[0084] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The primer binding position is indicated by bolding at the beginning and end of the sequence.

[0085] Example 4: Analysis of the SNP site g.220 C>G effect of molecular markers

[0086] This invention provides a SNP molecular marker that can significantly improve pig body length. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of pig body length traits. Calculations show that in this experimental population, for every 1 cm increase in body length, the weight increases by approximately 1 kg. If this invention selects all GG-type individuals (influencing pig body length) to become CC-type individuals, the average body length of pigs at 190 days of age will increase by 1.71 cm, and the weight by 1.71 kg. If all 10,000 CC-type pigs are selected to become GG-type pigs, an additional 17,100 kg of pork will be produced, resulting in an economic benefit of 270,000 yuan (based on a price of 16 yuan / kg). This demonstrates the enormous potential for body length to generate revenue for the pig farming industry. By selecting the dominant allele (C) of this SNP in the individual pig population using this SNP molecular marker, the overall pig production performance can be improved, thereby increasing the company's profits.

[0087] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting SNP molecular markers associated with body length located on chromosome 1 of pigs in identifying the body length trait or in the genetic breeding of the body length trait in pigs, characterized in that... The SNP molecular markers mentioned above correspond to the C>G mutation at 93692371 bp on chromosome 1 of the International Pig Reference Genome Version 11.

1. The polymorphism of the bases at this site affects the body length trait of pigs; among them, the body length of pigs with CC genotype and CG genotype is greater than that of pigs with GG genotype. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, where M in the sequence is C or G; The pigs mentioned are American Duroc pigs, Danish Landrace pigs, or Danish Large White pigs.

2. The application of a primer pair for detecting SNP molecular markers related to body length located on chromosome 1 of pigs in identifying pig body length traits or in pig body length trait genetic breeding, characterized in that: The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-CGTGTGGACCATTCGTCTCT-3'; Downstream primer primer-R: 5'-ACTCAAAGGCTGAGTTGTGGT-3'; The SNP molecular marker is the SNP molecular marker described in claim 1, and the corresponding pig body length for the SNP molecular marker is: the body length of pigs with CC genotype and CG genotype is greater than that of pigs with GG genotype; The pigs mentioned are American Duroc pigs, Danish Landrace pigs, or Danish Large White pigs.

3. A kit for detecting SNP molecular markers associated with body length located on pig chromosome 1, and its application in identifying pig body length traits or in pig body length trait genetic breeding, characterized in that: The kit comprises the primer pair as described in claim 2; The SNP molecular marker is the SNP molecular marker described in claim 1, and the corresponding pig body length for the SNP molecular marker is: the body length of pigs with CC genotype and CG genotype is greater than that of pigs with GG genotype; The pigs mentioned are American Duroc pigs, Danish Landrace pigs, or Danish Large White pigs.

4. The application according to claim 3, characterized in that: The kit also contains PCR reaction buffer, DNA polymerase, dNTPs, and Mg. 2+ At least one of them.

5. A method for detecting the body length trait of pigs, characterized in that... It includes the following steps: The SNP sites of the SNP molecular markers described in claim 1 on chromosome 1 of pigs are detected, and the body length trait of pigs is determined based on whether the single nucleotide of the SNP site is C or G; wherein, the body length of pigs with CC genotype and CG genotype is greater than that of pigs with GG genotype. The pigs mentioned are American Duroc pigs, Danish Landrace pigs, or Danish Large White pigs.

6. The method according to claim 5, characterized in that: The detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using the primer pair described in claim 2 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, determine the genotype of the SNP site of the SNP molecular marker described in claim 1.

7. A method for genetic improvement of pigs, characterized in that... It includes the following steps: Identify the SNP molecular markers described in claim 1 for breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP molecular markers: select individuals with CC and CG genotypes at chromosome 93692371 bp on chromosome 1 of the International Swine Reference Genome 11.1 for successive generations of breeding pigs, and eliminate individuals with GG genotypes at this locus, so as to increase the frequency of allele C at this locus in successive generations, thereby increasing the body length of pigs; The pigs mentioned are American Duroc pigs, Danish Landrace pigs, or Danish Large White pigs.

Images